Biocontrol strain 2a1, bacterial agent and application thereof

CN119875852BActive Publication Date: 2026-08-18JIANGSU ACAD OF AGRI SCI
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
CN202510212332.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-25
Publication Date
2026-08-18
Estimated Expiration
2045-02-25

AI Technical Summary

Technical Problem

然而,现有技术的生防资源有限,寻找新的生防菌株具有重要意义

Benefits of technology

[0026] The biocontrol strain of the present invention, Penicillium fructuariae-cellaei 2A1, can effectively inhibit Fusarium pseudograminearum, Rhizoctonia solani, Verticillium dahliae, and M. oryzae, and is suitable for the prevention and control of wheat stem rot, wheat sheath blight, cotton Verticillium wilt, and rice blast.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119875852B_ABST
    Figure CN119875852B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of biocontrol strain 2A1, its bacterial agent and application.The biocontrol strain Penicillium fructuariae-cellaei 2A1, preservation number is CGMCC NO.41539.The biocontrol agent contains above-mentioned biocontrol strain or its fermentation liquor.Concrete application is for preventing and treating wheat stem base rot, wheat sheath blight, cotton verticillium wilt or rice blast.The biocontrol strain of the present application can effectively inhibit F.pseudograminearum, R.cerealis, V.dahliae, M.oryzae, and is suitable for preventing and treating wheat stem base rot, wheat sheath blight, cotton verticillium wilt, rice blast.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a biocontrol strain 2A1, its inoculant and its application, belonging to the fields of agricultural biocontrol bacteria technology and microbial technology. Background Technology

[0002] Fusarium spp. is a large group of ascomycetes that produce falciform conidia, exhibiting rich diversity and including many plant pathogens. Among them, *Fusarium graminearum* infects wheat and causes Fusarium graminearum, while *Fusarium pseudograminearum* infects wheat and causes wheat stem rot. These two Fusarium diseases in wheat not only cause severe yield losses, but the pathogens also produce various fungal toxins, including 3-acetyl-deoxynivalenol (3AcDON), 15-acetyl-deoxynivalenol (15AcDON), and nivalenol (NIV), which can cause vomiting and decreased immune function in humans and animals, threatening human and animal health.

[0003] Rhizoctonia cerealis is the main pathogen causing wheat sheath blight, one of the most serious diseases affecting wheat-growing regions worldwide. In my country, sheath blight is a significant limiting factor for wheat yield in the middle and lower reaches of the Yangtze River and the Huang-Huai wheat-growing areas. Mild cases cause water loss and necrosis at the base of the wheat stem, leading to lodging. Severe cases result in withered whiteheads, drastically reducing wheat yield by 20%–40%. Currently, no wheat varieties are highly resistant to sheath blight; control relies mainly on chemical fungicides such as triazoles and amides.

[0004] Verticillium dahliae is a soil-borne pathogenic fungus that invades plants through the roots, colonizes, proliferates, and damages the vascular system, ultimately causing leaf yellowing and wilting. Verticillium dahliae infection in cotton causes cotton wilt disease, resulting in large-scale yield reductions or even total crop failure, with yield losses reaching 20%-30%. This fungus has a wide host range, infecting over 400 dicotyledonous plant species besides cotton, including important economic and vegetable crops such as tomatoes, potatoes, tobacco, sunflowers, eggplants, and lettuce, posing a significant threat to agricultural production.

[0005] Rice blast, caused by Magnaporthe oryzae, is a major disease affecting rice production, leading to significant yield reductions, sometimes as high as 40%-50%, or even complete crop failure. Rice blast can occur throughout the entire rice growth cycle, with leaf blast and neck blast being the most common, and neck blast having the most severe impact on yield. The risk of frequent rice blast outbreaks is extremely high in the Jianghuai and middle and lower reaches of the Yangtze River in my country, easily resulting in severe yield losses.

[0006] Currently, the control of the above-mentioned crop diseases mainly relies on chemical fungicides, but this method suffers from problems such as a limited selection of fungicides, large application rates in the field, and unstable efficacy. Biological control, as an environmentally friendly, safe for humans and livestock, and economically effective control method, has been widely recognized in global agricultural production. However, existing biological control resources are limited, making the search for new biological control strains of great significance.

[0007] A search revealed that the invention patent application with application number 202311867809.X and publication number CN 118086064A discloses a Penicillium chrysogenum ZJU810 that can inhibit Fusarium graminearum and Fusarium pseudograminearum. Its main purpose is to control wheat scab and inhibit the fungal toxins produced by the wheat scab fungus. However, it does not show any control effect on other crop diseases.

[0008] The inventors of this invention have achieved research results by developing biocontrol strains for the prevention and control of crop diseases, and are now applying for a patent for this invention. Summary of the Invention

[0009] The main objective of this invention is to overcome the problems existing in the prior art and provide a biocontrol strain 2A1 that can effectively inhibit various pathogens such as *Fusarium graminearum*, *Rhizoctonia graminearum*, *Verticillium dahliae*, and *Bacillus oryzae*, thereby preventing and controlling corresponding crop diseases. It also provides corresponding biocontrol agents and their applications.

[0010] The technical solution of this invention to solve its technical problem is as follows:

[0011] A biocontrol strain, Penicillium fructuariae-cellae 2A1, is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41539.

[0012] The fermentation broth of the biocontrol strain mentioned above.

[0013] This invention also provides:

[0014] A method for preparing a fermentation broth of a biocontrol strain, comprising the following steps:

[0015] Step 1: After culturing the biocontrol strains described above on PDA medium plates, remove the bacterial discs; place the bacterial discs in PDB liquid medium and culture with shaking at 25℃±1℃ to obtain the fermentation mixture.

[0016] The second step is to filter the fermentation mixture, centrifuge the obtained liquid to obtain the supernatant, and then pass the supernatant through a bacterial filter to remove spores, thus obtaining the biocontrol strain fermentation broth.

[0017] Preferably, in the first step, the diameter of the bacterial disc is 5±1mm, and the number of bacterial discs: volume of PDB liquid culture medium = 5 discs: 100±10mL; the culture conditions are: rotation speed of 200-250r / min, and time of at least 7 days.

[0018] Preferably, in the first step, the PDA culture medium consists of the following components: 200g potato, 15g agar powder, 20g glucose, and ddH2O to a final volume of 1L; the PDB liquid culture medium consists of the following components: 200g potato, 20g glucose, and ddH2O to a final volume of 1L.

[0019] Preferably, in the second step, at least three layers of sterile filter cloth are used for filtration; the centrifugation conditions are: at 25℃±1℃, centrifugation at 5000-6000rpm for at least 8min; the pore size of the bacterial filter is less than or equal to 0.22μm.

[0020] This invention also provides:

[0021] The aforementioned biocontrol strains or their fermentation broths are used to prepare biocontrol agents that inhibit Fusarium graminearum, Rhizoctonia graminearum, Verticillium dahliae, and rice blast fungus.

[0022] The aforementioned biocontrol strains or their fermentation broths are used to prepare biocontrol agents for the control of wheat stem base rot, wheat sheath blight, cotton verticillium wilt, or rice blast.

[0023] This invention also provides:

[0024] A biocontrol agent containing the aforementioned biocontrol strain or its fermentation broth.

[0025] The biocontrol agents mentioned above are used to control wheat stem base rot, wheat sheath blight, cotton verticillium wilt, or rice blast.

[0026] The biocontrol strain of the present invention, Penicillium fructuariae-cellaei 2A1, can effectively inhibit Fusarium pseudograminearum, Rhizoctonia solani, Verticillium dahliae, and M. oryzae, and is suitable for the prevention and control of wheat stem rot, wheat sheath blight, cotton Verticillium wilt, and rice blast. Attached Figure Description

[0027] Figure 1 This is a colony morphology diagram of strain 2A1 in Example 1 of the present invention. The left image is the front view, and the right image is the back view.

[0028] Figure 2 This is a phylogenetic tree of fungi constructed based on the ITS gene in Example 1 of the present invention.

[0029] Figure 3 This is a phylogenetic tree of fungi constructed based on the BenA-CaM gene combination in Example 1 of the present invention.

[0030] Figure 4 This is a plate confrontation diagram showing the antagonistic effects of strain 2A1 against various pathogens in Example 2 of the present invention. The CK group serves as a blank control.

[0031] Figure 5 This is a graph showing the inhibitory effect of different concentrations of fermentation broth from strain 2A1 in Example 3 of the present invention.

[0032] In the figure, A is Fusarium pseudograss CF14047, B is Fusarium grass PH-1, C is Rhizoctonia grass R0301; CK is the blank control.

[0033] Figure 6 This is a graph showing the changes in the number of Fusarium spores CF14047 under different treatments in Example 4 of the present invention.

[0034] Figure 7 This is a diagram showing the incidence of wheat coleoptile stem base rot under different treatments in Example 5 of the present invention.

[0035] The CK group served as a blank control.

[0036] Figure 8 This is a diagram showing the incidence of wheat stem base rot under different treatments in Example 6 of the present invention.

[0037] Figure 9 This is a diagram showing the growth of wheat under different treatments in Example 6 of the present invention. Detailed Implementation

[0038] The present invention will be further illustrated by the following examples, but the invention is not limited to these examples. All reagents involved in the present invention are commercially available. Unless otherwise specified, the experimental methods in the following examples are conventional methods.

[0039] Example 1

[0040] This example demonstrates the isolation and identification of bacterial strains.

[0041] The specific details of this embodiment are as follows:

[0042] (1) Separation

[0043] The inventors' team collected soil samples from a wheat field at a base of the Jiangsu Academy of Agricultural Sciences. Gravel and fallen leaves were removed using a 0.9mm soil sieve. Each soil sample (5g) was weighed and placed in a conical flask containing 45mL of sterile water, and shaken at 150rpm for 30 minutes. The resulting soil turbidity was serially diluted, and 100μL of the appropriate concentration was spread onto Martin's agar plates and incubated at 25℃ for 4-7 days. Based on the color and morphology of the colonies, the samples were purified by streak plating three times, and a pure strain, designated strain 2A1, was obtained.

[0044] (2) Identification

[0045] Morphological characteristics of strain 2A1 were identified, and the specific results are as follows:

[0046] (i) Morphological characteristics:

[0047] On PDA medium, strain 2A1 colonies are round, compact, relatively soft, and have intact edges. Initially white, they turn green in the center and white around the outer edge due to abundant spore formation, exhibiting radial growth. Yellow pigment is produced in the medium, resulting in pale yellow colonies on the reverse side. Figure 1 As shown.

[0048] (ii) Gene sequence characteristics:

[0049] The fungal DNA was extracted using a fungal genomic DNA extraction kit (Beijing Solarbio Science & Technology Co., Ltd.). Genomic DNA of strain 2A1 was extracted as a template, and PCR amplification was performed using universal primers for the ITS gene, and primers for the BenA and CaM genes, as detailed below.

[0050] Universal primers for the ITS gene:

[0051] ITS1: 5'-tccgtaggtgaacctgcgg-3' (SEQ ID NO: 1)

[0052] ITS4: 5'-tcctccgcttattgatatgc-3' (SEQ ID NO: 2)

[0053] The 25 μL reaction system consisted of: 12.5 μL of Taq PCR Mix premix (Sangon Biotech (Shanghai) Co., Ltd., hereinafter the same); 1 μL each of primers ITS1 and ITS4; 1 μL of genomic template of strain 2A1; and 9.5 μL of ddH2O.

[0054] The reaction conditions were: 95℃ for 5 min; 95℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 5 min.

[0055] The primers for the BenA gene are:

[0056] Bt2a: 5'-ggtaaccaaatcggtgctgctttc-3' (SEQ ID NO: 3)

[0057] Bt2b: ​​5'-accctcagtgtagtgacccttggc-3' (SEQ ID NO: 4)

[0058] The 25 μL reaction system consisted of: 12.5 μL of Taq PCR Mix premix; 1 μL each of primers Bt2a and Bt2b; 1 μL of genomic template of strain 2A1; and 9.5 μL of ddH2O.

[0059] The reaction conditions were: 95℃ for 5 min; 95℃ for 30 s, 61.3℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 5 min.

[0060] The primers for the CaM gene are:

[0061] CaM F: 5'-tcygagtacaaggaggcstt-3' (SEQ ID NO: 5)

[0062] CaM R: 5'-ccratggaggtcatracgtg-3' (SEQ ID NO: 6)

[0063] The 25 μL reaction system consisted of: 12.5 μL of Taq PCR Mix premix; 1 μL each of primers CaMF and CaMR; 1 μL of genomic template of strain 2A1; and 9.5 μL of ddH2O.

[0064] The reaction conditions were: 95℃ for 5 min; 95℃ for 30 s, 54.7℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 5 min.

[0065] The PCR amplification products were sequenced (Sangon Biotech (Shanghai) Co., Ltd.) to obtain the 555bp ITS gene sequence, the 501bp BenA gene sequence, and the 562bp CaM gene sequence.

[0066] ITS gene sequence (SEQ ID NO:7):

[0067] gttacgacgaggatctgggtccacctcccacccgtgtttatcgtaccttgttgcttcggcgggcccgcctcacggccgccggggggcacccgcccccgggccc

[0068] gcgcccgccgaagacaccattgaactctgtctgaagattgcagtctgagcgattagctaaatcagttaaaactttcaacaacggatctcttggttccggcatcgatg

[0069] aagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgagtctttgaacgcacattgcgccccctggtattccggggggcatgcctgt

[0070] ccgagcgtcattgctgccctcaagcacggcttgtgtgttgggcccccgcccctccccccgggggggcgggcccgaaaggcagcggcggcaccgcgtccgg

[0071] tcctcgagcgtatggggcttcgtcacccgctctgtaggcccggccggcgcccgccggcgaccccaatcaatctttccaggttgacctcggatcaggtagggata

[0072] cccgctgaacttaagcatatcaaaaggcggaggaa

[0073] BenA gene sequence (SEQ ID NO:8):

[0074] ggtttcgtgcccgccaccaacactgcccaacataacaaagcagcccctccgattgcgagtctgaatggacaagatgtactgactcgaactacaggcagaccatt

[0075] gctggtgagcacggccttgacggcgatggccagtaagtttcttcgataccactcgacaataccactcgaacgcggaatggcggtctgatattttttggctaggtac

[0076] aatggtacctccgacctccagctcgagcgcttgaacgtctacttcacccacgtaagttgcgtatccagtcaatgccgaaataccgaatacgattctaatcgatggat

[0077] cttttgtttcttaggccagcggtgacaagtacgttccccgtgccgttctggtcgatctggagcccggtaccatggacgctgtccgtgccggtccctttggcaagctct

[0078] tccgtcccgacaacttcgtcttcggtcagtccggtgctggtaacaactgggccaagggtcacaccctgggagggta

[0079] CaM gene sequence (SEQ ID NO:9):

[0080] ggggagggaagctctcgacgcgtgcattgacaatctccgatcgaaaaaaaaacagtagactgaccagggccggttttcccgcttgtcaacaggacaaggatgg

[0081] cgatggtgagtgcagtcattcccgatagctcggaagagtggtctttgggccattggaacttgcgaaaacttcaaaaacagaatgactaaagttgcatactattaata

[0082] ggccaaatcaccaccaaggagctcggcactgtcatgcgctcgctcggccagaacccctccgagtctgagctgcaggatatgatcaacgaggtcgatgccgac

[0083] aacaacggcaccattgacttccccggtacgctcttaatatcccaagctgtcaccagctgctattttctctctcagacccaagactaattgcttttctgtgcgcccgtag

[0084] agttcctcaccatgatggcccgcaagatgaaggacaccgactcagaggaggagatccgggaggcgttcaaggtgttcgaccgtgacaacaacggctttatctc

[0085] cgccgctgagctccgccacgtcatgccccttccatcgg

[0086] Phylogenetic methods were used to identify strain 2A1. BLAST analysis of the ITS gene sequence preliminarily identified strain 2A1 as a *Penicillium* sp. Sequencing results of the BenA and CaM genes were then compared. Sequences from different strains with high homology were combined with fungal sequences and constructed using MEGA 11 neighbor-joining to form a multi-gene phylogenetic tree. Ultimately, strain 2A1 and *Penicillium fructuariae-cellae* clustered in the same branch. The results are as follows: Figure 2 and Figure 3 As shown.

[0087] Based on morphological and gene sequence characteristics, strain 2A1 was ultimately identified as Penicillium fructuariae-cellae.

[0088] (3) Preservation

[0089] Strain 2A1 was deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China, with accession number CGMCC NO.41539.

[0090] Example 2

[0091] In this embodiment, the broad-spectrum antibacterial activity of strain 2A1 was determined by plate confrontation method.

[0092] The specific details of this embodiment are as follows:

[0093] Strains 2A1 and pathogenic bacteria discs were inoculated at a distance of 5 cm on both sides of the PDA medium plate and cultured at 25℃ for 3 days. The control group (CK group) was the one inoculated with pathogenic bacteria discs alone.

[0094] Inhibition rate (%) = (diameter of control pathogen - diameter of treated pathogen) / diameter of control pathogen × 100.

[0095] The pathogens used in this embodiment include: Fusarium pseudograminearum, Fusarium graminearum, Rhizoctonia cerealis, Verticillium dahliae, and Magnaphorthe oryzae.

[0096] The pathogens mentioned above were provided by the Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences. Among them, Fusarium graminearum was designated PH-1, F. pseudograminearum was designated CF14047, and Rhizoctonia cerealis was designated R0301.

[0097] The results are shown in Table 1 and Figure 4 As shown.

[0098] Table 1. Inhibitory effect of strain 2A1 against different pathogens (%)

[0099]

[0100] The results showed that strain 2A1 exhibited varying degrees of inhibitory effects on the growth of the five pathogens. Among Fusarium species, strain 2A1 showed the best inhibitory effect against *F. pseudograminearum*, with an inhibition rate of 41.96%, followed by *R. cerealis* with an inhibition rate of 39.98%, and *V. dahliae* and *M. oryzae* with inhibition rates of 54.23% and 50.70%, respectively. Except for *F. graminearum*, strain 2A1 showed inhibition rates higher than 39% against all other pathogens.

[0101] Example 3

[0102] This embodiment examines the inhibitory effect of the fermentation broth of strain 2A1 on the growth of three pathogens.

[0103] The specific details of this embodiment are as follows:

[0104] Strain 2A1 was cultured on PDA agar plates. Five 5mm incubator discs were then placed in 100mL PDB liquid medium and incubated at 25℃ and 200rpm for 7 days. The culture was then filtered through three layers of sterile filter cloth and centrifuged at 5000rpm for 8 minutes at 25℃. The supernatant was passed through a 0.22μm bacterial filter to remove spores. The resulting fermentation broth was stored at 4℃ for later use. Note: The PDA medium formula is as follows: 200g potato, 15g agar powder, 20g glucose, and ddH2O to a final volume of 1L. The PDB liquid medium formula is as follows: 200g potato, 20g glucose, and ddH2O to a final volume of 1L.

[0105] The fermentation broth of strain 2A1 was mixed with cooled, autoclaved PDA medium to obtain mixed media with volume ratios of 25%, 50%, and 75% (v / v). 15 mL of each mixed medium was then poured onto 9 cm Petri dishes. After the medium cooled and solidified, *Fusarium graminearum* CF14047, *Fusarium graminearum* PH-1, and *Rhizoctonia graminearum* R0301 were inoculated into the center of each plate, with three replicates for each concentration. PDA medium without the mixed fermentation broth served as a blank control. After culturing at 25°C in the dark for 5 days, the colony diameter was measured using a cross-hatching method, and the inhibition rate was calculated. The results are shown in Table 2. Figure 5 As shown.

[0106] Table 2. Inhibitory effect of fermentation broth of strain 2A1 on pathogen growth (%)

[0107]

[0108] The results showed that fermentation broths of strain 2A1 at different concentration gradients inhibited the growth of Fusarium pseudograss CF14047, Fusarium grass PH-1 and Rhizoctonia grass R0301. The inhibitory effect on pathogens was enhanced with increasing fermentation broth concentration.

[0109] The fermentation broth of strain 2A1 at a concentration of 50% showed significant antibacterial effects against *Fusarium graminearum* CF14047 and *Rhizoctonia graminearum* R0301, with an inhibition rate exceeding 70%, almost completely inhibiting the growth of pathogenic mycelia. When the concentration was increased to 75%, the fermentation broth of strain 2A1 completely inhibited the growth of pathogenic mycelia. At a concentration of 75%, the fermentation broth of strain 2A1 significantly inhibited *Fusarium graminearum* PH-1, with an inhibition rate exceeding 50%. The inhibitory effect of fermentation broth 2A1 on *Fusarium graminearum* and *Rhizoctonia graminearum* was superior to that on *Fusarium graminearum*.

[0110] Example 4

[0111] This embodiment examines the inhibitory effect of the fermentation broth of strain 2A1 on the germination of Fusarium pseudograss spores.

[0112] The specific details of this embodiment are as follows:

[0113] Fusarium graminearum CF14047 was cultured on PDA medium at 25℃ for 3 days. Mycelia were scraped into 100 mL of mung bean soup medium and incubated at 25℃ with shaking at 175 rpm for 3 days. The spores were filtered through two layers of sterile filter cloth and centrifuged (5000 rpm, 8 min). The supernatant was removed, diluted with sterile water, and the spore concentration was calculated using a hemocytometer and adjusted to 5 × 10⁻⁶. 6 per mL.

[0114] 5 mL of strain 2A1 fermentation broth (obtained according to the method in Example 3) and 5 mL of Fusarium graminearum CF14047 spore solution (5 × 10⁻⁶) were mixed. 6 Spores / mL were mixed at a 1:1 (v / v) ratio and placed in 50 mL sterile tubes. PDB liquid medium and YEPD liquid medium were used as controls. All tubes were incubated in the dark at 25°C with shaking (180 rpm), and spore germination rate was measured at 7 and 10 hours after incubation. The germination of 40 conidia was evaluated. The conidia germination inhibition rate was calculated using the formula: I(%) = [(Nc-Nt) / Nc] × 100%, where Nc is the number of germinating spores in the control group and Nt is the number of germinating spores in the treatment group.

[0115] The results are shown in Table 3 and Figure 6 As shown.

[0116] Table 3. Inhibitory effect of fermentation broth of strain 2A1 on spore germination of CF14047 (%)

[0117]

[0118] The results showed that, compared with the control group, the fermentation broth of strain 2A1 significantly inhibited the germination of Fusarium graminearum CF14047 spores. After 7 hours of treatment, the germination of spores was 100% inhibited, and after 10 hours of treatment, the inhibition rate was as high as 95.28%, indicating that the fermentation broth of strain 2A1 has a good inhibitory effect on the germination of Fusarium graminearum CF14047 spores.

[0119] Example 5

[0120] This embodiment tests the inhibitory effect of the fermentation broth of strain 2A1 on stem rot fungus in wheat coleoptiles.

[0121] The specific details of this embodiment are as follows:

[0122] Soak Huaimai 33 seeds for 2 hours, then rinse three times with sterile water. Place three sheets of sterile filter paper at the bottom of a petri dish and moisten them. Place 11 wheat seeds in each dish and cover with soil. Incubate at 25℃ for 12 hours under light and 12 hours in darkness. Once the wheat coleoptiles have grown to 3 cm, make a small incision at the top of the coleoptile and drip 2 μL of Fusarium graminearum CF14047 spore solution (spore solution concentration 5 × 10⁻⁶). 6 Spores / mL (spore solution obtained according to the method in Example 3), 2 μL of sterile water was added to the blank control. On the second day, a sterile cotton ball was used to wrap around the coleoptile, and 150 μL of fermentation broth of strain 2A1 (fermentation broth obtained according to the method in Example 3) was added to the cotton ball. The control was not wrapped with a cotton ball. After 6 days of growth, the height and fresh weight of the wheat seedlings were measured, and the length of the lesions was also measured. The results are shown in Table 4 and... Figure 7 As shown.

[0123] Table 4. Effects of fermentation broth of strain 2A1 on the growth of stem rot pathogen on coleoptiles (cm)

[0124]

[0125] The results showed that, compared with the control group (CK), the length of wheat lesions treated with fermentation broth was significantly different, and the length of lesions was significantly shorter than that of the control group, indicating that the fermentation broth of strain 2A1 significantly reduced the infection of wheat plants by the pathogen Fusarium pseudograss CF14047.

[0126] Example 6

[0127] This example is a pot experiment on the control efficacy of strain 2A1 fermentation broth against Fusarium oxysporum CF14047.

[0128] The specific details of this embodiment are as follows:

[0129] (1) Preparation of diseased rice grains

[0130] Fusarium graminearum CF14047 was activated on PDA medium. Mycelial cakes were collected from the edge of the colony and inoculated into mung bean soup. The mixture was incubated at 25℃ and 175 rpm for 3 days. The mycelia were filtered through three layers of sterile filter cloth, and the concentration of the conidial solution was adjusted to 5 × 10⁻⁶. 5 Conidia / mL: Inoculate 10mL of spore solution per 50g of millet and incubate in the dark at 25℃ for 5-7 days to obtain diseased millet grains. Sterilize the seedling substrate (purchased from Jiangsu Xingnong Substrate Technology Co., Ltd.) in a 121℃ oven for 6 hours to obtain sterile substrate. Mix the diseased millet grains and sterile substrate evenly at a mass ratio of 0.5% to obtain the inoculum-containing substrate for later use.

[0131] (2) Inhibitory effect of fermentation broth of strain 2A1 on wheat stem base rot

[0132] Disinfected Huaimai 33 seeds were placed in petri dishes lined with moistened filter paper and germinated at 26℃ under alternating light and dark conditions for 12h / 12h until the seeds showed signs of germination. The germinated seeds were then planted in a microbial substrate. A blank control was set up, with one treatment sown in sterile substrate as a negative control and the remaining treatments sown in microbial substrate as positive controls. Each pot contained 16 wheat seeds, with 3 pots per treatment. The plants were cultured at 26℃ under 12h light and 12h darkness conditions. When the wheat reached approximately 3cm in height, the 2A1 group was drenched with 20mL / pot of fermentation broth from strain 2A1 (obtained according to the method described in Example 3), the blank control group was drenched with PDB liquid medium, and the drug control group was drenched with fludioxonil suspension (Zhengzhou Leading Chemical Co., Ltd.). After 30 days of growth, the occurrence of wheat stem rot and the growth of the wheat were investigated. The results are shown in Table 5. Figure 8 , Figure 9 As shown.

[0133] Table 5. Effects of fermentation broth from strain 2A1 on wheat growth (cm)

[0134]

[0135] The results showed that, compared with the positive control, the incidence of wheat stem rot was reduced to varying degrees in both the fludioxonil group and the 2A1 group. The length of lesions on the roots of both the fludioxonil group and the 2A1 group was shorter than that of the positive control, and the incidence of wheat disease in the fludioxonil group was lower than that in the 2A1 group. The plant height and fresh weight of wheat in the 2A1 group were higher than those in the CK group, but slightly lower than those in the fludioxonil group.

[0136] In addition to the embodiments described above, the present invention may have other implementations. All technical solutions formed by equivalent substitution or equivalent transformation fall within the protection scope claimed by the present invention.

Claims

1. A biocontrol strain, Penicillium fructuariae-cellaei 2A1, deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC NO. 41539.

2. The use of the biocontrol strain of claim 1 in preparing a biocontrol agent for inhibiting Fusarium graminearum, Rhizoctonia graminearum, Verticillium dahliae, and rice blast fungus.

3. The use of the biocontrol strain of claim 1 in preparing a biocontrol agent for controlling wheat stem base rot, wheat sheath blight, cotton verticillium wilt, and rice blast.

4. A biocontrol agent containing the biocontrol strain of claim 1.

5. The use of the biocontrol agent according to claim 4 for the prevention and control of wheat stem base rot, wheat sheath blight, cotton verticillium wilt, and rice blast.

Citation Information

Patent Citations

  • Cotton endophytic fungus CEF-818 and application thereof in control of cotton verticillium wilt

    CN103627643A

  • Penicillium griseofulvum for preventing and treating fungal disease and application thereof

    CN105385606A

  • Penicillium vinaceum strain, biocontrol agent and application

    CN113444648A

  • Penicillium janthinillum strain, biocontrol agent and application

    CN113502228A

  • Penicillium oxalicum strain, biocontrol agent and application thereof

    CN116024099A