A method for extracting zeaxanthin from a fermentation broth

Abstract

The application provides a method for extracting zeaxanthin from fermentation liquor, which comprises the following steps: obtaining a broken liquid by breaking cells in the fermentation liquor, obtaining a precipitate by centrifuging the broken liquid, washing the precipitate with pure water, removing water from the precipitate after washing, obtaining an extraction phase by leaching the precipitate, obtaining a concentrated slurry by concentrating the extraction phase, obtaining a filter cake by suction filtration of the concentrated slurry, and optionally, a drying step of the filter cake. The method has simple process steps, avoids the use of high-toxicity solvents, and has high product purity and yield, and is suitable for subsequent large-scale commercial production.

Description

Technical Field

[0001] This invention relates to the field of zeaxanthin bio-extraction, specifically to a method for extracting zeaxanthin from Yersinia lipolytica fermentation broth. Background Technology

[0002] Zeaxanthin, also known as zeaxanthin, CAS number 144-68-3, molecular formula C 40 H 56 O2, with a molecular weight of 566.88, is a type of carotenoid and a dihydroxy derivative of β-carotene. Zeaxanthin is abundant in plant tissues such as green vegetables, paprika, marigolds, corn seeds, goji berries, and tartary berries, as well as some non-photosynthetic bacteria. Zeaxanthin possesses specific antioxidant functions, making it an important nutritional supplement. Furthermore, zeaxanthin has unique physiological effects in preventing cardiovascular disease, cataracts, cancer, and enhancing immunity (CN101293863A). Simultaneously, zeaxanthin also has wide applications in food coloring, agriculture, and cosmetics (CN101203616A).

[0003] Currently, there are four main industrial methods for obtaining zeaxanthin: extraction from plants; total chemical synthesis; chemical transformation using other intermediates; and microbial fermentation. Plant extraction primarily obtains zeaxanthin from plants such as paprika (CN110590630A), marigold (CN113582899A; CN105254549; CN114057072A), corn (CN102603590A), wolfberry (CN106349136A; CN107098839A; CN106349137A), and lycine (CN106565574A). This method often requires large amounts of organic solvents and is aided by inefficient and expensive techniques such as supercritical fluid extraction and ultrasound to obtain the final product. The process is complex, energy-intensive, and has a low product yield, while also exhibiting poor removal efficiency for other carotenoids. The total synthesis strategy involves complex processes, severe pollution, and high costs, and is currently far from commercialization. Using canthaxanthin (CN101293863A), lutein (CN105085351A, CN101153017B; Helv.Chim.Acta 39(1956)2041; Justus LiebigsAnn.Chem.603(1957)129), or astaxanthin (CN110143904B) can largely solve the problems associated with total synthesis. However, the use of toxic reagents and stringent reaction parameters during the process pose serious challenges to the industrial scale-up of zeaxanthin. Microbial synthesis has opened up a completely new avenue for the commercial production of zeaxanthin. Patents such as CN10123616A, CN103038358B, and CN105886518A have also conducted extensive research on different bacterial genera, making many attempts in strain construction, fermentation optimization, and downstream extraction. However, low fermentation yield, low extraction efficiency, and complex processes severely limit its industrialization prospects. Summary of the Invention

[0004] To address the above problems, this invention provides a method for extracting zeaxanthin from microbial fermentation broth, which features simple process steps, low solvent toxicity, high extraction yield, and good product quality.

[0005] The present invention provides a method for extracting zeaxanthin from microbial fermentation broth or fermentation cells, the method comprising: 1) pretreatment of fermentation broth or fermentation cells to obtain a precipitate; 2) washing the precipitate and removing water from the precipitate; and 3) precipitate extraction.

[0006] In some embodiments, pure water is used for sedimentation and washing in step 2).

[0007] In some embodiments, an alcohol solvent is used for washing and dehydration in step 2).

[0008] In some embodiments, the alcohol solvent is selected from one or more of acetonitrile, methanol, acetone, ethanol, and isopropanol; preferably, the alcohol solvent is acetonitrile.

[0009] In some embodiments, the extractant used in step 3) is a low-carbon alcohol or ester; preferably, the extractant is dichloroethane.

[0010] In some embodiments, the method further includes: 4) the step of extract phase concentration.

[0011] In some embodiments, the method further includes: 5) a step of concentrating the slurry solvent for washing.

[0012] In some embodiments, the solvent used for washing impurities in step 5) is selected from one or more of low-carbon hydrocarbons, alcohols, esters, and halogenated hydrocarbons; preferably, the solvent used for washing impurities is ethanol.

[0013] In some embodiments, the method further includes the steps of: 6) filtration of concentrated slurry and optionally 7) drying of filter cake.

[0014] In some embodiments, step 7) of drying the filter cake further includes washing the filter cake with hot ethanol.

[0015] In some embodiments, the pretreatment of the fermentation broth or fermentation cells in step 1) includes cell disruption and centrifugation.

[0016] In some implementations, a high-pressure homogenizer is used for cell disruption.

[0017] In some implementations, the homogenization pressure is 600-1200 bar and the homogenization temperature is 5-40°C.

[0018] In some implementations, the homogenization pressure is 800-1000 bar.

[0019] In some implementations, the homogenization temperature is 5–30°C.

[0020] In some implementations, the homogenization is performed 1-4 times.

[0021] In some embodiments, the relative centrifugal force of the centrifugation is 3000-12000 rcf, the centrifugation temperature is 0-25°C, and the centrifugation time is 2-40 min.

[0022] In some embodiments, the relative centrifugal force is 4000-1000rcf.

[0023] In some embodiments, the centrifugation temperature is 20-25°C.

[0024] In some embodiments, the centrifugation time is 5-20 min.

[0025] In some embodiments, in step 2), 1 to 4 times the mass (w / w) of pure water is added to the precipitate obtained in step 1) for washing, and the washing aqueous phase is removed by centrifugation.

[0026] In some embodiments, the amount of pure water added is 2 to 3 times the mass (w / w) of the precipitate.

[0027] In some embodiments, in step 2), 1 to 4 times the mass (w / w) of alcohol solvent is added to the precipitate after washing with pure water for washing and dehydration, and the aqueous solution is removed by centrifugation.

[0028] In some embodiments, the amount of the alcohol solvent used is 2 to 3 times the mass (w / w) of the precipitate. In some embodiments, the washing and dehydration temperature is 10-80°C.

[0029] In some implementations, the washing and dewatering temperature is 10-60°C.

[0030] In some embodiments, in step 3), the precipitate after washing and dehydration is extracted 1 to 10 times its weight (w / w) of extractant in 1 to 5 extractions.

[0031] In some embodiments, the amount of extractant used is 2-6 times the mass (w / w) of the precipitate.

[0032] In some embodiments, the extraction is performed 2-3 times.

[0033] In some embodiments, the extraction vessel is a mechanically stirred tank.

[0034] In some implementations, the extraction time is 0.1-8 hours.

[0035] In some embodiments, the extraction temperature is 0–80°C.

[0036] In some embodiments, the extract phase is concentrated by evaporation in step 4).

[0037] In some implementations, the extract phase is concentrated by rotary evaporation.

[0038] In some embodiments, the rotary evaporation temperature is 0-60°C and the rotary evaporation vacuum is 10-1000 mbar.

[0039] In some embodiments, the rotary evaporation temperature is 20-50°C.

[0040] In some embodiments, the rotary evaporation vacuum is 20-60 mbar.

[0041] In some embodiments, the container for evaporation and concentration is a rotary flask.

[0042] In some implementations, the rotary evaporation operation is stopped when no more liquid drips out.

[0043] In some embodiments, step 5) involves adding 1-50 times the mass (w / w) of washing solvent to the concentrated slurry, washing at a temperature of 0-100°C, and washing for 0.1-5.0 hours.

[0044] In some embodiments, the amount of the washing solvent is 5-20 times that of the concentrated slurry.

[0045] In some embodiments, the washing temperature is 30-60°C.

[0046] In some embodiments, the washing time is 0.2-2.0 hours.

[0047] In some embodiments, the temperature for drying the filter cake in step 7) is 30-100°C, the vacuum degree is 1-20 kPa, and the drying time is 12-24 hours.

[0048] In some embodiments, the drying temperature for the filter cake is 30-60°C.

[0049] In some embodiments, the vacuum level is 1-10 kPa.

[0050] In some embodiments, the drying time is 12-18 hours.

[0051] In some embodiments, the filter cake is dried in a vacuum oven.

[0052] In some embodiments, the microorganism is Yersinia lipolyticis.

[0053] In some embodiments, the *Yersinia lipolytica* is a recombinant *Yersinia lipolytica*.

[0054] In some embodiments, the recombinant Yersinia lipolytica contains introduced genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgerany diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase or a truncated form thereof (tHMGR), β-carotene hydroxylase (CrtZ_9GAMM) from Pantoea stewartii, mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase (CrtZ_SACS2) from Saccharolobus solfataricus, and the β-carotene hydroxylase CrtZ_SACS2-ERG6 fusion protein.

[0055] In some embodiments, the phytoene dehydrogenase comprises the amino acid sequence shown in SEQ ID NO: 1.

[0056] In some embodiments, the gene encoding phytopene dehydrogenase comprises the nucleotide sequence shown in SEQ ID NO: 10.

[0057] In some embodiments, the lycopene cyclase / hydrolycopene synthase comprises the amino acid sequence shown in SEQ ID NO: 2.

[0058] In some embodiments, the gene encoding lycopene cyclase / hydrolycopene synthase comprises the nucleotide sequence shown in SEQ ID NO: 11.

[0059] In some embodiments, the geraniol geraniol diphosphate synthase comprises the amino acid sequence shown in SEQ ID NO: 3.

[0060] In some embodiments, the gene encoding geraniol geraniol diphosphate synthase comprises the nucleotide sequence shown in SEQ ID NO: 12.

[0061] In some embodiments, the diacylglycerol acyltransferase comprises the amino acid sequence shown in SEQ ID NO: 4.

[0062] In some embodiments, the gene encoding diacylglycerol acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 13.

[0063] In some embodiments, the 3-hydroxy-3-methylglutaryl-CoA reductase or a truncated form thereof comprises the amino acid sequence shown in SEQ ID NO: 5.

[0064] In some embodiments, the gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase or a truncated form thereof comprises the nucleotide sequence shown in SEQ ID NO: 14.

[0065] In some embodiments, the β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO: 6.

[0066] In some embodiments, the gene encoding β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO: 15.

[0067] In some embodiments, the mevalonate-5-pyrophosphate decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 7.

[0068] In some embodiments, the gene encoding mevalonate-5-pyrophosphate decarboxylase comprises the nucleotide sequence shown in SEQ ID NO: 16.

[0069] In some embodiments, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO: 8.

[0070] In some embodiments, the gene encoding β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO: 17.

[0071] In some embodiments, the sterol methyltransferase comprises the amino acid sequence shown in SEQ ID NO: 9.

[0072] In some embodiments, the gene encoding sterol methyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 18.

[0073] In some embodiments, the recombinant Yersinia lipolytica genome is inserted with a combination of the following DNA sequences or fragments thereof: SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26.

[0074] In some embodiments, the fragment is a sequence obtained by removing the resistance gene or the screening gene from any one of SEQ ID NO: 19-26.

[0075] In some embodiments, the starting strain for constructing the recombinant Yersinia lipophila is Polf.

[0076] The second aspect of the present invention provides a zeaxanthin product extracted according to the method described in the first aspect of the present invention.

[0077] In some embodiments, the purity of the product is >90%.

[0078] The advantages of this invention over the prior art are:

[0079] This invention provides for the first time a method for extracting and purifying zeaxanthin from fermentation broth or fermentation cells.

[0080] The purification method used in this invention has simple process steps and avoids the use of highly toxic solvents, making it suitable for subsequent large-scale commercial production.

[0081] The technical route provided by this invention produces products with a purity of >90%, and the separation and purification yield can reach up to 78%. Attached Figure Description

[0082] Figure 1 Displaying the AP18860 plasmid map.

[0083] Figure 2 The map of plasmid DNA6336 is displayed.

[0084] Figure 3 The comparison shows the ability of strains BOTA01025, BOTA01027 and BOTA01017 to produce β-carotene.

[0085] Figure 4 The comparison shows the yield of maize xanthine produced by strains BOTA01017, BOTA01018, and BOTA01021.

[0086] Figure 5 The comparison shows the yield of zeaxanthin produced by strains BOTA01021 and BOTA01019.

[0087] Figure 6 The comparison shows the yield of zeaxanthin produced by strains BOTA01019 and BOTA01026.

[0088] Figure 7 The chromatogram of the fermentation broth from the experimental example is shown. This chromatogram is derived from the detection of the sample at the fermentation endpoint. Zeaxanthin is present at a residence time of 1.367 min, β-carotene at a residence time of 3.178 min, cryptoxanthin at a residence time of 2.440 min, and other residence time components are other fermentation byproducts.

[0089] Figure 8The chromatogram of the cell homogenate lysate is shown. This chromatogram is derived from the detection of the cell homogenate lysate sample. Zeaxanthin is present at a residence time of 1.331 min, β-carotene at a residence time of 3.170 min, cryptoxanthin at a residence time of 2.384 min, and other components at other residence times are other fermentation byproducts.

[0090] Figure 9 The chromatogram of the washing phase of the experimental example is shown. This chromatogram is derived from the detection of the washing phase sample. Zeaxanthin is present at a residence time of 1.328 min, β-carotene is present at a residence time of 3.169 min, and other components at other residence times are other fermentation byproducts.

[0091] Figure 10 The chromatogram of the washing and dehydration solution in the experimental example is shown. This chromatogram is derived from the detection of the washing and dehydration phase sample. Zeaxanthin is present at a residence time of 1.327 min, β-carotene at a residence time of 3.167 min, cryptoxanthin at a residence time of 2.381 min, and other components at other residence times are other fermentation byproducts.

[0092] Figure 11 The chromatogram of the extract phase from the experimental example is shown. This chromatogram is derived from the detection of the extract phase sample. Zeaxanthin is present at a residence time of 1.313 min, β-carotene at a residence time of 3.173 min, cryptoxanthin at a residence time of 2.372 min, and other fermentation byproducts at other residence times.

[0093] Figure 12 The chromatogram of the raffinate phase in the experimental example is shown. This chromatogram is derived from the detection of the raffinate phase sample. Zeaxanthin is present at a residence time of 1.323 min, β-carotene at a residence time of 3.175 min, cryptoxanthin at a residence time of 2.391 min, and other components at other residence times are other fermentation byproducts.

[0094] Figure 13 The chromatogram of the mother liquor from the experimental example is shown. This chromatogram is derived from the detection of the mother liquor sample. The component at a residence time of 3.195 min is β-carotene, while the components at other residence times are other fermentation byproducts.

[0095] Figure 14 The chromatogram of the experimental product is shown. This chromatogram is derived from the detection of the mother liquor sample. Zeaxanthin is present at a residence time of 1.236 min, while small amounts of byproducts are present at other residence times. Detailed Implementation

[0096] The following definitions are provided to enable those skilled in the art to understand the invention. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Preferred materials and methods are described herein, but any methods and materials similar to or equivalent to those described herein may be used in the practice of testing the invention. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0097] Terminology Definition

[0098] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.

[0099] To make this disclosure easier to understand, some terms are defined below.

[0100] As used in this specification and the appended claims, the singular forms “a” and “the” include plural references, unless the context clearly specifies otherwise.

[0101] In this document, the terms “comprising,” “having,” “including,” and “containing” should be interpreted as open-ended terms (i.e., meaning “including but not limited to”).

[0102] In this document, “and / or” means and includes any and all possible combinations of one or more of the associated listed items. For example, “the composition contains A and / or B” can be interpreted as the composition contains A, the composition contains B, or the composition contains both A and B.

[0103] All numerical names, such as pH, temperature, time, concentration, and molecular weight, including ranges, are approximate values ​​that are appropriately varied in increments of 1.0 or 0.1, or optionally varied (+) or (-) by changes of + / - 15%, 10%, 5%, or 2%. It should be understood that all numerical names are preceded by the term "about". It should also be understood that the reagents described herein are exemplary only, and their equivalents are known in the art. When referring to measurable values ​​such as amount or concentration, the term "about" as used herein means a variation within 20%, 10%, 5%, 1%, 0.5%, or 0.1% of the specified amount.

[0104] As used in this article, "zeaxanthin," also known as "zeaxanthin," is a fat-soluble pigment component of the lutein class and a dihydroxy derivative of β-carotene. Zeaxanthin is abundant in plant tissues such as green vegetables, corn seeds, goji berries, and tartary berries, as well as in some non-photosynthetic bacteria.

[0105] As used in this article, "Yarrowia lipolytica" is an unconventional yeast belonging to the class Hemiascomycetes. Yarrowia lipolytica is widely used in the production of food additives. Its applications in the biosynthesis of natural products include the fermentation production of fatty acids and lipids, terpenoids, flavonoids, and other bioactive products such as succinic acid, pyruvic acid, α-ketoglutarate, adipic acid, erythritol, and cordycepin.

[0106] As used in this article, "cell disruption" refers to the disruption of cells in the fermentation broth using physical or chemical methods to release intracellular active components such as enzymes, polysaccharides, and nucleic acids. The disruption process is crucial for extracting target components because many genetically engineered products typically accumulate within cells. Common methods for disrupting fermentation broth include mechanical, chemical, and enzymatic methods. Mechanical methods include high-pressure homogenization and grinding. Chemical methods use chemical reagents such as acids, alkalis, or organic solvents to disrupt cells. Enzymatic methods utilize enzymatic action to disrupt cells. For example, baker's yeast is pretreated with lysozyme and polysaccharide hydrolase, followed by high-pressure homogenization. In this article, a high-pressure homogenizer was used for cell disruption in the fermentation broth.

[0107] As used in this article, "high-pressure homogenization" refers to the process of using ultra-high pressure to force materials to flow at high speeds within a specially structured cavity, thereby achieving a homogenization effect. High-pressure homogenization can cause changes in the physical, chemical, and structural properties of suspensions under pressures up to 60,000 psi through a specially structured cavity, ultimately achieving a homogenization effect.

[0108] As used in this article, the term "extraction method," also known as liquid-solid extraction, involves using a volatile organic solvent to transfer certain components from the raw material into the solvent phase. The organic solvent is then recovered through evaporation, distillation, or other methods to obtain the desired, relatively pure extract. In this article, the precipitate was treated using the "extraction method" to obtain the extract phase and the raffinate phase. Most of the zeaxanthin was contained in the extract phase.

[0109] As used in this article, "rotary evaporation" refers to a common laboratory method for separating and concentrating solutions. Its basic principle involves using a rotating flask and condenser, combined with the negative pressure of a vacuum pump, to evaporate the solution during rotation, thereby effectively concentrating the solution.

[0110] As used in this article, “washing and dehydration” refers to a method of replacing residual water in a feed solution with a non-aqueous solvent.

[0111] As used in this article, “washing” refers to a method of dissolving impurities to be separated using specific reagents.

[0112] In this document, the terms “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” “nucleotide sequence,” and “polynucleotide” are used interchangeably and refer to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Therefore, the term includes, but is not limited to, single-stranded or double-stranded DNA or RNA, genomic DNA, cDNA, DNA / RNA hybrids, or polymers comprising, consisting of, or substantially consisting of purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases.

[0113] The terms “protein,” “peptide,” “polypeptide,” and “amino acid sequence” are used interchangeably and, in their broadest sense, refer to a polymer of two or more amino acid subunits, amino acid analogs, or peptide mimics. “Protein,” “peptide,” “polypeptide,” and “amino acid sequence” contain at least two amino acids, and there is no limit to the maximum number of amino acids. As used herein, the term “amino acid” refers to natural and / or non-natural or synthetic amino acids, including D and L optical isomers and amino acid analogs.

[0114] Equivalents having one or more amino acid modifications compared to the protein or amino acid sequence described herein are also covered within the scope of this invention, provided that such modification does not affect or substantially does not affect the activity of the protein or amino acid sequence. In this document, amino acid modification can be amino acid substitution, amino acid deletion, or amino acid insertion. Amino acid substitution can be conserved or non-conserved. A conserved substitution (also called a conserved mutation, conserved replacement, or conserved variation) is an amino acid substitution in a protein that changes a given amino acid to a different amino acid having similar biochemical properties (e.g., charge, hydrophobicity, or size). In this document, "conserved substitution" means that an amino acid residue is replaced by another biologically similar residue. Examples of conserved substitution include one hydrophobic residue such as isoleucine, valine, leucine, or methionine replacing another; or one charged or polar residue replacing another, such as arginine replacing lysine, glutamic acid replacing aspartic acid, glutamine replacing asparagine, etc. Other exemplary examples of conservative substitutions include the following changes: alanine to serine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine ​​to serine; glycine to proline; histidine to asparagine or glutamine; lysine to arginine, glutamine, or glutamic acid; diphenylalanine to tyrosine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine, etc.

[0115] In this article, "expression" refers to the process by which a nucleic acid sequence is transcribed into mRNA and / or the transcribed mRNA is subsequently translated into peptides, polypeptides, amino acid sequences, or proteins. If the nucleic acid sequence originates from genomic DNA, expression may include the splicing of mRNA in eukaryotic cells.

[0116] When the term "coding" is applied to a nucleic acid sequence, it refers to a nucleic acid sequence that, if in its natural state or when manipulated by methods well known to those skilled in the art, can be transcribed to produce mRNA and / or translated to produce a polypeptide, is called a "coding" polypeptide sequence. Therefore, a "coding sequence" is a nucleic acid sequence that has the aforementioned function, and it can be DNA or RNA (e.g., mRNA).

[0117] In this paper, "coding gene" includes "coding sequence" and may optionally include other nucleotide sequence elements for regulating gene expression, such as promoters and terminators. Within a "coding gene," the coding sequence and other nucleotide sequence elements are arranged in a suitable order to promote the correct expression of the encoded protein.

[0118] "Homology" or "identity" refers to the sequence similarity between two polypeptides or two nucleic acid sequences. The percentage of identity can be determined by comparing positions in each sequence, which can be aligned for comparison purposes. When a position in the compared sequences is occupied by the same base or amino acid, the molecules are identical at that position. The degree of identity between sequences depends on the number of shared matching positions. Tools for comparing sequence similarity are well known to those skilled in the art; for example, the alignment and percentage of sequence identity of the nucleic acid or amino acid sequences provided herein can be obtained by importing the nucleic acid or amino acid sequence into ClustalW (available from https: / / genome..jp / tools bin / clustalw / ) and using ClustalW.

[0119] In this article, the terms "homologous protein" and "homological protein" are used interchangeably, referring to proteins that share a high degree of sequence identity in their amino acid or coding sequences with a reference protein, and that share a high degree of functional similarity, such as performing the same function or catalyzing the same reaction process. "Homologous protein" includes proteins that share at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with a reference protein. Alternatively, "homologous protein" includes proteins encoded by polynucleotides that share at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with a reference protein's coding sequence.

[0120] "Non-homologous protein" or "irrelevant protein" has less than 40%, less than 30%, or less than 25% identity with the amino acid sequence or coding sequence of the reference protein described in this invention.

[0121] As used herein, the term "promoter" refers to an expression control sequence that controls the initiation and efficiency of gene or transgene transcription. Promoters can be, for example, constitutive, inducible, repressive, or tissue-specific. Promoters may contain genetic elements that regulate proteins and molecules such as RNA polymerases and transcription factors to which they can bind. Promoters used herein include pTEFin (SEQ ID NO: 50), pGPD (SEQ ID NO: 51), and 8UASEXP (SEQ ID NO: 52).

[0122] The term "terminator" used in this article refers to the DNA sequence that provides a transcription termination signal to RNA polymerase. Terminators can be divided into two categories: those that terminate transcription independently of protein cofactors, and those that require protein cofactors. These protein cofactors are called termination factors, often referred to as p-factors. Both types of terminators share common sequence characteristics. A palindromic sequence precedes the transcription termination point. The two repeating portions of the palindromic sequence (each 7–20 bp) are separated by several non-repeating bp segments. The axis of symmetry of the palindromic sequence is generally 16–24 bp from the transcription termination point. The terminators used in this article include the endogenous terminators Txpr2 and Tipi2 commonly used in Yeast Extract.

[0123] As used herein, the term "recombination" refers to the process of re-covalent recombination of genetic information within or between DNA molecules. When applied to specific microorganisms, such as *Yarrowia lipolytica* as described in this invention, the term "recombination" refers to the artificial intervention that imparts certain different characteristics to *Yarrowia lipolytica* compared to the starting strain, such as increased zeaxanthin production. Those skilled in the art will understand that "engineered microorganisms" are not limited to strains modified through genetic engineering; strains containing the gene-damping features described in this invention, obtained through UV mutagenesis or chemical mutagenesis, should also be included within the scope of "engineered microorganisms" as described in this invention.

[0124] The term "non-homologous end joining (NHEJ)" refers to the repair of double-stranded DNA breaks by a protein complex binding to the ends of the DNA strands and recruiting corresponding ATP-dependent DNA ligases. Unlike homologous recombination (HR), NHEJ does not require a homologous DNA template and is not dependent on DNA replication. NHEJ is an important mechanism of microbial gene recombination, especially in *Yarrowia lipophila*.

[0125] The term "Gibson assembly" is a recombination-based molecular cloning method used for the in vitro assembly of DNA fragments. The core principle of Gibson assembly relies on three enzymes: a DNA exonuclease, a high-fidelity DNA polymerase, and a thermostable DNA ligase. First, the T5 exonuclease digests the DNA fragments from the 5' to the 3' direction, with each fragment forming a single-stranded overhang. Because these adjacent overhangs share some homology, they undergo complementary annealing. Then, the high-fidelity DNA polymerase fills the gaps in the annealed fragments, and the thermostable DNA ligase finally seals the gaps in the assembled DNA, generating a completely sealed double-stranded DNA molecule. Invention Details

[0127] I. Recombinant Yersinia lipophila

[0128] This invention provides a recombinant Yarrowia lipolytica, which, based on the starting strain, contains introduced genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgerany diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase or its truncated form (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase CrtZ_SACS2, and β-carotene hydroxylase CrtZ_SACS2-ERG6 fusion protein.

[0129] In some embodiments, the number of copies of the gene encoding CarB introduced is 2, 3, 4 or 5, preferably 2; preferably, the gene with different copy numbers is the same.

[0130] In some embodiments, the number of copies of the gene encoding CarE introduced is 2, 3, 4 or 5, preferably 2; preferably, the gene with different copy numbers is the same.

[0131] In some embodiments, the phytoene dehydrogenase comprises the amino acid sequence shown in SEQ ID NO: 1 or the amino acid sequence of a homologous protein of SEQ ID NO: 1 or the amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 1 and retaining the function of phytoene dehydrogenase.

[0132] In some embodiments, the gene encoding phytopenic lycopene dehydrogenase comprises the nucleotide sequence shown in SEQ ID NO: 10 or its degenerate sequence, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 10.

[0133] In some embodiments, the lycopene cyclase / hydrolycopene synthase comprises the amino acid sequence shown in SEQ ID NO: 2 or the amino acid sequence of a homologous protein of SEQ ID NO: 2 or the amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 2 and retaining the function of lycopene cyclase / hydrolycopene synthase.

[0134] In some embodiments, the gene encoding lycopene cyclase / hydrolycopene synthase comprises the nucleotide sequence shown in SEQ ID NO: 11 or its degenerate sequence, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 11.

[0135] In some embodiments, the geraniol geraniol diphosphate synthase comprises the amino acid sequence shown in SEQ ID NO: 3 or the amino acid sequence of a homologous protein of SEQ ID NO: 3 or the amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 3 and retaining the function of geraniol geraniol diphosphate synthase.

[0136] In some embodiments, the gene encoding geraniol geraniol diphosphate synthase comprises the nucleotide sequence shown in SEQ ID NO: 12 or its degenerate sequence, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 12.

[0137] In some embodiments, the diacylglycerol acyltransferase comprises the amino acid sequence shown in SEQ ID NO:4 or the amino acid sequence of a homologous protein of SEQ ID NO:4 or the amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:4 and retaining the diacylglycerol acyltransferase function.

[0138] In some embodiments, the gene encoding diacylglycerol acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 13 or its degenerate sequence, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 13.

[0139] In some embodiments, the 3-hydroxy-3-methylglutaryl-CoA reductase or a truncated form thereof comprises the amino acid sequence shown in SEQ ID NO: 5 or the amino acid sequence of a homologous protein of SEQ ID NO: 5 or the amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 5 and retaining the function of 3-hydroxy-3-methylglutaryl-CoA reductase.

[0140] In some embodiments, the gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase or a truncated form thereof comprises the nucleotide sequence shown in SEQ ID NO: 14 or its degenerate sequence, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 14.

[0141] In some embodiments, the β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO: 6 or the amino acid sequence of a homologous protein of SEQ ID NO: 6 or the amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 6 and retaining the β-carotene hydroxylase function.

[0142] In some embodiments, the gene encoding β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO: 15 or its degenerate sequence, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 15.

[0143] In some embodiments, the mevalonate-5-pyrophosphate decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 7 or the amino acid sequence of a homologous protein of SEQ ID NO: 7 or the amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 7 and retaining the function of mevalonate-5-pyrophosphate decarboxylase.

[0144] In some embodiments, the gene encoding mevalonate-5-pyrophosphate decarboxylase comprises the nucleotide sequence shown in SEQ ID NO: 16 or its degenerate sequence, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 16.

[0145] In some embodiments, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO: 8 or the amino acid sequence of a homologous protein of SEQ ID NO: 8 or the amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 8 and retaining the β-carotene hydroxylase function.

[0146] In some embodiments, the gene encoding β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO: 17 or its degenerate sequence, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 20 or 21. Preferably, the *Yarrowia lipolytica* comprises the nucleotide sequence shown in SEQ ID NO: 17 or its degenerate sequence, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 20 or 21.

[0147] In some embodiments, the sterol methyltransferase comprises the amino acid sequence shown in SEQ ID NO: 9 or the amino acid sequence of a homologous protein of SEQ ID NO: 9 or the amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 9 and retaining the function of sterol methyltransferase.

[0148] In some embodiments, the gene encoding sterol methyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 18 or its degenerate sequence, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 18.

[0149] In some embodiments, the starting strain of the recombinant Yersinia lipolytica is Yersinia lipolytica Po1f.

[0150] In some embodiments, the introduction is performed by integrating donor DNA containing the target gene and selected from resistance genes and selection genes into the Yersinia lipolytica genome via non-homologous end joining (NHEJ).

[0151] In some embodiments, the resistance gene includes the hygromycin gene.

[0152] In some embodiments, the screening gene includes the URA3 gene or the LEU2 gene.

[0153] In some embodiments, the resistance gene or tag gene in the donor DNA contains the same two LoxP sites (Lox71 and Lox66) in both the forward and backward directions.

[0154] In some embodiments, the donor DNA is integrated into the Yersinia lipophila genome, and the resistance gene or selection gene is recovered by transfecting the Cre enzyme expression plasmid.

[0155] In some implementations, the promoters used in the expression cassette of the target gene include pTEFin, pGPD, and 8UASEXP.

[0156] In some implementations, the expression cassette of the target gene uses Txpr2 and Tipp2 as terminators.

[0157] In some embodiments, the recombinant Yersinia lipophila genome is inserted with a combination of the following DNA sequences or fragments thereof:

[0158] SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26.

[0159] In some embodiments, the fragment is a sequence obtained by removing the resistance gene or the screening gene from any one of SEQ ID NO: 19-26.

[0160] In some embodiments, the recombinant lipophilic yeast of the present invention is shown in Table 1 below.

[0161] Table 1

[0162]

[0163]

[0164] In some embodiments, the recombinant Yersinia lipolyticis is BOTA01026.

[0165] II. Production of Zeaxanthin by Fermentation of Recombinant Yersinia Lipolysaccharide

[0166] This invention provides a method for producing zeaxanthin by fermentation using recombinant Yersinia lipolytica, the method comprising the steps of seed culture preparation and fermentation culture.

[0167] In some embodiments, the initial culture medium for fermentation is formulated as follows: glucose 30-50 g / L, potassium dihydrogen phosphate 6-10 g / L, magnesium sulfate heptahydrate 4.15-8.15 g / L, ammonium sulfate 11-19 g / L, 3-7 mL / L TMS solution, and 2-4 mL / L vitamin solution.

[0168] In some embodiments, the initial culture medium for fermentation is formulated as follows: 40 g / L glucose, 8 g / L potassium dihydrogen phosphate, 6.15 g / L magnesium sulfate heptahydrate, 15 g / L ammonium sulfate, 5 mL / L TMS solution, and 3 mL / L vitamin solution.

[0169] In some embodiments, the inoculation amount of the seed solution is 5-15% v / v, preferably 10% v / v.

[0170] In some embodiments, the stirring speed of the fermentation culture is 600-1200 rpm.

[0171] In some embodiments, the aeration ratio of the fermentation culture is 1.0-1.5 VVM.

[0172] In some embodiments, the dissolved oxygen control of the fermentation culture is set to approximately 20%.

[0173] In some embodiments, the pH of the fermentation culture is approximately 5.5. Preferably, ammonia is used to control the pH of the fermentation process. Preferably, the ammonia concentration is approximately 25%.

[0174] In some embodiments, the fermentation culture temperature is about 30°C.

[0175] In some implementations, the carbon source in the initial culture medium is depleted, and replenishment begins.

[0176] In some embodiments, the feed culture medium formulation is as follows: glucose 450-530 g / L, potassium dihydrogen phosphate 10.8-14.8 g / L, magnesium sulfate heptahydrate 7.8-11.8 g / L, ammonium sulfate 147.2-187.2 g / L, 4-6 mL / L TMS solution, and 2-4 mL / L vitamin solution.

[0177] In some embodiments, the feed culture medium formulation is as follows: glucose 490 g / L, potassium dihydrogen phosphate 12.8 g / L, magnesium sulfate heptahydrate 9.8 g / L, ammonium sulfate 167.2 g / L, 5 mL / L TMS solution, and 3 mL / L vitamin solution.

[0178] In some embodiments, a constant dissolved oxygen feeding control strategy is employed during the fed culture, with a dissolved oxygen control value of approximately 20%.

[0179] In some implementations, the fed-batch culture is terminated after approximately 120 hours.

[0180] In some embodiments, the TMS solution formulation in the initial culture medium and the supplemental culture medium is as follows: ferrous sulfate heptahydrate 3.6-7.6 g / L, zinc sulfate heptahydrate 9.5-13.5 g / L, copper sulfate 0.44-0.84 g / L, manganese chloride tetrahydrate 0.3-0.7 g / L, cobalt chloride hexahydrate 0.74-1.14 g / L, calcium chloride dihydrate 3.6-7.6 g / L, sodium molybdate dihydrate 0.76-1.16 g / L, and 0.3-0.7 MEDTA 140-180 mL / L.

[0181] In some embodiments, the TMS solution formulation in the initial culture medium and the supplemental culture medium is as follows: ferrous sulfate heptahydrate 5.6 g / L, zinc sulfate heptahydrate 11.5 g / L, copper sulfate 0.64 g / L, manganese chloride tetrahydrate 0.5 g / L, cobalt chloride hexahydrate 0.94 g / L, calcium chloride dihydrate 5.6 g / L, sodium molybdate dihydrate 0.96 g / L, and 0.5 M EDTA 160 mL / L.

[0182] In some embodiments, the vitamin solution formulation in the initial culture medium and the supplemental culture medium is as follows: biotin 0.1-0.3 g / L, para-aminobenzoic acid 0.6-1.0 g / L, nicotinic acid 3-5 g / L, inositol 8-12 g / L, calcium pantothenate 3-5 g / L, pyridoxine hydrochloride 3-5 g / L, and thiamine hydrochloride 3-5 g / L.

[0183] In some embodiments, the vitamin solution formulation in the initial culture medium and the supplemental culture medium is: biotin 0.2 g / L, para-aminobenzoic acid 0.8 g / L, nicotinic acid 4 g / L, inositol 10 g / L, calcium pantothenate 4 g / L, pyridoxine hydrochloride 4 g / L, and thiamine hydrochloride 4 g / L.

[0184] III. Extraction and purification of zeaxanthin from fermentation broth

[0185] This invention provides a method for extracting zeaxanthin from microbial fermentation broth or fermentation cells.

[0186] In some embodiments, the microorganisms include, but are not limited to, *Yarrowia lipolyticis*, and may include any microorganism suitable for zeaxanthin production. The fermentation broth of any microorganism suitable for zeaxanthin production is applicable to the method of the present invention for zeaxanthin extraction.

[0187] In some embodiments, the recombinant lipophilic yeast is as described in I.

[0188] In some embodiments, the fermentation production method is as shown in II.

[0189] In some embodiments, the method for extracting zeaxanthin from microbial fermentation broth includes: 1) pretreatment of the fermentation broth or fermentation cells to obtain a precipitate; 2) washing the precipitate and removing water; and 3) precipitate extraction.

[0190] In some embodiments, the pretreatment of fermentation broth or fermentation cells in step 1) includes cell disruption and centrifugation.

[0191] In some embodiments, the cell disruption method includes mechanical methods, chemical methods, and enzymatic methods.

[0192] In some embodiments, the chemical method uses acids, bases, or organic solvents to break down cells.

[0193] In some embodiments, the mechanical method includes high-pressure homogenization and grinding, etc.

[0194] In some embodiments, a high-pressure homogenizer is used to disrupt the cells in step 1).

[0195] In some embodiments, the homogenization pressure is 600-1200 bar.

[0196] In some embodiments, the homogenization pressure is 800-1000 bar, for example, about 800 bar, about 900 bar.

[0197] bar, approximately 1000 bar.

[0198] In some embodiments, the homogenization temperature is 5-40°C.

[0199] In some embodiments, the homogenization temperature is 5 to 30°C, for example, about 5°C, 10°C, 15°C, 20°C, or 30°C.

[0200] In some implementations, the homogenization is performed 1 to 4 times, for example, 1 time, 2 times, 3 times, 4 times.

[0201] In some embodiments, the relative centrifugal force in step 1) is 3000-12000rcf.

[0202] In some embodiments, the relative centrifugal force is 4000-10000 rcf, for example about 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000 rcf.

[0203] In some embodiments, the centrifugation temperature in step 1) is 0-25°C.

[0204] In some embodiments, the centrifugation temperature is 20-25°C, for example 21°C, 22°C, 23°C, 24°C or 25°C.

[0205] In some embodiments, the centrifugation time in step 1) is 2-40 min.

[0206] In some embodiments, the centrifugation time is 5-20 min, for example, about 5 min, 6 min, 7 min, 8 min, 9 min, 10 min, 11 min, 12 min, 13 min, 14 min, 15 min, 16 min, 17 min, 18 min, 19 min or 20 min.

[0207] In some implementations, pure water is used for sedimentation and washing in step 2).

[0208] In some embodiments, in step 2), 1 to 4 times the mass (w / w) of pure water is added to the precipitate obtained in step 1) for washing, and the washing aqueous phase is removed by centrifugation.

[0209] In some embodiments, the amount of pure water added is 2 to 3 times the mass (w / w) of precipitate 1.

[0210] In some embodiments, an alcohol solvent is used for washing and dehydration in step 2); preferably, the alcohol solvent is selected from one or more of acetonitrile, methanol, acetone, ethanol, and isopropanol; preferably, the alcohol solvent is acetonitrile.

[0211] In some embodiments, in step 2), 1 to 4 times the mass (w / w) of alcohol solvent is added to the precipitate after washing with pure water for washing and dehydration, and the aqueous solution is removed by centrifugation.

[0212] In some embodiments, the amount of the alcohol solvent used is 2 to 3 times the mass (w / w) of the precipitate.

[0213] In some embodiments, the washing and dewatering temperature is 10-80°C.

[0214] In some embodiments, the washing and dewatering temperature is 10-60°C, for example, about 10°C, 15°C, 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C or 60°C.

[0215] In some embodiments, the extractant used in step 3) is a low-carbon alcohol or ester; preferably, the extractant is dichloroethane.

[0216] In some embodiments, the precipitate after washing and dehydration is extracted 1 to 10 times its weight (w / w) of extractant in 1 to 5 fractions.

[0217] In some embodiments, the amount of extractant used is 2 to 6 times the mass (w / w) of precipitate 3, for example, about 2, 3, 4, 5 or 6 times.

[0218] In some embodiments, the extraction is performed 2-3 times.

[0219] In some embodiments, the extraction vessel is a mechanically stirred tank.

[0220] In some embodiments, the extraction time is 0.1-8 hours.

[0221] In some embodiments, the extraction time is about 0.1, 0.5, 1, 2, 3, 4, 5, 6, 7 or 8 hours.

[0222] In some embodiments, the extraction temperature is 0–80°C.

[0223] In some embodiments, the extraction temperature is about 0°C, 10°C, 20°C, 30°C, 40°C, 50°C, 60°C, 70°C, or 80°C.

[0224] In some embodiments, the method for extracting zeaxanthin from microbial fermentation broth further includes: 4) the step of extract phase concentration.

[0225] In some implementations, the extract phase is concentrated by evaporation.

[0226] In some implementations, the extract phase is concentrated by rotary evaporation.

[0227] In some embodiments, the rotary evaporation temperature in step 4) is 0-60°C, for example, about 0°C, 10°C, 20°C, 30°C, 40°C, 50°C, 60°C.

[0228] In some embodiments, the rotary evaporation vacuum is 10-1000 mbar, for example about 10, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 mbar.

[0229] In some embodiments, the rotary evaporation temperature is 20-50°C, for example about 20°C, 25°C, 30°C, 35°C, 40°C, 45°C or 50°C.

[0230] In some embodiments, the rotary evaporation vacuum is 20-60 mbar, for example about 20, 30, 40, 50 or 60 mbar.

[0231] In some embodiments, the container for evaporation and concentration is a rotary flask.

[0232] In some implementations, the rotary evaporation operation is stopped when no more liquid drips out.

[0233] In some embodiments, the method for extracting zeaxanthin from microbial fermentation broth further includes: 5) a step of concentrating the slurry and washing it with solvent.

[0234] In some embodiments, the washing solvent in step 5) is selected from one or more of low-carbon hydrocarbons, alcohols, esters, and halogenated hydrocarbons; preferably, the washing solvent is ethanol.

[0235] In some embodiments, in step 5), 1-50 times the mass (w / w) of washing solvent is added to the concentrated slurry, the washing temperature is 0-100°C, and the washing time is 0.1-5.0 hours.

[0236] In some embodiments, the amount of the washing solvent is 5 to 20 times that of the concentrated slurry, for example, about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times.

[0237] In some embodiments, the washing temperature is 30-60°C, for example, about 30°C, 35°C, 40°C, 45°C, 50°C, 55°C or 60°C.

[0238] In some embodiments, the washing time is 0.2-2.0 hours. For example, about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2.0 hours.

[0239] In some embodiments, the method for extracting zeaxanthin from microbial fermentation broth further includes 6) filtration of concentrated slurry and optionally 7) drying of filter cake.

[0240] In some embodiments, step 6) involves filtration of the concentrated slurry to obtain a wet filter cake and a mother liquor.

[0241] In some embodiments, step 7) of drying the filter cake further includes a step of washing the filter cake with hot ethanol.

[0242] In some embodiments, in step 7), the filter cake is dried at a temperature of 30-100°C, a vacuum of 1-20 kPa, and a drying time of 12-24 hours.

[0243] In some embodiments, the drying temperature for drying the filter cake is 30-60°C, for example, about 30°C, 35°C, 40°C, 45°C, 50°C, 55°C or 60°C.

[0244] In some implementations, the vacuum level is 1-10 kPa, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 kPa.

[0245] In some implementations, the drying time is 12-18 hours, for example about 12, 13, 14, 15, 16, 17 or 18 hours.

[0246] In some embodiments, the container for drying the filter cake is a vacuum oven.

[0247] Example

[0248] The invention will be more readily understood by referring to the following examples, which are only used to illustrate certain aspects and embodiments of the invention and are not intended to limit the invention.

[0249] Unless otherwise stated, all reagents used in this embodiment are commercially available or conventional materials.

[0250] Example 1: Construction of recombinant lipophilic yeast producing zeaxanthin

[0251] 1.1 Starting strain

[0252] In this embodiment of the invention, Yarrowia lipolytica Po1f was used as the starting strain, purchased from ATCC, with the number MAY-2613 and the genotype MATA ura3-302leu2-270xpr-322axp2-deltaNU49XPR2::SUC2.

[0253] 1.2 Culture medium composition

[0254] Escherichia coli culture medium: LB-Amp medium, with the following formula: 10g peptone, 5g yeast extract, 10g NaCl, 1L deionized water, and 100mg / L ampicillin (Amp) added after sterilization; if it is a solid culture medium, an additional 2% (20g / L) concentration of agar powder needs to be added.

[0255] YPD medium for Yeast Extract: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose; if it is a solid medium, an additional 2% (20 g / L) concentration of agar powder should be added.

[0256] YPD-Hph medium for Yersinia lipolyticis: Sterilized YPD medium supplemented with 500 mg / L hygromycin (Hph), 500 mg / L bleomycin (zeocin) and 500 mg / L genimycin (G418).

[0257] YPD-Nat lipophilic yeast medium: Sterile YPD medium supplemented with 1 g / L hygromycin (Hph), 1 g / L bleomycin (zeocin) and 1 g / L genimycin (G418).

[0258] SCD-Ura medium for Yeast Extract: 1.7 g / L yeast inorganic nitrogen source, 5 g / L ammonium sulfate, 0.62 g / L DOSupplement-Leu / -Trp / -Ura, 0.1 g / L L-leucine (Leu), 0.05 g / L L-tryptophan (Trp), 20 g / L glucose. If it is a solid medium, an additional 2% (20 g / L) concentration of agar powder needs to be added.

[0259] SCD-Leu lipophilic yeast medium: yeast inorganic nitrogen source 1.7 g / L, ammonium sulfate 5 g / L, DOSupplement-Leu / -Trp / -Ura 0.62 g / L, uracil (Ura) 0.02 g / L, L-tryptophan (Trp) 0.05 g / L, glucose 20 g / L. If it is a solid medium, an additional 2% (20 g / L) concentration of agar powder needs to be added.

[0260] Yeast extract culture medium (BSM): Potassium dihydrogen phosphate 8 g / L, ammonium sulfate 7.5 g / L, magnesium sulfate heptahydrate 6.15 g / L, urea 3.4 g / L, BSM vitamins 3 ml, BSM metal elements 5 ml. The pH was adjusted to 5.5 by adding NaOH or H2SO4. The BSM vitamin formula was: Biotin 0.2 g / L, potassium para-aminobenzoate 0.8 g / L, vitamin B3 4 g / L, inositol 10 g / L, vitamin B1 4 g / L, vitamin B6 4 g / L, and calcium pantothenate 4 g / L. The BSM metal element formula is as follows: 0.5M oxaloacetic acid tetraacetic acid 160ml / L, zinc sulfate heptahydrate 11.5g / L, copper sulfate 0.64g / L, manganese chloride tetrahydrate 0.64g / L, cobalt chloride hexahydrate 0.94g / L, sodium molybdate dihydrate 0.96g / L, ferrous sulfate heptahydrate 5.6g / L, and calcium chloride dihydrate 5.6g / L.

[0261] 1.3 Donor DNA Construction Method

[0262] The construction of donor DNA includes the following steps

[0263] 1) Construction of donor DNA template plasmids. Using pUC57 as the vector backbone, resistance gene expression cassettes or selection gene expression cassettes (resistance genes include the hygromycin gene, and selection genes include the URA3 or LEU2 gene) and the target gene expression cassette to be integrated into the Yersinia lipolytica genome were inserted using the Gibson method. Plasmid cloning and DNA amplification were performed using E. coli DH5α medium as described in section 1.2. The Gibson construction method specifically involves: first, amplifying the backbone and the fragments to be inserted using PCR; designing primers to ensure that the two DNA fragments to be ligated have a 30-40 bp homologous region at their interface; then, these donor DNA fragments and the Gibson method were used... Master Mix (NEB) was mixed and incubated at 50°C for 60 minutes. T5 exonuclease generated single-stranded 3' overhangs, prompting annealing of complementary terminal repeat sequences (overlapping regions). Phusion polymerase filled the gaps in the annealed fragments, and Taq DNA ligase ligated the assembled DNA at the cut site. Finally, the incubated mixture was transferred into *E. coli* to amplify the plasmid DNA. Lox71 and Lox66 sequences were introduced before and after the expression cassette for the resistance gene and selection gene, respectively, to recover the resistance gene or selection gene after integration of the linear DNA into the genome via Cre enzyme expression plasmid. Promoters used in the target gene expression cassette included pTEFin (SEQ ID NO: 50), pGPD (SEQ ID NO: 51), and 8UASEXP (SEQ ID NO: 52). Terminators used in the target gene expression cassette were Txpr2 and Tip2.

[0264] 2) Using the donor DNA template plasmid as a template, DNA fragments containing the expression cassettes of resistance genes or selection genes and the target gene expression cassette were amplified by PCR (primers are shown in Table 3). The PCR reaction system used for donor DNA fragment amplification was as follows: 50 μL reaction system containing 25 μL Q5 DNA polymerase mix, 2.5 μL each of upstream and downstream primers, 1 μL template, and 19 μL ddH2O. The PCR cycling program was: pre-denaturation at 98℃ for 2 min, denaturation at 98℃ for 10 s, annealing at 55℃ for 10 s, extension at 72℃ for 30 s / kb, for 31 cycles; extension at 72℃ for 3 min, and storage at 4℃.

[0265] 3) The PCR products were purified by magnetic bead method. The purified donor DNA can be directly transformed into Yersinia lipolyticis to achieve genome integration.

[0266] The donor DNA information in this invention is shown in Table 2.

[0267] Table 2 Donor DNA Information in this Invention

[0268]

[0269] Except for DNA6336, all DNAs in Table 2 are linear donor DNAs. DNA6336 is a suicide plasmid that cannot replicate in yarrowia.

[0270] The primers used for amplifying the donor DNA are shown in Table 3.

[0271] Table 3

[0272] hph_AF 27 aagtaccagctcccctcacttacc LIP_R 28 ccattcgatcgcatgctggtttc ADD_LEUF 29 aacaaccgattccaacaggttaccgt GSY_R 30 ctacgtttgcctcacatcgaactact ADD_R1 31 tcgcatctcgatgagctggc 18211-F 32 accgattccaaccagtgactttg 18211-R 33 gggacacaaatacgccgccaacccggtctgtatccacgacaaaaacatttgtc 17881_F 34 accagacaaatgtttttgtcgtggatacagaccgggttggcggcgtatttg 17881_R 35 attccaagttgctgcttgatggg

[0273] Information on the integration of donor DNA into the genome is shown in Table 4.

[0274] Table 4. Plasmid integration site information

[0275]

[0276] 1.4 Recovery of resistance or tag genes

[0277] The method for recovering resistance or tag genes used in this invention employs the Cre-LoxP recombination system. After transforming the recombinase plasmid (AP18860) driven by pTEFin Cre expression into *Yarrowia lipolytica*, the Cre recombinase recognizes two LoxP sites (Lox 71 and Lox 66) with the same forward and backward orientation of the resistance or tag gene, thereby mediating the knockout of the gene between the two LoxP sites. Furthermore, Lox 71 and Lox 66 are retained in the genome as the Lox 72 sequence after recombination. The AP18860 plasmid contains the pBR322 sequence and kanamycin resistance marker for replication in *E. coli*, and the ORI1001 sequence and nourseothricin resistance marker for replication in *Yarrowia lipolytica*. The plasmid map is shown below. Figure 1 As shown.

[0278] 1.5 96-well plate fermentation method

[0279] 1) After yeast transformation, the transformants were inoculated into 96-well plates containing YPD medium and cultured for 1 day in a shaker at 30°C and 800 rpm.

[0280] 2) Subculture the obtained culture medium into a new 96-well plate containing fresh YPD or BSM medium and incubate for 3 days in a shaker at 30°C and 800 rpm.

[0281] 1.6 Extraction and Detection Methods for β-Carotene and Zeaxanthin in Fermentation Products

[0282] Take 20 μL of bacterial culture and add 750 μL of extraction buffer (dimethyl sulfoxide: ethyl acetate: methanol = 1:0.5:1). Shake at 2000 rpm for 20 minutes, sonicate at 25°C for 10 minutes, shake on a 30°C shaker at 1500 rpm for 60 minutes, and then centrifuge at 25°C at 4000 rpm for 20 minutes. Collect the supernatant for ultra-high performance liquid chromatography (UHPLC). Detection conditions are as follows:

[0283] 1) Chromatographic column: CHIRALPAK AD-H LC column 4.6mm*250 5μm;

[0284] 2) Mobile phase: A1: Isopropanol; B1: n-Hexane;

[0285] 3) Injection volume: 2.5 μL;

[0286] 4) Seal wash: 10% isopropanol;

[0287] 5) Needle wash: Methanol: Ethyl acetate = 1:1;

[0288] 6) Column temperature: 30℃;

[0289] 7) Flow rate: 0.7 ml / min;

[0290] 8) Gradient elution

[0291] The conditions are shown in Table 5;

[0292] Table 5: Gradient elution conditions

[0293] 0 5.5 94.5 0.7 10 5.5 94.5 0.7 40 15 85 0.7 41 5.5 94.5 0.7 45 5.5 94.5 0.7

[0294] 9) Running time: 45 minutes;

[0295] 10) Wavelength: 452nm.

[0296] The concentration can be calculated by comparing the peak areas of zeaxanthin and β-carotene in the analyte obtained by liquid chromatography with the peak areas obtained by the standard, and the concentration is expressed in mg / L in this patent.

[0297] The relative zeaxanthin titer is calculated as: average zeaxanthin concentration of the target strain / average zeaxanthin concentration of the starting strain. In this paper, both concentration and titer refer to the mass of the target substance per unit volume. In this paper, the starting strain refers to the chassis strain demonstrating the described technical solution.

[0298] Zeaxanthin percentage calculation: (zeaxanthin concentration) / (zeaxanthin concentration + β-carotene concentration) × 100%.

[0299] 1.7 BOTA01026 Recombinant Yersinia delbrueckii

[0300] Using wild-type strain Po1f (ATCC number MAY-2613) as the starting strain, plasmid DNA6336 (SEQ ID NO: 19) expressing the complete β-carotene pathway gene (CarB / CarRP / CrtE) was transformed into the β-carotene production starting strain BOTA01023. The DNA6336 plasmid map is shown below. Figure 2 As shown, DNA6336 is a circular plasmid containing only the pBR322 sequence used for replication in E. coli. After whole-genome sequencing of BOTA01023, it was found that the plasmid was successfully integrated into the Locus 1 site within 500 bp upstream and downstream.

[0301] Subsequently, based on strain BOTA01023, CarB gene expression was introduced into the genome. The linear donor DNA ADD5278 (SEQ ID NO: 20) carrying the CarB gene was transformed into strain BOTA01023 to obtain strain BOTA01025. ADD5278 was amplified using SOE (Gene splicing by overlap extension PCR, https: / / doi.org / 10.1038 / nprot.2007.132). First, the LEU2 expression cassette was amplified using primers 18211-F and 18211-R, then the CarB expression cassette was amplified using primers 17881-F and 17881-R. Subsequently, using these two fragments as templates, the two fragments were spliced ​​together using primers 18211-F and 17881-R. After whole-genome sequencing verification, the integration site of the linear donor DNA ADD5278 was Locus 2.

[0302] Subsequently, based on strain BOTA01025, DGA1 gene expression was introduced into the genome. First, using the aforementioned tag gene recovery method, strains with recovered tag genes were obtained. Then, the linear donor DNA ADD6303 (SEQ ID NO: 21) carrying the DGA1 gene was transformed into strain BOTA01025, overexpressing DGA1 to obtain strain BOTA01027. The amplification primers for ADD6306 were ADD_LEUF and GSY_R. After whole-genome sequencing verification, the integration site of the linear donor DNA ADD6306 was Locus3.

[0303] Subsequently, based on strain BOTA01027, the tHMGR gene was introduced into the genome for expression. First, using the aforementioned tag gene recovery method, strains with recovered tag genes were obtained. Then, linear donor DNA ADD5976 (SEQ ID NO: 22) was transformed into strain BOTA01027, and tHMGR was overexpressed to obtain strain BOTA01017. Figure 3 The amplification primers for ADD5976 were ADD_LEUF and GSY_R. After whole-genome sequencing verification, the integration site of the linear donor DNA ADD5976 was Locus4, and two copies of tHMGR(ADD5976) were found integrated at Locus4, which is due to the NHEJ integration method used.

[0304] Using BOTA01017 as the chassis strain, CrtZ_9GAMM (transformed from linear donor DNAADD6957, SEQ ID NO: 23) was introduced into the genome to obtain strain BOTA01018, which successfully achieved the conversion of β-carotene to zeaxanthin, with a yield of 107 mg / L. Figure 4 The PCR amplification primers for the linear donor DNA ADD6957 were hph_AF and LIP_R. After whole-genome sequencing verification, the genomic insertion site of ADD6975 was Locus 5.

[0305] After obtaining the tag gene recovered strain using the above-mentioned tag gene recovery method, strain BOTA01018 was simultaneously overexpressed with CrtE and ERG19 in its genome (transformed with linear donor DNA ADD7684, SEQ ID NO: 24) to obtain strain BOTA01021. Using a 96-well plate fermentation method, the strain was able to further increase the yield of zeaxanthin to 210 mg / L, representing a 96% increase compared to BOTA01018. Figure 4 The amplification primers for the linear donor DNA ADD7684 were ADD_LEUF and GSY_R. After whole-genome sequencing verification, the genomic insertion site of ADD7684 was determined to be Locus 6.

[0306] In BOTA01021, after obtaining the tag gene recovered strain using the aforementioned tag gene recovery method, the linear donor DNA ADD7670 (SEQ ID NO: 25) containing codon-optimized version 2 of CrtZ_SACS2 was transformed into BOTA01021 to obtain strain BOTA01019. The amplification primers for ADD7670 were ADD_LEUF and GSY_R. After whole-genome sequencing verification, the genomic insertion site of ADD7670 was Locus 7. Using a 96-well plate fermentation method, strain BOTA01019 showed a 152% increase in zeaxanthin yield compared to BOTA01021. Figure 5 ).

[0307] In BOTA01019, after obtaining the tag gene recovered strain using the aforementioned tag gene recovery method, the linear donor DNA ADD9423 (SEQ ID NO: 26) was transformed into BOTA01019 to obtain strain BOTA01026. This design incorporates the flexible linker sequence APGRY (SEQ ID NO: 53) linking CrtZ_SACS2 and ERG6. The amplification primers for ADD9423 were ADD_LEUF and ADD_R1. Using a 96-well plate fermentation assay, the results showed that the fusion-expressed CrtZ significantly increased the proportion of zeaxanthin in carotenoids. Using BOTA01019 as a chassis, after overexpressing the CrtZ fusion-expressed with ERG6, the zeaxanthin proportion in BOTA01026 was 81%, an increase of 39% compared to BOTA01019. Figure 6 ).

[0308] Example 2: Preparation of Fermentation Broth

[0309] 2.1 Primary 500ml shake flask fermentation

[0310] Culture medium: YPD medium. The liquid volume is 20%, the inoculum is 1% v / v, the shaker speed is 200 rpm (26 mm amplitude), and the culture is carried out at 30°C for 24-28 hours.

[0311] 2.2 Fermentation and conversion of zeaxanthin in a 3L fermenter

[0312] The initial fermentation medium was formulated as follows: glucose 40 g / L, potassium dihydrogen phosphate 8 g / L, magnesium sulfate heptahydrate 6.15 g / L, ammonium sulfate 15 g / L, 5 mL / L TMS solution, and 3 mL / L vitamin solution. The inoculum size was 10% (v / v), the stirring speed was 600-1200 rpm, the aeration ratio was 1.0-1.5 VVM, and the dissolved oxygen was controlled at 20%. The pH was maintained at 5.5 using 25% ammonia water. After culturing at 30°C for 24-28 hours until the carbon source in the initial medium was depleted, fed-batch culture began. The fed-batch medium was formulated as follows: glucose 490 g / L, potassium dihydrogen phosphate 12.8 g / L, magnesium sulfate heptahydrate 9.8 g / L, ammonium sulfate 167.2 g / L, 5 mL / L TMS solution, and 3 mL / L vitamin solution. A constant dissolved oxygen feeding strategy was used during the fed-batch culture, with the dissolved oxygen level controlled at 20%. Fermentation was terminated after 120 hours of fed-batch culture.

[0313] TMS solution formulation: ferrous sulfate heptahydrate 5.6 g / L, zinc sulfate heptahydrate 11.5 g / L, copper sulfate 0.64 g / L, manganese chloride tetrahydrate 0.5 g / L, cobalt chloride hexahydrate 0.94 g / L, calcium chloride dihydrate 5.6 g / L, sodium molybdate dihydrate 0.96 g / L, 0.5 M EDTA 160 mL / L.

[0314] Vitamin solution formula: Biotin 0.2g / L, para-aminobenzoic acid 0.8g / L, niacin 4g / L, inositol 10g / L, calcium pantothenate 4g / L, pyridoxine hydrochloride 4g / L, thiamine hydrochloride 4g / L.

[0315] Example 3: Purification of Fermentation Broth

[0316] Experimental Example

[0317] 1917g of fermentation broth was harvested (containing 2892mg of zeaxanthin, spectral data as shown). Figure 7 As shown), the homogenization temperature was controlled below 30℃, and high-pressure homogenization was performed three times at 800 bar. 1908g of the broken liquid was harvested (containing 2888mg of zeaxanthin; spectrum shown). Figure 8 (As shown); Centrifuge at 8000 rcf for 10 min at room temperature to harvest 1213 g of wet cells; Add 1213 g of purified water to the cells, centrifuge at 8000 rcf for 10 min at room temperature to harvest 1730 g of aqueous phase (containing 3 mg of zeaxanthin, chromatogram shown). Figure 9 (As shown), 693g of solid phase was centrifuged; 693g of acetonitrile was added to the centrifuged solid phase, and the mixture was centrifuged at 8000 rcf for 10 min at room temperature, yielding 782g of aqueous phase (containing 23mg of zeaxanthin, chromatogram shown). Figure 10 As shown), the solid phase was centrifuged to 398g; then, using 6 times its mass of dichloroethane (2388g), it was extracted three times at 25°C for 2 hours each time, yielding a total of 2702g of extract (containing 2406mg of zeaxanthin, chromatogram shown). Figure 11 As shown), the extraction residue was 81g (containing 202mg of zeaxanthin, chromatogram as shown). Figure 12 (As shown); the extract was concentrated at 30℃ and 60mbar until no liquid distilled off, yielding 66g of concentrated slurry; 1320g of ethanol was added to the concentrated slurry, and the mixture was stirred at 50℃ for 0.5 hours; the concentrated slurry was filtered, and the filter cake was washed with hot ethanol to obtain the mother liquor (containing 146mg of zeaxanthin, spectral diagram shown). Figure 13 (As shown); the wet filter cake was placed in a 60℃ oven, the vacuum degree was set to 2KPa, and after drying for 18 hours, 2452mg of reddish-brown solid powder was obtained (containing 2255mg of zeaxanthin, spectrum as shown). Figure 14 As shown in the figure, the purity of zeaxanthin was 92%, and the downstream purification yield was 78%.

[0318] Comparative Example 1

[0319] 1000g of fermentation broth (containing 1872mg zeaxanthin) was harvested. Homogenization was performed three times at 800 bar under controlled temperature below 30℃, yielding 995g of the broken broth (containing 1866mg zeaxanthin). The broth was centrifuged at 8000rcf for 10min at room temperature, yielding 376g of wet cells. 376g of purified water was added to the cells, and the mixture was centrifuged at 8000rcf for 10min at room temperature, yielding 472g of the aqueous phase (containing 1mg zeaxanthin) and 277g of the solid phase. 554g of methanol was added to the solid phase, and the mixture was centrifuged at 8000rcf for 10min at room temperature, yielding 622g of the light phase (containing 7mg zeaxanthin) and 202g of the solid phase. Six times the mass of dichloroethane (1212g) was used. The extract was extracted three times at 25°C for 2 hours each time, yielding a total of 1315g of extract (containing 1684mg of zeaxanthin) and 34g of residue (containing 45mg of zeaxanthin). The extract was concentrated at 30°C and 60mbar until no liquid distilled off, yielding 21g of concentrated slurry. 420g of ethanol was added to the concentrated slurry, and the mixture was stirred at 50°C for 0.5 hours. The concentrated slurry was filtered, and the filter cake was washed with hot ethanol to obtain the mother liquor (containing 24mg of zeaxanthin). The wet filter cake was placed in a 60°C oven at a vacuum of 2kPa and dried for 18 hours to obtain 1982mg of reddish-brown solid powder (containing 1348mg of zeaxanthin). The zeaxanthin purity was 68%, and the downstream purification yield was 72%.

[0320] Comparative Example 2

[0321] 1000g of fermentation broth (containing 1785mg zeaxanthin) was harvested. Homogenization was performed three times at 800 bar under controlled temperature below 30℃, yielding 992g of the broken broth (containing 1782mg zeaxanthin). The broth was centrifuged at 8000 rcf for 10 min at room temperature, yielding 412g of wet cells. 412g of purified water was added to the cells, and the mixture was centrifuged at 8000 rcf for 10 min at room temperature, yielding 508g of the aqueous phase (containing 1mg zeaxanthin) and 309g of the solid phase. 618g of methanol was added to the solid phase, and the mixture was centrifuged at 8000 rcf for 10 min at room temperature, yielding 713g of the light phase (containing 6mg zeaxanthin) and 212g of the solid phase. A 6-fold dilution was used. A total of 1272g of dichloroethane was extracted three times at 25°C for 2 hours each time, yielding a total of 1439g of extract (containing 1624mg of zeaxanthin) and 42g of residue (containing 56mg of zeaxanthin). The extract was concentrated at 30°C and 60mbar until no liquid distilled off, yielding 21g of concentrated slurry. The concentrated slurry was filtered, and the filter cake was washed with dichloroethane to obtain the mother liquor (containing 21mg of zeaxanthin). The wet filter cake was placed in a 60°C oven under a vacuum of 2kPa and dried for 18 hours to obtain 2893mg of reddish-brown solid powder (containing 1302mg of zeaxanthin). The zeaxanthin purity was 45%, and the downstream purification yield was 73%.

[0322] Comparative Example 3

[0323] Harvest 1000g of fermentation broth (containing 1862mg of zeaxanthin), control the homogenization temperature below 30℃, and homogenize three times at 800 bar to harvest 988g of broken broth (containing 1855mg of zeaxanthin); centrifuge at 8000 rcf for 10 min at room temperature to harvest 408g of wet cells; add 408g of purified water to the cells, centrifuge at 8000 rcf for 10 min at room temperature to harvest 522g of aqueous phase (containing 3mg of zeaxanthin), and 288g of solid phase; add 576g of methanol to the solid phase, centrifuge at 8000 rcf for 10 min at room temperature to harvest 682g of light phase (containing 8mg of zeaxanthin), and 177g of solid phase; use 6 times... 1062 g of isopropanol was extracted three times at 25 °C for 2 hours each time, yielding a total of 1170 g of extract (containing 1135 mg of zeaxanthin) and 62 g of residue (containing 596 mg of zeaxanthin). The extract was concentrated at 30 °C and 60 mbar until no liquid distilled off, yielding 32 g of concentrated slurry. The concentrated slurry was filtered, and the filter cake was washed with isopropanol to obtain a mother liquor (containing 36 mg of zeaxanthin). The wet filter cake was placed in a 60 °C oven under a vacuum of 2 kPa and dried for 18 hours to obtain 1817 mg of reddish-brown solid powder (containing 763 mg of zeaxanthin). The zeaxanthin purity was 42%, and the downstream purification yield was 41%.

[0324] Comparative Example 4

[0325] 1000g of fermentation broth (containing 1735mg of zeaxanthin) was harvested. Homogenization was performed three times at 800 bar, controlling the homogenization temperature below 30℃, yielding 991g of the broken broth (containing 1733mg of zeaxanthin). The broth was centrifuged at 8000 rcf for 10 min at room temperature, yielding 378g of wet cells. 378g of purified water was added to the cells, and the mixture was centrifuged at 8000 rcf for 10 min at room temperature, yielding 445g of the aqueous phase (containing 2mg of zeaxanthin) and 306g of the solid phase. Six times the mass of dichloroethane (1836g) was used for extraction, three times at 25℃ for 2 hours each time, yielding a total of 1967g of extract (containing 734mg of zeaxanthin). The residue was... 162g of residue (containing 876mg of zeaxanthin); the extract was concentrated at 30℃ and 60mbar until no liquid distilled off, yielding 18g of concentrated slurry; 360g of ethanol was added to the concentrated slurry, and the mixture was stirred at 50℃ for 0.5 hours; the concentrated slurry was filtered, and the filter cake was washed with hot ethanol to obtain mother liquor (containing 34mg of zeaxanthin); the concentrated slurry was filtered, and the filter cake was washed with hot ethanol to obtain mother liquor (containing 36mg of zeaxanthin); the wet filter cake was placed in a 60℃ oven, and the vacuum degree was set to 2KPa. After drying for 18 hours, 979mg of reddish-brown solid powder (containing 617mg of zeaxanthin) was obtained, with a zeaxanthin purity of 63% and a downstream purification yield of 36%.

Claims

1. A method for extracting zeaxanthin from microbial fermentation broth or fermentation cells, characterized in that, The method includes: 1) pretreatment of fermentation broth or fermentation cells to obtain a precipitate; 2) washing the precipitate and removing water; and 3) precipitate extraction, wherein the solvent used for washing and removing water is acetonitrile, and the extractant used for precipitate extraction is dichloroethane; wherein the microorganism is Yersinia lipolyticis; in step 2), 1-4 times the mass (w / w) of acetonitrile is added to the precipitate after washing with pure water for washing and removing water, and the aqueous solution is removed by centrifugation; in step 3), the precipitate after washing and removing water is extracted 1-10 times the mass (w / w) of dichloroethane in 1-5 extractions.

2. The method according to claim 1, wherein pure water is used for precipitation and washing in step 2).

3. The method according to claim 1, wherein the method further comprises: 4) The step of extracting phase concentration.

4. The method according to claim 3, wherein the method further comprises 5) the step of concentrating the slurry solvent for washing away impurities.

5. The method according to claim 4, wherein the solvent for washing impurities in step 5) is selected from one or more of low-carbon hydrocarbons, alcohols, esters, and halogenated hydrocarbons.

6. The method according to claim 5, wherein the solvent for washing is ethanol.

7. The method of claim 4, wherein the method further comprises: 6) The concentrated slurry is filtered to obtain a filter cake.

8. The method according to claim 7, further comprising the step of 7) drying the filter cake.

9. The method of claim 8, wherein step 7) further comprises washing the filter cake with hot ethanol before drying the filter cake.

10. The method according to claim 1, wherein the pretreatment of fermentation broth or fermentation cells in step 1) includes cell disruption and centrifugation.

11. The method according to claim 10, wherein the relative centrifugal force of centrifugation is 3000-12000rcf, the centrifugal temperature is 0-25℃, and the centrifugal time is 2-40min.

12. The method according to claim 1, wherein in step 2), 1 to 4 times the mass (w / w) of pure water is added to the precipitate obtained in step 1) for washing, and the washing aqueous phase is removed by centrifugation.

13. The method according to claim 3, wherein in step 4), the extract phase is concentrated by evaporation.

14. The method according to claim 4, wherein in step 5), 1-50 times the mass (w / w) of washing solvent is added to the concentrated slurry, the washing temperature is 0-100°C, and the washing time is 0.1-5.0 hours.

15. The method according to claim 8, wherein the temperature for drying the filter cake in step 7) is 30-100°C, the vacuum degree is 1-20 kPa, and the drying time is 12-24 hours.

16. The method according to claim 1, wherein the *Yersinia lipolytica* is a recombinant *Yersinia lipolytica*.

17. The method of claim 16, wherein the recombinant Yersinia lipolytica comprises an introduced gene encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranyl-geranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase or a truncated form thereof (tHMGR), β-carotene hydroxylase (CrtZ_9GAMM) from Pantoea stewartii, mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase (CrtZ_SACS2) from Saccharolobus solfataricus, and the β-carotene hydroxylase CrtZ_SACS2-ERG6 fusion protein.

18. The method of claim 17, wherein the recombinant Yersinia lipolytica genome is inserted with a combination of the following DNA sequences or fragments thereof: SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26; wherein, The fragment is a sequence obtained by removing the resistance gene or the screening gene from any one of SEQ ID NO: 26-32, 35.

19. The method according to claim 16, wherein the starting strain for constructing the recombinant Yersinia lipophila is Polf.

Images