Marker foxo1 associated with human synovial membrane aging and application thereof in delaying synovial membrane aging

Abstract

The application discloses a marker FOXO1 related to human synovial membrane aging and application thereof in delaying synovial membrane aging. The application finds that, with aging, angiogenesis and aging-related genes are up-regulated, and genes related to cell adhesion and cartilage development are down-regulated in the aging process by describing aging-related transcriptome changes of different cell types and related regulation networks. In addition, specific cell-cell communication in the aging synovial membrane reflects aging-related inflammation and tissue remodeling, including blood vessel hyperplasia and tissue fibrosis. The application discloses that FOXO1 is a main regulation factor for down-regulating aging DEG, and verifies that FOXO1 is down-regulated in the lining and sublining MSC population of old synovial membrane, and further, knocking out FOXO1 in human mesenchymal stromal cells derived from human embryonic stem cells can find obvious accelerated aging, and the application improves our understanding of joint degeneration, thereby providing information for development of a new therapy aiming at restoring the vitality of old joints.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to FOXO1, a biomarker associated with human synovial aging, and its application in delaying synovial aging. Background Technology

[0002] The synovium is a thin layer of tissue in a joint that secretes synovial fluid. With age, it can cause severe shoulder pain and other joint disorders. Histological changes observed in the synovial tissue are thought to be associated with synovial aging. Chronic inflammation, a characteristic of aging joints observed in the synovium of older individuals, can lead to the disruption of normal tissue structure and function, resulting in tissue damage and degeneration.

[0003] However, previous studies on phenotypes associated with inflammation and tissue remodeling have all been clearly related to disease conditions, primarily focusing on arthritis. For example, the synovial lining in osteoarthritis exhibits low-grade chronic inflammation, mainly mediated by the innate immune system. Other inflammation-related phenotypic features have also been reported in the synovium of the elderly, such as the accumulation of advanced glycation end products (AGEs) and severe oxidative stress. Further research has explored the roles of synovial fibroblasts, macrophages, and endothelial cells in maintaining joint health and disrupting articular cartilage integrity during inflammatory joint diseases. Various molecules that promote inflammation and tissue remodeling are secreted in the diseased synovium, highlighting the molecular mechanisms that have been shown to control the pathological activity of resident synovial cells. Furthermore, studies on the synovium based on single-cell sequencing technology have largely focused on the pathological analysis of arthritis. For instance, in rheumatoid arthritis, the synovial tissue undergoes significant proliferation, inflammation, and invasiveness, ultimately destroying the joint.

[0004] However, the above studies all pertain to the synovium of individuals with arthritis and cannot indicate the phenotypic characteristics and molecular mechanisms of synovial aging in humans. Our understanding of the phenotypic and molecular mechanisms of synovial aging remains insufficient, and further research is needed on the molecular targets mediating synovial aging. It is noteworthy that synovial cells exhibit high heterogeneity in their response to age-related stresses. Therefore, in-depth studies of each cell type in the synovium at single-cell resolution are essential and hold promise for revealing the complex physiological and pathological changes in the synovium of the elderly. Summary of the Invention

[0005] The technical problem this invention aims to solve is how to delay aging.

[0006] In a first aspect, the present invention claims novel uses of substances that protect FOXO1 protein or increase the content and / or activity of FOXO1 protein.

[0007] This invention provides the application of FOXO1 protein or substances that increase the content and / or activity of FOXO1 protein in delaying aging or in the preparation of products that delay aging.

[0008] Secondly, this invention claims protection for a product that delays aging.

[0009] The anti-aging products claimed in this invention include FOXO1 protein or substances that increase the content and / or activity of FOXO1 protein.

[0010] Thirdly, the present invention claims protection for novel uses of substances that reduce the content and / or activity of FOXO1 protein.

[0011] This invention claims protection for the use of substances that reduce the content and / or activity of FOXO1 protein in any of the following D1)-D6):

[0012] D1) Constructing senescent cells;

[0013] D2) Preparation of products for constructing senescent cells;

[0014] D3) Screening or assisting in the screening of drugs that delay aging;

[0015] D4) Products for preparing or assisting in the screening of drugs that delay aging;

[0016] D5) To study or assist in the study of the aging mechanisms of the body, tissues, or cells;

[0017] D6) Prepare products for research or to assist in the research of the aging mechanisms of the body, tissues or cells.

[0018] Fourthly, this invention claims protection for a product whose function is any one of the following E1)-E3):

[0019] E1) Constructing senescent cells;

[0020] E2) Screening or assisting in the screening of drugs that delay aging;

[0021] E3) Research or assist in the research of aging mechanisms of the body, tissues or cells.

[0022] The active ingredient of the product that the present invention claims to have any one of the functions of E1)-E3) is a substance that reduces the content and / or activity of FOXO1 protein.

[0023] Fifthly, the present invention claims protection for novel uses of substances for detecting FOXO1 expression levels.

[0024] The substance claimed in this invention for detecting FOXO1 expression levels is used in identifying or assisting in the identification of aging levels in an organism, tissue, or cell, or in the preparation of products for identifying or assisting in the identification of aging levels in an organism, tissue, or cell.

[0025] Sixthly, the present invention claims protection for a product for identifying or assisting in the identification of the level of aging in an organism, tissue, or cell.

[0026] The products claimed in this invention for identifying or assisting in the identification of the level of aging in an organism, tissue, or cell include substances for detecting the expression level of FOXO1.

[0027] Any of the methods listed below (F1)-F7) also falls within the scope of protection of this invention:

[0028] F1) A method for delaying the aging of an organism, tissue or cell, comprising the step of contacting the organism, tissue or cell with FOXO1 protein or a substance that increases the content and / or activity of FOXO1 protein.

[0029] F2) A method for constructing senescent cells, comprising the step of introducing a substance that reduces the content and / or activity of FOXO1 protein into recipient cells (ex vivo cells);

[0030] F3) A method for screening or assisting in the screening of drugs for delaying aging, comprising the step of screening senescent cells constructed using the method described in F2) for drugs for delaying aging;

[0031] F4) A method for studying or assisting in the study of aging mechanisms of an organism, tissue or cell, including the steps of studying aging mechanisms of an organism, tissue or cell using senescent cells constructed by the method described in F2);

[0032] F5) A method for altering the senescent state of isolated cells, comprising the step of introducing a substance that reduces the content and / or activity of FOXO1 protein into isolated cells;

[0033] F6) A method for promoting cellular senescence, comprising the step of introducing a substance that reduces the content and / or activity of FOXO1 protein into recipient cells (ex vivo cells);

[0034] F7) A method for identifying or assisting in the identification of the level of aging in an organism, tissue or cell, including the step of detecting the expression level of FOXO1 in a sample from a subject.

[0035] In the above method, the senescent cells have at least one of the following characteristics: slowed growth, decreased clonogenic capacity, reduced Ki67 positive cells, S phase arrest, increased reactive oxygen species (ROS) levels, shortened telomeres, increased P16INK4a expression, increased IL6 secretion levels, loss of heterochromatin, decreased expression of heterochromatin-associated proteins HP1α and HP1γ, and abnormal expression of profibrotic and pro-inflammatory factors.

[0036] The alteration of the senescence state of isolated cells is to induce isolated cells to have at least one of the following characteristics: slowed growth, decreased clonogenic capacity, reduced Ki67-positive cells, S-phase arrest, increased reactive oxygen species (ROS) levels, shortened telomeres, increased P16INK4a expression, increased IL6 secretion levels, loss of heterochromatin, decreased expression of heterochromatin-associated proteins HP1α and HP1γ, and abnormal expression of profibrotic and pro-inflammatory factors.

[0037] In any of the above-described applications, products, or methods, the substance that enhances the activity and / or content of FOXO1 protein may be a nucleic acid molecule encoding FOXO1 protein or an expression cassette, recombinant vector, recombinant microorganism, or recombinant cell line containing the nucleic acid molecule.

[0038] In any of the above-described applications, products, or methods, the substance that reduces the activity of FOXO1 protein may be a protein, polypeptide, or small molecule compound that inhibits the function of FOXO1 protein.

[0039] The substance that reduces FOXO1 protein content may be a substance that inhibits FOXO1 protein synthesis, promotes FOXO1 protein degradation, or knocks down or eliminates the FOXO1 gene.

[0040] Furthermore, the substance that knocks down the FOXO1 protein-coding gene can be siRNA or shRNA that inhibits FOXO1 gene expression.

[0041] The substance that knocks out the FOXO1 protein-coding gene can be a FOXO1 gene editing system; specifically, the FOXO1 gene editing system can be a FOXO1 gene editing system based on TALEN gene editing technology.

[0042] In F3 above, the FOXO1 expression level can be the FOXO1 protein expression level or the FOXO1 mRNA expression level.

[0043] The substance used to detect FOXO1 expression level can be a substance used to detect FOXO1 protein expression level or a substance used to detect FOXO1 mRNA expression level. Specifically, it can be a substance used to detect FOXO1 expression level by real-time quantitative PCR, immunofluorescence tissue staining, plasma ELISA, (single-cell) transcriptomics, plasma proteomics or a combination thereof, such as primers that specifically amplify the FOXO1 gene, probes that specifically recognize the FOXO1 gene, antibodies that specifically bind to the FOXO1 protein, etc.

[0044] The above-mentioned method for identifying or assisting in identifying the aging level of an organism, tissue, or cell may specifically include the following steps: measuring the FOXO1 expression level in the sample from the subject; comparing the FOXO1 expression level with a reference value; and identifying or assisting in identifying the aging level of the subject.

[0045] Preferably, the sample is selected from tissue or blood samples, such as whole blood, serum, or plasma.

[0046] Preferably, the reference value is the FOXO1 expression level (or average expression level) in the same type of samples from young, healthy individuals (or groups) with normal synovial function.

[0047] Preferably, when the FOXO1 expression level in the sample from the subject is lower than the reference value, it indicates that the subject is in a state of aging.

[0048] In any of the above-described applications, products, or methods, the delay in aging can refer to delaying the aging of the body, tissues, or cells.

[0049] The organism may be a mammal (such as a human or a mouse).

[0050] The tissue or cells may be synovial tissue or cells (such as human synovial tissue or cells).

[0051] Furthermore, the synovium may be derived from the human acromion.

[0052] The cells may be human mesenchymal stromal cells differentiated from human embryonic stem cells.

[0053] Furthermore, the human embryonic stem cells are the human embryonic stem cell hESCs H9 cell line.

[0054] In any of the above-described applications, products, or methods, the amino acid sequence of the FOXO1 protein is shown in Sequence 1. The nucleotide sequence of the FOXO1 gene is shown in Sequence 2.

[0055] Any of the products mentioned above may be pharmaceuticals.

[0056] This invention utilizes the synovial membrane of both young and elderly individuals, providing novel insights into histological, cellular, and molecular changes. By describing age-related transcriptomic changes in different cell types and their associated regulatory networks, it was found that angiogenesis and age-related genes are upregulated with aging, while genes related to cell adhesion and cartilage development are downregulated during aging. Furthermore, specific cell-cell communications in aging synovium reflect age-related inflammation and tissue remodeling, including angiogenesis and fibrosis. This invention reveals FOXO1 as a major regulator of the downregulation of aging DEGs and validates its downregulation in lining and sublining MSC populations of aged synovium. Further, knocking out FOXO1 in human mesenchymal stromal cells (MSCs) derived from human embryonic stem cells revealed that FOXO1 knockout significantly accelerates cellular senescence. This invention deepens our understanding of joint degeneration, thereby providing information for the development of new therapies aimed at revitalizing joints in the elderly. Attached Figure Description

[0057] Figure 1 This section describes age-related changes in the synovial membrane of the human acromion. a) Schematic diagram of the experimental design for synovial membranes in young and elderly individuals. b) H&E staining of synovial tissues from the young and elderly groups. Scale bars, 50 μm and 10 μm (magnified views). Young group, n = 6; Elderly group, n = 6. c) Immunohistochemical (IHC) staining of CD31 in synovial tissues from the young and elderly groups. Scale bars, 50 μm and 20 μm (magnified images). Young group, n = 6; Elderly group, n = 6. d) SA-β-Gal staining of human synovial tissues from the young and elderly groups. Scale bars, 50 μm and 10 μm (magnified images). Young group, n = 6; Elderly group, n = 6. e) P21, a cellular senescence-related marker, in synovial tissues from the young and elderly groups. Cip1 IHC staining in synovial tissue of young and old groups. Scale bars, 50 μm and 10 μm (magnified images). Young group, n = 6; Old group, n = 6. f shows IHC staining of HERVK in synovial tissue of young and old groups. Scale bars, 50 μm and 10 μm (magnified images). Young group, n = 6; Old group, n = 6. g shows IHC staining of H3K9me3 in synovial tissue of young and old groups. Scale bars, 50 μm and 10 μm (magnified images). Young group, n = 6; Old group, n = 6. h shows IHC staining of S100A8 in synovial tissue of young and old groups. Scale bars, 50 μm and 10 μm (magnified images). Young group, n = 6; Old group, n = 6. i shows IHC staining of S100A9 in synovial tissue of young and old groups. Scale bars, 50 μm and 10 μm (magnified images). For the young group, n=6; for the old group, n=6.

[0058] Figure 2Mononuclear transcriptomic analysis of synovium in young and old groups. a) Distribution of different cell types in synovial tissue of young and old groups. L-MSC: lining mesenchymal stromal cells; SL-MSC: sublining mesenchymal stromal cells; Per: perithelial cells; SMC: smooth muscle cells; EC: endothelial cells; Adi: adipocytes; Mac: macrophages; TC: T cells. b) Expression of representative marker genes for each cell type in synovium. c) Expression profiles of the top 30 marker genes in different cell types in synovial tissue of young and old groups, with enriched functional annotations shown on the right. d) Heatmap and bar graph of Log2FC (left) and number (right) of aging-related DEGs. e) Enrichment pathways of upregulated (left) and downregulated (right) DEGs in all cell types during aging. Dot size indicates the number of DEGs enriched in the corresponding pathway. f) Gene set scores of fibrosis-related genes in different cell types of synovial tissue of young and old groups. g shows IHC staining of COL1A2 in synovial tissue from young and old groups. Scale bars, 50 μm and 10 μm (magnified images). Young group, n = 6; Old group, n = 6. h shows Masson staining of synovial tissue from young and old groups. Scale bars, 50 μm and 10 μm (magnified images). Young group, n = 6; Old group, n = 6. i shows Oil Red O staining of synovial tissue from young and old groups. Scale bars, 50 μm and 12.5 μm (magnified images). Young group, n = 6; Old group, n = 6. j is a circular plot of upregulated and downregulated DEG common to at least four cell types or three cell types.

[0059] Figure 3This section shows cell type-specific transcriptional changes during human synovial aging. a) Age-related DEGs annotated in the Aging Atlas database for different cell types. b) Network diagram of the correlation between age-related DEGs and synovial disease gene sets. Each node represents a gene, and node size indicates the number of cell types sharing the DEG. c) Heatmap of the number of interaction pairs between indicated human synovial cell types in the young and old groups. d) Changes in cell interaction pairs among different cell types during synovial aging. Node size (pixel type) indicates the number of altered cell interaction pairs. Line color indicates the direction of change in interaction events between different cell types. e) Cell-cell interaction pairs during synovial aging. f) Age-specific VCAM1-related cell interaction pairs in specified cell types in the young and old groups. g) Expression levels of VCAM1-related cell-cell interaction pairs in different cell types during synovial aging. h) IHC staining of VCAM1 in synovial tissue of the young and old groups. Scale bars, 50 μm and 10 μm (magnified images). Young group, n = 6; Old group, n = 6. i shows the immunofluorescence staining of CD163 in synovial tissue of the young and old groups. Scale bars, 50 μm and 20 μm (magnified images). Young group, n = 6; old group, n = 6.

[0060] Figure 4 This study analyzes the core transcriptional regulation of synovial aging. a) Core regulatory transcription factors upregulated and downregulated in all cell types during synovial aging. b) Distribution of core transcription factors in different cell types during aging. Dot size indicates the number of target gene hits. c) Expression level of FOXO1 in different cell types during aging. d) IHC staining of FOXO1 in synovial tissues of young and older groups. Scale bars, 50 μm and 10 μm (magnified images). Young group, n=6; Older group, n=6. e) Gene set scores of FOXO1-targeted differentially expressed genes in synovial tissues of young and older groups in each cell type. f) Representative GO pathways of FOXO1-targeted differentially expressed genes during synovial aging.

[0061] Figure 5 FOXO1 does not affect the dryness of hESC. a is FOXO1 + / + hESC and FOXO1 - / - Western blot analysis of FOXO1 in hESC. GAPDH was used as load control. b represents FOXO1 protein blot analysis via whole-genome sequencing. + / + hESC and FOXO1 - / - hESC was used for copy number variation analysis. c represents FOXO1. - / - G-band karyotype analysis of hESCs. d shows immunofluorescence images of pluripotency markers NANOG, SOX2, and OCT4, as well as FOXO1. + / +hESC and FOXO1 - / - Phase contrast image of hESC. Scale bar, 25 μm. e is FOXO1. + / + hESC and FOXO1 - / - Immunofluorescence analysis of Ki67 in hESCs. Scale bar, 20 μm. Statistical analysis of Ki67-positive cells is shown in the right figure. Data are expressed as SEM ± mean. n = 3. Indicative of two-tailed t-test p-value.

[0062] Figure 6 For FOXO1 + / + hESC and FOXO1 - / - hESC differentiates into FOXO1 + / + hMSC and FOXO1 - / - hMSCs, flow cytometry analysis of FOXO1 + / + hMSC and FOXO1 - / - Expression of hMSC-specific markers (CD44, CD73, CD90, and CD105) and hMSC-independent markers (CD34 and CD45) in hMSCs.

[0063] Figure 7 FOXO1 accelerates the senescence of hMSC cells. (a represents FOXO1) + / + hMSCs and FOXO1 - / - Western blot analysis of FOXO1 in hMSCs, with GAPDH used as a control. b represents FOXO1. + / + MSCs and FOXO1 - / - hMSCs growth curves. Data are presented as mean ± SEM values. n = 3 biological replicates. ns, not significant; P < 0.001. c represents FOXO1. + / + hESCs and FOXO1 - / - Monoclonal formation capacity assay of hMSCs. Data are presented as mean ± SEM values. n = 6. Representative data from one of three independent experiments. d represents FOXO1. + / + hMSCs and FOXO1 - / - Immunofluorescence analysis of Ki67 in hMSCs. Scale bar, 20 μm. e represents FOXO1. + / + hMSCs and FOXO1 - / - Cell cycle analysis of hMSCs. f represents flow cytometry analysis of FOXO1. + / + hMSC and FOXO1 - / - ROS levels in hMSC cells. n = 3 biological replicates. g represents RT-qPCR analysis at P16. INK4a P21 Cip1 IL6, VCAM1, and extracellular matrix-related genes in FOXO1 + / +hMSCs and FOXO1 - / - Expression in hMSCs. Data are presented as mean ± SEM values. n = 3 biological replicates. h represents FOXO1. + / + hMSCs and FOXO1 - / - SA-β-gal staining of hMSCs. Scale bar, 50 μm. Data are expressed as mean ± SEM value. n = 3 biological replicates. i represents FOXO1. + / + hMSC and FOXO1 - / - Western blot analysis of p16 INK4a, HP1α, and HP1γ proteins in hMSCs. GAPDH was used as a control. Data are presented as mean ± SEM values. n = 3 biological replicates. j represents DNA-FISH detection of FOXO1. + / + hMSC and FOXO1 - / - Telomere length in hMSCs. Scale bar, 20 μm. Data are expressed as SEM ± mean. n = 100. k is the value of FOXO1 detected by ELISA. + / + hMSC and FOXO1 - / - IL6 secretion in hMSC culture medium. Data are presented as mean ± SEM. n = 3 biological replicates. l represents FOXO1. + / + hMSC and FOXO1 - / - Immunofluorescence analysis of H3K9me3 in hMSCs. Scale bar, 20 μm. Data are expressed as mean ± SEM value. n = 300. m represents FOXO1. + / + hMSC and FOXO1 - / - Expression profiles of overlapping DEGs between sn-RNA sequences (L-MSC & SL-MSC) and bulk RNA-seq. n represents the expression profile of sn-RNAseq (L-MSC & SL-MSC) and FOXO1. + / + hMSC and FOXO1 - / - Representative pathways for upregulation and downregulation of differentially regulated genes among hMSCs. Detailed Implementation

[0064] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0065] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0066] FOXO1 in the following examples + / + hESCs are human embryonic stem cells, specifically the H9 cell line (female, H9ESC), a product of the WiCell Research Institute in Madison, Wisconsin, USA.

[0067] The experimental methods involved in the following embodiments are as follows:

[0068] 1. Human synovial membrane sample

[0069] Synovial samples were collected from patients with partial rotator cuff tears, including individuals from young adults (36.6 ± 0.9 years) and older adults (71.8 ± 1.2 years). All patients underwent arthroscopic surgery to treat the shoulder pathology, while patients who had previously undergone surgery were excluded from the study. This study was approved by the Ethics Committee of Beijing Jishuitan Hospital (Approval No.: Beijing Jishuitan Hospital 201611-03).

[0070] 2. Cell Culture

[0071] FOXO1 + / + hESC and FOXO1 - / - hESCs were seeded on mouse embryonic fibroblast (MEF) feeder cells (MEF feeder cells are described in the literature: Tan YS, Lei YL. Generation and Culture of Mouse Embryonic Fibroblasts. Methods Mol Biol. 2019; 1960: 85-91). These cells were inactivated with mitomycin C (MMC) and maintained in Dulbecco's modified Eagle / F12 (DMEM / F12) medium (Gibco, 11330057) containing 20% ​​knockout serum substitute (Thermo Scientific, A3181502), 5 μM β-mercaptoethanol, 2 mM glutamate (MA), 10 ng / mL bFGF, 1% penicillin / streptomycin, and 0.1 mM non-essential amino acids (NEA) for further in vitro experiments at 37°C and 5% CO2. Unlike hESCs, hMSCs were cultured in MEMα medium (Gibco, 32571-101) supplemented with 10% fetal bovine serum (FBS, Gibco, Cat#10091-148, Lot#22500491P), 1 ng / mL bFGF, 0.1 mM NEAA and 1% penicillin / streptomycin.

[0072] 3. FOXO1 gene knockout hESC (FOXO1 - / -Preparation of hESC)

[0073] FOXO1 gene knockout hESC cells were prepared using TALEN-mediated gene targeting technology. The specific steps are as follows: Following the literature "Liu GH, Suzuki K, Li M, Qu J, Montserrat N, Tarantino C, Gu Y, Yi F, Xu X, Zhang W, Ruiz S, Plongthongkum N, Zhang K, Masuda S, Nivet E, Tsunekawa Y, Soligalla RD, Goebl A, Aizawa E, Kim NY, Kim J, Dubova I, Li Y, Ren R, Benner C, DelSol A, Bueren J, Trujillo JP, Surralles J, Cappelli E, Dufour C, Esteban CR, Belmonte JCI. Modelling Fanconi anemia pathogenesis and therapeutics using integration-free patient-derived iPSCs. Nat Commun. 2014 Jul The method described in 7;5:4330.doi:10.1038 / ncomms5330.PMID:24999918;PMCID:PMC4291073.” uses TAL2322 (Addgene, Plasmid #36748) and TAL2323 (Addgene, Plasmid #36749) to construct TALEN plasmids (FOXO1-TALEN_Left and FOXO1-TALEN_Right) for the human FOXO1 gene. The 1.2-1.3kb homologous arms (primer sequences for the homologous arms are as follows: FOXO1 Left Arm Primer F: ATAGGGCCCCATTGGTGTTATAGGTTCTCTGTGCCTGCCTCGTC; FOXO1 Left Arm Primer R: CCGCTCGAGAATCTCCCGCTCCGTCCACTAAGTCCAG; FOXO1 Right Arm Primer) are then used to construct the TALEN plasmids (FOXO1-TALEN_Left and FOXO1-TALEN_Right) for the human FOXO1 gene. F: CGCGGATCCTTCCTGCCTTGCCACCCTATTCTTGAGCAT; FOXO1Right Arm Primer R: CGGGGTACCAAGGCACTCCAGCAAGTTGAAGTAGGTTGTATCCA.The donor plasmid was created by combining it with a resistance kit (neo or puro). In the first round of gene knockout, H9 ESCs were digested using TrypLE (Invitrogen) and filtered through a 40 μm cell filter to remove cell clumps. The cells were then resuspended in 1 mL of MEF conditioned medium supplemented with 10 mM ROCK inhibitor (MEMα medium (Gibco, 32571-101) containing 10% fetal bovine serum (FBS, Gibco, Cat#10091-148, Lot#22500491P), 0.1 mM NEAA (Gibco, 11140076), 2 mM GlutaMAX (Gibco, 35050079), and 1% penicillin / streptomycin (Gibco, 15140-163)). The plasmids (comprising 10 μg FOXO1-TALEN_Left, 10 μg FOXO1-TALEN_Right, and 30 μg donor plasmid) were then mixed with the cell suspension and electroporated. After electroporation, the cells were seeded into 100 mm culture dishes containing mouse embryonic fibroblasts (MEFs, Invitrogen, Inc., catalog number: S1520-100). Two days after electroporation, G418 (50 mg / mL) was added to the culture medium. After 14–21 days, G418-resistant clones were manually picked into 96-well plates for amplification and genotyping. Heterozygous knockout clones were identified and used in the subsequent round of gene knockout. In the second round of gene knockout, the same procedure was repeated using a puromycin-resistant donor and puromycin selection (1 mg / mL) to obtain FOXO1. - / - hESC cells. Compared with hESC(FOXO1) + / + Compared to hESC cell genomic DNA, FOXO1 - / - The only difference between hESC cells is the deletion of the FOXO1 gene (the FOXO1 gene is deleted on all homologous chromosomes).

[0074] 4. Differentiation of hMSCs

[0075] hESC-derived embryos were seeded onto six-well plates coated with matrix gel and cultured for approximately 14 days in hMSC differentiation medium (MEMα medium (Gibco, 32571-101) containing 10% fetal bovine serum (FBS, Gibco, Cat#10091-148, Lot#22500491P), 1% penicillin / streptomycin (Gibco, 15140-163), 1 ng / ml bFGF (Joint Protein Central, 100120), and 5 ng / ml TGFβ (Stem Immune, HST-TB1-1000)). The differentiation medium was changed every other day until the fibroblast-like cells were almost confluent. The cells were then transferred to hMSC medium (MEMα medium containing 10% fetal bovine serum (FBS, Gibco, Cat#10091-148, Lot#22500491P), 1 ng / mL bFGF, 0.1 mM NEAA and 1% penicillin / streptomycin (Gibco, 32571-101)) and cultured for a further period. The derived hMSCs were sorted using a fluorescence activated cell sorting system (FACS) (BD FACS Influx) and CD73, CD90 and CD105 triple-positive cells were collected for further experiments. The sorted hMSCs were analyzed by flow cytometry using the following antibodies: CD34 (BD Biosciences, 555821), CD45 (BioLegend, 103108), CD44 (BD Biosciences, 550989), CD73 (BD ​​Biosciences, 550257), CD90 (BD Biosciences, 555595), and CD105 (BD Biosciences, 17-1057-42).

[0076] 5. CNV Analysis

[0077] FOXO1 was extracted using the DNeasy Blood and Tissue Kit (Qiagen). + / + hESC and FOXO1 - / - Genomic DNA from hESC was extracted. The extracted genomic DNA was sonicated, and Illumina's DNA Library Preparation Kit (NEB) was used to construct the sequencing library. The genome was then divided into consecutive 500kb windows with read counters, and computation was performed. Corrections for GC content and mappability were assessed using HMM copy analysis.

[0078] 6. Monoclonal formation ability test

[0079] 3,000 cells were cultured in 12-well plates coated with 0.1% gelatin for approximately 13 days, until the cells were nearly confluent. Cells were then fixed with 4% paraformaldehyde (PFA) for 20 minutes, washed three times with PBS, and stained with 0.2% crystal violet (Biohao, C0520) for 1 hour at room temperature, followed by washing with tap water. The 0.2% crystal violet solution was filtered through a 0.45 μm filter before use. Relative cell density was quantified using ImageJ software.

[0080] 7. SA-β-gal staining

[0081] Human synovial tissue sections (10 μm frozen sections) were brought to room temperature. hMSCs grown in 6-well plates were washed once directly with PBS and fixed for 5 minutes at room temperature with 0.2% glutaraldehyde and 2% formaldehyde fixative. The samples were then stained with 1 mg / mL X-gal staining buffer at 37°C for 12 hours. They were then mounted with 70% glycerol. Images were acquired using an Olympus VS200 system.

[0082] 8. Masson staining

[0083] Paraffin-embedded synovial sections were dewaxed with xylene and rehydrated with a gradient of alcohols and tap water. Masson's trichrome staining (Solarbio, G1340) was performed according to the manufacturer's instructions. Images were acquired using an Olympus VS200 system.

[0084] 9. HE staining

[0085] Human synovial histological sections were fixed with PFA, dehydrated, and then embedded in paraffin. The paraffin-embedded synovial sections (5 μm thick) were dewaxed with xylene and hydrated with gradient concentrations of alcohol and distilled water. The sections were counterstained with hematoxylin for 5 minutes, washed with tap water for 5 minutes, then reverse-stained with eosin, and dehydrated for 1 minute each with 50%, 95%, and 100% alcohol, respectively, before clearing with xylene. Images of the stained sections were captured using an Olympus microscope.

[0086] 10. Immunohistochemical staining

[0087] Paraffin sections were deparaffinized and rehydrated, then microwaved for 25 minutes in citrate buffer (pH 6.0) for antigen retrieval. They were then permeabilized in PBS with 0.3% Triton X-100 for 1 hour, followed by incubation in 5% blocking buffer (donkey serum, 017-000-021; Jackson) at room temperature for 1 hour. Primary antibody was incubated overnight in a humidified chamber at 4°C. Incubation with 3% H₂O₂ for 15 minutes was then performed to inactivate endogenous peroxidase. Sections were washed three times with PBS and incubated with secondary antibody for 1 hour according to the manufacturer's instructions. X-ray development was then performed using a DAB kit (ZSGB-BIO), followed by counterstaining with hematoxylin. Finally, sections were dehydrated and mounted with neutral resin. Images were taken using an Olympus VS200 system.

[0088] 11. Oil Red O staining

[0089] Oil Red O (Sigma-Aldrich, #O1391) stock solution was mixed with water at a ratio of 3:2 to prepare the Oil Red O working solution, which was then filtered through a 0.45 μm filter to remove impurities. OCT-embedded synovial membrane sections were stained with the Oil Red O working solution at room temperature for 15 minutes. The slides were washed twice with distilled water and then counterstained with hematoxylin. Images were acquired using an Olympus VS200 system, and the area of ​​the lipid droplets was quantified using ImageJ software.

[0090] 12. Immunofluorescence staining

[0091] Pretreatment of immunofluorescence samples was the same as that for immunohistochemical staining. Antigens were repaired by microwave heat treatment in citrate buffer (pH 6.0) for 25 minutes, followed by permeabilization with 0.3% Triton X-100 in PBS for 1 hour. The samples were then placed in 5% blocking buffer (ordinary donkey serum, 017-000-021; Jackson) and treated with primary antibody for 1 hour at room temperature. The primary antibody was incubated overnight at 4°C. Slides were washed three times with PBS and incubated with secondary antibody Alexa Fluor 488 or Alexa Fluor 594 at room temperature in the dark for 1 hour. Cell nuclei were labeled with Hoechst 3334. Finally, images were captured using a Zeiss LSM900 confocal laser scanning microscope system.

[0092] 13. DNA Fluorescence In Situ Hybridization (DNAFISH)

[0093] Cells were fixed with 4% paraformaldehyde for 10 minutes at room temperature and washed three times with PBS. Cells were then treated with prehybridization buffer at 60°C for 2 hours. Cells were then incubated overnight at 37°C with hybridization medium containing telomere probes. The next day, cells were incubated in fluorescent hybridization medium at 37°C for 1 hour. Finally, cell nuclei were counterstained with Hoechst 33342 (Invitrogen, H3570). Images were captured using a Zeiss LSM900 confocal microscopy system and analyzed using ImageJ software.

[0094] 14. Enzyme-linked immunosorbent assay (ELISA)

[0095] Following the manufacturer's instructions, use the ELISA kit (Biolegend, 430504) to test for FOXO1. + / + hMSCs and FOXO1 - / - The IL-6 content in the conditioned medium of hMSCs was analyzed. Detection was performed using Synergy H1 (BioTek) at 450 nm. Finally, the results were quantified by cell count for data analysis.

[0096] 15. Cell cycle analysis

[0097] Collect FOXO1 + / + hMSCs and FOXO1 - / - hMSCs were fixed overnight in 75% ethanol at -20°C. Cells were then washed with PBS and centrifuged at 3000 rpm for 5 minutes, followed by staining at 37°C for 30 minutes in a buffer containing 0.2 mg / mL RNase A, 0.02 mg / mL propidium iodide, and 0.1% Triton X-100. Samples were then analyzed directly using an LSR Tortessa Cell Analyzer (BD), and data were analyzed using ModFit software.

[0098] 16. Measurement of reactive oxygen species

[0099] Reactive oxygen species (ROS) levels were detected using CM-H2DCFDA (Invitrogen, #C6827) dye. Cells were incubated with 2.5 μM CM-H2DCFDA at 37°C in the dark for 20 min, and then analyzed by BD LSRFortessa flow cytometry.

[0100] 17. Protein blotting

[0101] FOXO1 cultured in 6-well plates + / + hMSCs and FOXO1 - / -hMSCs were lysed on ice for 30 min with 120 μL of radioimmunoprecipitation (RIPA) buffer (Invent, IN-WB001) containing a protease inhibitor (Roche, 4693159001) and a phosphatase inhibitor (Roche, 4906837001), followed by centrifugation at 13,500 × g for 15 min at 4 °C. The supernatant was collected in 1.5 mL EP tubes, and protein concentration was measured using a BCA protein quantification kit (Dingguo Changsheng Biotechnology, BCA02). Samples were then separated by SDS-PAGE and electrotransferred to a 0.2 μm PVDF membrane (Millipore, ISEQ00010). The membrane was then incubated with 5% (w / v) skim milk blocking buffer at room temperature for 1 h, followed by overnight incubation with primary antibody at 4 °C. After multiple washes, the membrane was incubated with HRP-conjugated secondary antibody at room temperature for 1 h. Imaging was performed using the ChemiDoc XRS+ system (Bio-Rad), and protein band intensity data were analyzed using ImageJ. The following primary antibodies were used: anti-P16INK4a (BD Bioscience, 550834), anti-GAPDH (Santa Cruz, sc-365062), anti-HP1α (Cell Signaling Technology, 2616), anti-HP1γ (Cell Signaling Technology, 2619), HRP-conjugated goat anti-mouse IgG (Jackson ImmunoResearch Laboratories, 115-035-003), and HRP-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, 111-035-003).

[0102] 18. Quantitative Reverse Transcription PCR (RT-qPCR) assay

[0103] RT-qPCR using Thunderbird SYBR qPCR Mix (TOYOBO) in QuantStudio TM 5. Real-time quantitative PCR was performed on an Applied Biosystems system. Total RNA was extracted using TRIzol, and cDNA was synthesized using 2 μg of RNA on a GoScript reverse transcription system (Promega) according to the manufacturer's instructions. qPCR was performed using a CFX384 real-time system (Bio-Rad Laboratories, Inc.). The relative expression of each gene was normalized using GAPDH transcripts.

[0104] 19. Nuclear isolation and snRNA-seq on the 10x genomics platform

[0105] Frozen synovial tissue was rapidly ground into powder in a mortar using liquid nitrogen, and then 1.5 mL of lysis buffer was added. The cell lysis buffer consisted of nuclease-free water and 0.1% Triton X-100, 250 mM sucrose, 5 mM MgCl2, 25 mM KCl, 10 mM Tris buffer, 0.4 U / μL RNaseIn, 1 μM dithiothreitol, 0.2 U / μL Superasin, and 1× protease inhibitor. The sample was filtered through a 40 μm cell filter (BD Falcon), centrifuged at 500×g for 8 min at 4 °C, and then resuspended in 1×PBS supplemented with 0.1% BSA, 0.2 U / μL Superasin, and 0.4 U / μL RNaseIn. Cell nuclei were stained with Hoechst 33342 and propidium iodide (PI), and double-positive nuclei were sorted by FACS (BD inflow). Single-nucleus capture was performed on merged nuclei from synovial tissue of the same sex (n=8) using the 10x Genomics Single-Cell 3' system. At least 9,000 nuclei were captured from each sample according to the standard 10x capture and library preparation protocol (10x Genomics), and then sequenced on a NovaSeq 6000 sequencing system (Illumina, 20012866).

[0106] 20. Quality control and preprocessing of snRNA-seq data

[0107] FASTQ files were mapped to the human reference genome (hg19), and a counting matrix was generated using Cell Ranger software. Cellbender (version 0.2.0) (https: / / github.com / broadinstitute / CellBender) was then used to remove potential bias from background mRNA in each sample. Low-quality cells were further filtered using the R package Seurat (V4.1.1) (Hao et al., 2021). To ensure data reliability, nuclei with a mitochondrial gene proportion greater than 2.5% or fewer than 200 genes were excluded. DoubletFinder (version 2.0.3) was used to remove bimodalities across the entire dataset. Finally, 19,892 high-quality nuclei, with a median of 2,182 gene expressions detected per cell, were retained for downstream analysis.

[0108] 21. Integration, clustering, and identification of cell types

[0109] Seurat (version 4.1.1) was used for linear dimensionality reduction. First, each sample dataset was normalized using Seurat's "SCTransform" function. To identify ensemble anchors, the "PrepSCTIntegration" and "FindIntegrationAnchors" functions were applied. Using these anchors, the datasets for all samples were integrated using the "IntegrateData" function. Principal component analysis (PCA) dimensions were calculated using the "RunPCA" function, and important components were identified using the "ElbowPlot" and "DimHeatmap" functions. The first 17 principal components were used for downstream analysis, and cluster units were dimensionality reduced using the "FindNeighbors" and "FindClusters" functions. Each cluster was identified as a distinct cell type by the expression of classic cell type marker genes.

[0110] 22. Identification of differentially expressed genes and analysis of gene function

[0111] The Seurat "FindMarkers" function and Wilcoxon rank-sum test were used to analyze the calculation of age-related differentially expressed genes (DEGs) in human synovial tissue of different cell types in elderly and young groups. Genes with |Log2FC|2FC|>0.25 and P-value <0.05 were defined as age-related DEGs.

[0112] 23. Gene Ontology (GO) Analysis

[0113] Metascape (version 3.5) (http: / / metascape.org) was used to enrich GO terms / pathways related to genes. Results were visualized using the networkD3 R package or Cytoscape (version 3.7.2).

[0114] 24. Analysis of Transcription Factor (TF) Regulatory Networks

[0115] Core regulatory transcription factors were predicted based on snRNA-seq data. Transcription factor-binding genomes were identified using the GENIE3 R package (version 1.6.0) and the RcisTarget database (version 1.6.0) of SCENIC (version 1.1.2.2) with default options (http: / / scenic.aertslab.org / ). Using the hg19RcisTarget database with genome-wide ranking, RcisTarget identified and predicted abundant transcription factor-binding genomes and candidate target genes. Gene regulatory networks were created using DEG for different cell types using GENIE3 (version 1.6.0). The transcription regulatory networks were displayed using Cytoscape (version 3.7.2).

[0116] 25. Analysis of intercellular interactions

[0117] Cell-cell interaction analysis was performed using CellphoneDB software (version 1.1.0). Further analysis evaluated ligands and receptors expressed in more than 10% of cells within a given cell type. Cell-cell communication was further predicted for each group using ligand-receptor pairs with a p-value <0.01 by comparing the mean expression of each ligand-receptor pair across different cell types.

[0118] 26. Bulk RNA-seq analysis

[0119] The raw RNA-seq data were trimmed using Trim Galore. Sequencing reads were then mapped to the hg19 genome using HISAT2 software (version 2.1.0). The mapped data were counted using HTSeq (version 0.13.5). DEGs were identified using DESeq2 (version 1.2.4), with a Benjamini-Hochberg adjusted p-value < 0.05 and Log2FoldChange > 0.5. ClusterProfiler (version 4.6.0) was used for gene set enrichment analysis (GSEA).

[0120] Example 1: FOXO1, a biomarker associated with human synovial aging, was discovered based on single-cell nuclear sequencing technology.

[0121] I. Age-related phenotypes of the human synovial membrane

[0122] To investigate age-related physiological changes in the subacromial bursa using histological analysis, this invention collected synovial tissue from young and elderly individuals from the basal layer of the subacromial bursa near the supraspinatus tendon. Figure 1 a). By comparing different anatomical regions of the subacromial synovium (including the lining (L) and sublining (SL)), significant changes were found in the synovium of the elderly. At the structural level, angiogenesis in the subsynovial layer increases with age, while intimal hyperplasia is particularly increased in the lining. Figure 1 (b, c) By examining senescence markers of senescent synovial cells, it was found that both the lining and sublining of aged synovium had a higher proportion of senescence-associated β-galactosidase (SA-β-Gal) positive cells. Figure 1 d). Similarly, the cellular senescence marker p21 Cip1 The presence of human endogenous retrovirus-K (HERV-K) positive cells in senescent synovium is increased. Figure 1(e, f) indicates the accumulation of senescent cells in the synovial membrane during aging. The loss of heterochromatin and the reduction of the heterochromatin-associated protein HP1γ are associated with cellular senescence and age-related diseases. Observations revealed that both the heterochromatin marker H3K9me3 and the heterochromatin-associated protein HP1γ were downregulated in cells within the lining and sublaminar layers of the senescent synovium. Figure 1 g). It is known that the accumulation of senescent cells is associated with pro-inflammatory processes in various organs; therefore, the expression of inflammatory factors in the synovium of aging patients was further investigated. An increase in the number of infiltrating immune cells was observed in the synovial tissue of aging patients, such as an increased proportion of CD45-positive immune cells, and an increase in the expression of S100A8 and S100A9 (which are usually expressed in activated neutrophils or macrophages in response to inflammatory stimuli) in the synovium of aging patients. Figure 1 (h, i). The above histological analysis results reveal multifaceted age-related changes in the subacromial membrane of older adults.

[0123] II. Transcriptomic analysis of the subacromial membrane in young and elderly individuals

[0124] Numerous studies have reported the presence of diverse cell populations in the synovium, including synovial cells, vascular cells, and immune cells. To address cell type-specific transcriptional changes in the human synovium during aging, single-nuclear RNA sequencing (snRNA-seq) was performed on synovial samples from the acromion of young and elderly individuals. Figure 2 a). After rigorous filtering, 18,982 high-quality single-nuclear transcriptomes were retained, with a median of 2,182 genes per cell, for subsequent analysis. Figure 2 a). After visualization using UMAP, eight cell types were annotated and characterized based on the expression of classic cell type-specific marker genes. Figure 2 a). All major synovial cell types were identified, including lining mesenchymal stromal cells (PRG4). + CRTAC1 + FN1 + L-MSCs (n=860 cells), subliner mesenchymal stromal cells (GSN) + VCAN + FBLN1 + SL-MSCs (n=10,566 cells), pericytes (RGS5) + TRPC6 + Per, n=1, 191 cells), smooth muscle cells (MYH11) + ACTA2 + SMC (n=351 cells), endothelial cells (FLT1) + VWF +EC (n=2,280 cells), adipocytes (ADIPOQ+, KLB+, Adi, n=674 cells), macrophages (MSR1) + CD163 + CD86 + Mac cells (n=2,832) and T cells (PTPRC) + CD69 + CD247 + (TC, n=228 cells) Figure 2 b). Functional enrichment analysis of the top 50 cell-type-specific marker genes for each cluster provides insights into their unique physiological functions, as shown by transcriptional features associated with these functions. Figure 2 c). Specifically, L-MSCs and SL-MSCs represent functionally distinct mesenchymal stromal cell types. L-MSCs express genes associated with NABA core matrix and O-linked glycosylation, including specific expression of PRG4, a highly glycosylated protein that acts as a lubricant in synovial fluid. Conversely, SL-MSCs express genes associated with adhesion foci and extracellular matrix tissue, such as VCAN, a key component of the extracellular matrix involved in cell attachment, growth, and migration. Overall, the above analysis of young and aged synovial cells provides a detailed cellular landscape, highlighting the heterogeneity and functional diversity of different mesenchymal stromal cells under synovial joint homeostasis.

[0125] III. Cell type-specific and common transcriptional changes during synovial aging

[0126] By calculating differentially expressed genes (DEGs) associated with aging in different synovial cell types (Log2 [fold change] > 0.25, P value < 0.05), it was found that SL-MSCs and Mac cells had the most aging-responsive DEGs (293 and 278 upregulated DEGs, respectively, and 204 and 167 downregulated DEGs, respectively). Figure 2 d). Gene ontology (GO) and functional enrichment analyses of these aging DEGs showed that, compared with young cells, genes associated with angiogenesis, response to TGFβ, lymphocyte activation, and collagen fibrillary tissue in most identified cell types of aging synovium were upregulated. Figure 2 e). To further assess the fibrosis status of aging synovium, gene set scoring analysis was performed on fibrosis-related genes, and elevated gene expression levels were observed in most identified cell types, particularly in SL-MSCs. Figure 2 f). Furthermore, the expression of fibrosis marker genes (such as COL1A2) was significantly enhanced in six of the eight identified cell types. Figure 2f, g). Masson's trichrome staining and COL1A2 immunohistochemical staining further confirmed the increased fibrosis of the senile synovial sublining. Figure 2 Specifically, genes rich in FCERI signaling, TNFα signaling, and lipid storage regulation were upregulated in Mac (g, h). Figure 2 e). Based on changes in gene expression, fatty infiltration was observed to be a histological change associated with synovial aging. Figure 2 i). Furthermore, the expression of genes associated with the Wnt signaling pathway was particularly upregulated in older EC patients, consistent with angiogenesis observed in aged synovium. Figure 2 e). Consistent with the histological finding of senescent cells accumulating in senescent synovium ( Figure 1 (d, e) Gene set scoring analysis showed that the expression of aging-associated secretory phenotype-related genes (SASP gene set) was generally increased in various cell types, especially in L-MSCs and Mac. Batch sequencing of synovial samples further confirmed the FCERI-mediated enhanced NF-κB activation and immune response observed in snRNA-seq analysis.

[0127] Conversely, downregulated genes common to different synovial cell types are mainly involved in cell projection or junctional tissues, cytochemical homeostasis, and cartilage development. Figure 2 e). Notably, the gene RPL31, which encodes ribosomal proteins, was identified as a highly downregulated DEG in six of the eight identified cell types. Figure 2 (j) Although RPL31 has been reported to be important in the regulation of osteogenic differentiation and has been identified as one of the most important dysregulated genes in the synovium of patients with rheumatoid arthritis (RA), the exact role of RPL31 in synovial aging or disease remains to be explored.

[0128] A joint analysis of synovial aging DEGs and the Aging Atlas Database (2021) revealed that gene expression characteristics of aged synovium are associated with inflammation and the pathogenesis of osteoarthritis (OA). Figure 3 a). For example, EGR1, a risk factor for osteoarthritis, is highly expressed in most synovial cells of aging samples, while the major circadian rhythm gene ARNTL is downregulated in both MSC cell types. Furthermore, VEGF-C, a potential drug target for inflamed synovium in osteoarthritis, is significantly downregulated in L-MSCs. Figure 3 a). Further assessment of genetic risk variants associated with the heritability of osteoarthritis ( Figure 3(b) It was noted that NAMPT was upregulated in synovial cells during aging. Similarly, FN1, which encodes a glycoprotein present on the cell surface or in the extracellular matrix associated with synovial osteochondromatosis and synovitis, was upregulated in different synovial cell types during aging. These data reveal a potential molecular association between aging and joint disease.

[0129] IV. Core Regulatory Factors of Transcriptional Changes in Aging Synovium

[0130] To characterize the cellular processes guiding synovial aging, intercellular communication analysis was performed using CellphoneDB. This analysis allowed for the examination of interactions between different cell types based on paired ligand-receptor gene expression. Figure 3 c). Overall, it was found that intercellular interactions among different cell types within synovial tissue are enhanced during aging, with SL-MSCs showing the most significant changes. Figure 3 d). When GO analysis was used to focus on intercellular interactions that increase with age, these interactions were found to be primarily enriched in pathways related to chemotaxis, collagen formation, and angiogenesis, while those that decrease with age were primarily enriched in pathways related to chondrocyte development and osteoblast differentiation. Figure 3 Notably, VCAM1 plays a crucial role in leukocyte chemotaxis and adhesion, and is significantly upregulated in L-MSCs during senescence. Figure 3 e.g., simultaneously, integrins (encoded by ITGA4 and ITGA9), as VCAM1 interacting partners, are primarily enhanced in immune cells (such as macrophages) of aging synovium. Figure 3 f). It has been reported that monocyte migration to the synovium, as an initiating step in synovitis, is primarily triggered by integrin activation and chemotaxis; therefore, this enhanced interaction between VCAM1 and integrins suggests that monocyte adhesion and migration to the synovial lining contributes to initiating an inflammatory response. Furthermore, this invention also detected an approximately 10-fold increase in VCAM1-positive cells in the synovial lining of older individuals. Figure 3 The number of macrophages also increases with age, and they exhibit aggregation near L-MSCs in the aging synovial lining. Figure 3 i).

[0131] Next, SCENIC analysis was used to identify transcription factors that cause transcriptional changes in different cell types in the subacromial membrane of the elderly. Figure 4 a, b). Key regulators of senescent DEG include NFATC1 (in SL-MSCs and ECs), a gene known to promote osteoclast differentiation, and SOX5 (in ECs), which plays a central role in the transcription of immune-related genes in the synovium. Figure 4a). Notably, both NFATC1 and SOX5 have been reported to be upregulated in the joints of patients with OA or RA. For the downregulated senescent DEG, the most significantly downregulated regulator was found to be FOXO1, which was reduced in most synovial cells, including L-MSCs and SL-MSCs (a). Figure 4 The downregulation of FOXO1 in the lining and sublining of aging synovium was verified by immunostaining. Figure 4 d). Further GO and functional enrichment analyses showed that genes associated with cartilage development and hormone response, such as FOXO1 target genes, were also downregulated during synovial aging. Figure 4 (e, f). These data suggest that downregulation of FOXO1 is a mechanism leading to abnormal regulation of synovial membranes in the elderly. Importantly, FOXO1 is known to regulate the gene expression of VCAM1 as a transcriptional repressor, and the upregulation of VCAM1 in aged MSCs of synovial membranes may be attributed to decreased FOXO1 expression.

[0132] Example 2: FOXO1 depletion accelerates hMSC cellular senescence.

[0133] I. FOXO1 does not affect the dryness of hESC.

[0134] To explore the potential regulatory role of FOXO1 in synovial cells, this invention uses transcription activator-like effector nuclease (TALEN)-mediated homologous recombination (HR) gene editing to knock out FOXO1 in human embryonic stem cells (hESCs), obtaining FOXO1... - / - hESC. Western blot analysis confirmed that FOXO1 had been knocked out. Figure 5 a) while genome-wide copy number variation (CNV) analysis showed that the genome in FOXO1 - / - Stable in hESC, and karyotype analysis is also normal. Figure 5 (b, c). Furthermore, the morphology and expression of pluripotency markers, including NANOG, SOX2, and OCT4, in FOXO1 - / - It's also normal in hESC ( Figure 5 d), and FOXO1 was detected by Ki67 immunofluorescence staining. + / + hESC and FOXO1 - / - There was no difference in cell proliferation capacity among hESCs. Figure 5 e). In summary, these data indicate that FOXO1 does not affect the maintenance of the pluripotency of hESCs.

[0135] II. FOXO1 depletion accelerates the senescence of hMSC cells.

[0136] To elucidate the function of FOXO1 in synovial cells, FOXO1 was... + / +hESCs and FOXO1 - / - hESCs differentiate into synovial cell-like mesenchymal stromal cells (hMSCs), FOXO1 + / + hMSC and FOXO1 - / - hMSCs all expressed comparable levels of mesenchymal progenitor cell markers CD73, CD90, and CD105, and lacked the expression of hMSC-irrelevant antigens CD34 and CD45 as previously mentioned. Figure 6 Western blot analysis confirmed the absence of FOXO1 in hMSCs. Figure 7 a). With FOXO1 + / + Compared to hMSCs, FOXO1 - / - hMSCs exhibited slowed cell growth, decreased colony-forming ability, reduced Ki67-positive cells, and arrested in S phase. Figure 7 be). Downregulation of FOXO1 significantly increases reactive oxygen species (ROS) levels. Figure 7 f), and leads to an increase in aging-associated galactosidase (SA-β-gal) positive cells. Figure 7 h). Typical indicators of cellular senescence, including FOXO1, were also observed. - / - telomere shortening and increased P16INK4a expression in hMSCs Figure 7 g, i, j). Similarly, this invention also detected the upregulated expression of a group of SASP genes, such as IL6 (g, i, j). Figure 7 g), at the same time, IL6 in FOXO1 - / - The secretion level in hMSCs also increased ( Figure 7 Furthermore, this invention also found that FOXO1 deficiency leads to the loss of heterochromatin in hMSCs (k). Figure 7 l). Meanwhile, FOXO1 was detected by Western blot analysis. - / - The expression of heterochromatin-associated proteins HP1α and HP1γ was decreased in hMSCs. Figure 7 i). In summary, the above results indicate that the lack of FOXO1 accelerates the aging of hMSCs.

[0137] Consistent with the above observations, RNA-seq data from this invention indicate that FOXO1 deficiency induces transcriptomic features similar to those observed in the human synovial transcriptome during aging. Of the 103 senescent DEGs found in L-MSCs or SL-MSCs, hMSCs also underwent changes following FOXO1 deficiency, including 62 upregulated genes and 41 downregulated genes. Figure 7 Furthermore, FOXO1-deficient hMSCs and upregulated DEGs in aged synovium are enriched in angiogenesis (EPAS1, ANGPTL4), chemotaxis (VCAM1, SEMA3C), and inflammatory response pathways (IL6, HIF1A). Figure 7 The genes enriched in m, n) and downregulated genes enriched in chondrogenesis (BMP2, SOX6) and response to oxidative stress (ARNTL, NQO1). Figure 7 Furthermore, RNA sequencing further confirmed FOXO1. - / - Abnormal expression of profibrotic and pro-inflammatory factors in hMSCs ( Figure 7 g).

[0138] In summary, the research of this invention shows that downregulation of FOXO1 will become an important regulator of aging-related transcriptomic changes in the synovium. FOXO1 plays an important role in synovial cells, protecting cells from aging and the secretion of inflammatory cytokines and chemokines.

[0139] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Application of substances that reduce the content and / or activity of FOXO1 protein in the preparation of products that construct senescent cells; The reduction in FOXO1 protein content and / or activity is achieved by knocking out the FOXO1 gene using transcription activator-like effector nuclease (TALEN)-mediated homologous recombination (HR) gene editing technology; The cells in question are synovial cell-like mesenchymal matrix cells.

2. A method for constructing senescent cells, comprising the step of introducing a substance that reduces the content and / or activity of FOXO1 protein into recipient cells; The reduction in FOXO1 protein content and / or activity is achieved by knocking out the FOXO1 gene using transcription activator-like effector nuclease (TALEN)-mediated homologous recombination (HR) gene editing technology; The cells in question are synovial cell-like mesenchymal matrix cells.

3. A method for altering the senescence state of isolated cells in vitro, comprising the step of introducing a substance that reduces the content and / or activity of FOXO1 protein into isolated cells; The reduction in FOXO1 protein content and / or activity is achieved by knocking out the FOXO1 gene using transcription activator-like effector nuclease (TALEN)-mediated homologous recombination (HR) gene editing technology; The cells were synovial cell-like mesenchymal matrix cells; The method described is not for disease diagnosis and treatment purposes.

4. A method for promoting cell senescence in vitro, comprising the step of introducing a substance that reduces the content and / or activity of FOXO1 protein into recipient cells; The reduction in FOXO1 protein content and / or activity is achieved by knocking out the FOXO1 gene using transcription activator-like effector nuclease (TALEN)-mediated homologous recombination (HR) gene editing technology; The cells were synovial cell-like mesenchymal matrix cells; The method described is not for disease diagnosis and treatment purposes.

Images