Lipase mutants and their use in the preparation of (s)-3-cyclohexen-1-carboxylic acid

Abstract

This invention belongs to the fields of biopharmaceuticals and biotransformation, specifically relating to a lipase mutant and its application in the preparation of (S)-3-cyclohexene-1-carboxylic acid. The CALB lipase mutant of this invention is obtained by single-point or combined mutations at positions 40, 134, 154, 189, 278, and 281 of the amino acid sequence shown in SEQ ID NO. 1. Compared to the wild type, this mutant exhibits significantly improved stereoselectivity in the catalytic reaction of racemic methyl 3-cyclohexene-1-carboxylate to produce (S)-3-cyclohexene-1-carboxylic acid. Compared to traditional chemical methods for preparing (S)-3-cyclohexene-1-carboxylic acid, the CALB lipase mutant provided by this invention offers high stereoselectivity, mild reaction conditions, environmental friendliness, and reduced equipment requirements, significantly lowering production costs and demonstrating broad application prospects in industrial applications.

Description

[0001] This invention is a divisional application of Chinese Patent Application No. 202510027385.9, filed on January 8, 2025, whose original invention was entitled "A lipase mutant and its application". Technical Field

[0002] This invention belongs to the fields of biopharmaceuticals and biotransformation, specifically relating to lipase mutants and their application in the preparation of (S)-3-cyclohexene-1-carboxylic acid. Background Technology

[0003] Lipases possess excellent catalytic activity in reactions such as hydrolysis, transesterification, esterification, and transesterification, and are widely used in the food, chemical, pharmaceutical, and bioenergy industries. Microbial lipases have become the main source of lipases for industrial applications. Antarctic Candida lipase B (CALB) is derived from Candida antarctica. Due to its outstanding catalytic activity in ester synthesis, hydrolysis, and transesterification, CALB is widely used in the food, pharmaceutical, and chemical industries.

[0004] (S)-3-cyclohexene-1-carboxylic acid, as a chiral compound, is an important chemical reagent and pharmaceutical intermediate, widely used in pharmaceuticals, chemicals, and other fields. (S)-3-cyclohexene-1-carboxylic acid can be used to generate (S)-3,4-diaminocyclohexanecarboxylic acid, a key chiral building block for the coagulation factor Xa (fXa) inhibitor edoxaban (trade name: Savaysa). This drug is used to treat cancer-related venous thromboembolism and, compared with similar coagulation factor Xa inhibitors such as rivaroxaban and apixaban, has significant advantages such as lower renal burden, lower bleeding risk, and greater safety and reliability, showing broad market prospects. As a key intermediate for this drug, the efficient preparation technology of (S)-3-cyclohexene-1-carboxylic acid has become a research hotspot.

[0005] Currently, there are three main methods for synthesizing chiral 3-cyclohexene-1-carboxylic acid: the Diels-Alder reaction, the chemical racemic acid resolution method, and the enzymatic asymmetric hydrolysis resolution of methyl 3-cyclohexene-1-carboxylate. The Diels-Alder reaction is currently the primary method for synthesizing chiral 3-cyclohexene-1-carboxylic acid; however, butadiene is a gas in this reaction, the product is difficult to separate, the reaction involves many steps, and the final yield is low, requiring further improvement. The chemical racemic acid resolution method requires at least six recrystallization processes in acetone. This chemical resolution method not only consumes a large amount of acetone, but also yields only 20-30% after resolution, resulting in low economic efficiency. Therefore, the chemical synthesis of chiral 3-cyclohexene-1-carboxylic acid suffers from problems such as numerous operational steps, low yield, and large consumption of acetone. The use of bio-enzyme catalysis to resolve chiral compounds has advantages such as mild reaction conditions, high stereoselectivity, low pollution, and simple operation, making it an important alternative or supplement to traditional chemical synthesis routes in the process of promoting sustainable development.

[0006] In 2004, Cihangir T et al. studied three enzymes—porcine liver esterase (PLE), horse liver esterase (HLE), and porcine pancreatic lipase (PPL)—that hydrolyze racemic methyl 3-cyclohexene-1-carboxylate. The results showed that the hydrolysis products of PLE and HLE were both (S)-3-cyclohexene-1-carboxylic acid, with ee values ​​exceeding 99% and reaching 97%, respectively; while the hydrolysis product of PPL was (R)-3-cyclohexene-1-carboxylic acid, with an ee value of 91%. However, all three enzymes are derived from animals, and their practical application as commercial enzymes faces multiple challenges, including high cost, interference from isoenzymes, significant batch-to-batch variability, and the potential risk of viral contamination.

[0007] In 2019, Dou Zhe et al. used methyl 3-cyclohexene-1-carboxylate as a substrate to screen wild-type strains and successfully discovered a strain named Acinetobacter sp. JNU9335. This strain can selectively catalyze the hydrolysis of the substrate, and the remaining (S)-3-cyclohexene-1-carboxylate, through further hydrolysis under alkaline conditions, yielded the target product (S)-3-cyclohexene-1-carboxylic acid. Adding 3.50 g of racemic methyl 3-cyclohexene-1-carboxylate to 50 mL of the reaction mixture and reacting for 12 h yielded the target product with a yield of 40% and an ee value as high as 99%. In 2020, Dou Zhe et al. successfully obtained the cyclohexene carboxyl ester hydrolase AcEst1 and its mutant. Using crude enzyme powder of the enhanced mutant F78V / A202K / G326A, it was able to catalyze 58.7 g of racemic 3-cyclohexene-1-carboxylic acid methyl ester. The remaining (S)-3-cyclohexene-1-carboxylic acid methyl ester was then subjected to alkaline hydrolysis to obtain 22.3 g of (S)-3-cyclohexene-1-carboxylic acid, achieving a yield of 38%. The product had a gas chromatography (GC) purity of 99% and an optical purity of 99.5% ee. Subsequently, in 2021, Dou Zhe et al. disclosed a novel carboxylesterase CarEst3 and its mutant. This enzyme exhibits excellent catalytic activity, capable of processing up to 500 g / L of racemic 3-cyclohexene-1-carboxylic acid methyl ester, ultimately yielding (S)-3-cyclohexene-1-carboxylic acid with a total yield of 37% and an optical purity of 99% ee.

[0008] Compared with traditional chemical synthesis methods, the method for preparing (S)-3-cyclohexen-1-carboxylic acid using bio-enzyme catalysis has advantages such as mild reaction conditions, high enantioselectivity, environmental friendliness, and simple operation. However, current methods for preparing (S)-3-cyclohexen-1-carboxylic acid are limited to laboratory scale and suffer from drawbacks such as low enzyme selectivity leading to low product yield, making them unsuitable for industrial production. Furthermore, there is a lack of reports on the synthesis of (S)-3-cyclohexen-1-carboxylic acid catalyzed by the lipase CALB. Therefore, it is necessary to screen for mutants of the lipase CALB with high catalytic efficiency and complementary enantioselectivity to meet the needs of industrial production of (S)-3-cyclohexen-1-carboxylic acid. Summary of the Invention

[0009] This invention aims to overcome the shortcomings of existing technologies in the preparation of (S)-3-cyclohexene-1-carboxylic acid using bio-enzyme catalysis, which suffers from low enzyme selectivity leading to low product yield, low catalytic efficiency, and difficulty in industrial production. The invention provides a lipase mutant, a mutant encoding gene, a recombinant vector containing the mutant encoding gene, and a recombinant genetically engineered bacterium containing the mutant encoding gene. Furthermore, the invention applies the lipase mutant to the industrial production process for (S)-3-cyclohexene-1-carboxylic acid.

[0010] To achieve the above-mentioned objectives, the present invention is implemented through the following technical solution:

[0011] A CALB lipase mutant derived from an amino acid sequence as shown in SEQ ID NO.1 by site-directed mutation, wherein the mutation site is one or more of the following: (1) position 40, (2) position 134, (3) position 154, (4) position 189, (5) position 278, (6) position 281.

[0012] Preferably, the lipase CALB mutant is derived from the amino acid sequence shown in SEQ ID NO.1 by site-directed mutation, wherein the mutation site is one or two of the following: (2) position 134, (6) position 281.

[0013] Preferably, the mutant is obtained by mutating one or more of the following sites of the amino acid sequence shown in SEQ ID NO.1: (1) threonine at position 40 is mutated to lysine, (2) aspartic acid at position 134 is mutated to serine, (3) valine at position 154 is mutated to isoleucine, (4) isoleucine at position 189 is mutated to arginine, (5) lysine at position 278 is mutated to aspartic acid, and (6) alanine at position 281 is mutated to glutamine.

[0014] A nucleic acid molecule containing the coding sequence of a lipase CALB mutant as described above.

[0015] A recombinant vector containing the coding sequence described above.

[0016] A recombinant genetically engineered bacterium, wherein the recombinant genetically engineered bacterium contains the recombinant vector as described above.

[0017] Preferably, the recombinant genetically engineered bacteria uses Escherichia coli as the expression host.

[0018] This invention provides a coding gene for a recombinant lipase CALB mutant, a recombinant vector containing the coding gene, and a recombinant genetically engineered bacterium constructed from the recombinant vector. The expression vector is pET28b(+), and the host of the recombinant genetically engineered bacterium is E. coli BL21(DE3).

[0019] The recombinant lipase CALB mutant of this invention is produced by mutating multiple specific amino acid sites of the wild-type lipase CALB, with the aim of enhancing its enantiomeric resolution ability of racemic 3-cyclohexene-1-carboxylic acid methyl ester. First, the encoding gene of wild-type Candida antarcticis lipase B (its sequence is shown in SEQ ID NO.2) is ligated to the expression vector pET28b(+) plasmid to construct a recombinant expression plasmid. Then, the successfully constructed recombinant expression plasmid is transformed into E. coli BL21(DE3). Using the recombinant expression plasmid containing the lipase CALB encoding gene as a template, gene modification is performed using site-directed mutagenesis. The successfully constructed recombinant plasmid is then transformed into E. coli BL21(DE3) to obtain a recombinant genetically engineered bacterium containing the encoding gene of the recombinant lipase CALB mutant. The obtained recombinant genetically engineered bacterium is fermented and induced to express the lipase. The fermentation broth is centrifuged to obtain wet bacterial cells containing the recombinant lipase CALB mutant. The wet bacterial weight was suspended in phosphate buffer solution and sonicated under ice bath conditions. The supernatant was collected by low-temperature centrifugation to obtain the crude enzyme solution of the CALB mutant lipase. The stereoselectivity of the mutant CALB lipase was compared with that of the wild-type CALB lipase to screen for mutants with excellent resolving performance.

[0020] The application of the CALB lipase mutant as described above in the preparation of (S)-3-cyclohexene-1-carboxylic acid.

[0021] As a preferred embodiment, the application involves mixing a phosphate buffer solution, methyl 3-cyclohexene-1-carboxylate, and wet bacterial cells obtained by fermentation culture of recombinant genetically engineered bacteria containing the CALB mutant lipase gene, or crude enzyme solution extracted after ultrasonic disruption of wet bacterial cells, and then performing a catalytic reaction to obtain (S)-3-cyclohexene-1-carboxylic acid.

[0022] Compared to traditional chemical methods for preparing (S)-3-cyclohexene-1-carboxylic acid, the CALB lipase mutant provided by this invention exhibits high stereoselectivity, mild reaction conditions, environmental friendliness, and lower equipment requirements, significantly reducing production costs and demonstrating broad application prospects in industrial production. The CALB lipase provided by this invention possesses high catalytic activity, resulting in mild reaction conditions, high substrate conversion, high enantioselectivity, reduced production costs, and environmental friendliness. This invention enhances the catalytic activity and stereoselectivity of CALB lipase for racemic 3-cyclohexene-1-carboxylic acid methyl ester by designing mutations at multiple different amino acid sites. This invention offers advantages such as mild reaction conditions, high substrate concentration, high stereoselectivity, simple catalyst treatment steps, and environmental friendliness. For example, at 10°C, 40 g / L of the CALB lipase mutant can catalyze 70 g / L of racemic 3-cyclohexene-1-carboxylic acid methyl ester within 6 hours, achieving a conversion rate of 52%.p The value is 72%.

[0023] Preferably, the reaction temperature of the catalytic reaction is 0–40°C and the reaction time is 2–12 h.

[0024] As a further preferred option, the reaction temperature of the catalytic reaction is 10°C and the reaction time is 6 hours.

[0025] Preferably, the phosphate buffer solution contains phosphate at a concentration of 50–200 mM.

[0026] As a further preferred option, the phosphate buffer solution contains phosphate at a concentration of 200 mM.

[0027] Preferably, the phosphate buffer solution includes disodium hydrogen phosphate and sodium dihydrogen phosphate.

[0028] Preferably, the pH of the phosphate buffer solution is 6 to 9.

[0029] As a further preferred option, the pH of the phosphate buffer solution is 7.

[0030] Preferably, the concentration of methyl 3-cyclohexene-1-carboxylate is 20–140 g / L.

[0031] As a further preferred option, the concentration of methyl 3-cyclohexene-1-carboxylate is 70 g / L.

[0032] Preferably, the concentration of the recombinant genetically engineered bacteria containing the CALB mutant lipase-encoding gene added to the catalytic reaction, obtained by fermentation culture, is 10–100 g / L.

[0033] As a further preferred option, the concentration of the recombinant genetically engineered bacteria containing the CALB mutant lipase-encoding gene added to the catalytic reaction, obtained by fermentation culture, is 40 g / L.

[0034] Preferably, the method for extracting (S)-3-cyclohexene-1-carboxylic acid from the enzyme-catalyzed reaction solution using an organic reagent includes the following steps:

[0035] After the enzyme-catalyzed reaction was completed, an equal volume of 3M HCl was added to terminate the reaction. Then, twice the volume of ethyl acetate was added for extraction. The extraction was repeated three times. The extracted organic phases were combined, dried with anhydrous sodium sulfate to remove excess water, filtered, and then rotary evaporated to obtain (S)-3-cyclohexene-1-carboxylic acid.

[0036] Preferably, the method for preparing the wet bacterial cells includes the following steps:

[0037] Engineered bacteria containing the CALB mutant gene encoding recombinant lipase were inoculated into LB liquid medium containing a final concentration of 50 μg / mL ampicillin resistance and cultured at 37°C and 180 rpm for 10–12 h. Then, 2% (v / v) of the culture was inoculated into LB liquid medium containing a final concentration of 50 μg / mL ampicillin resistance and cultured at 37°C and 180 rpm until the bacterial OD600 reached 0.6–0.8. IPTG was added to a final concentration of 1 mM and the culture was induced at 28°C and 180 rpm for 12 h. After centrifugation at 4°C and 8000 rpm for 10 min, the supernatant was discarded and the precipitate was collected to obtain the wet bacterial cells of recombinant engineered bacteria containing the CALB mutant gene encoding recombinant lipase.

[0038] Preferably, the method for preparing the crude enzyme solution includes the following steps:

[0039] Engineered bacteria containing the CALB mutant gene encoding recombinant lipase were fermented to obtain wet cells, which were then resuspended in 9.6 mL of 200 mM sodium phosphate buffer (pH 7.0) for every 0.4 g of wet cells. The cell resuspension was ultrasonically disrupted in an ice bath at 60 W for 2 seconds followed by a 4-second interval, for a total of 10 min to obtain cell lysate. The cell lysate obtained after ultrasonic disruption was centrifuged at 8000 rpm and 4 °C for 10 min, and the supernatant obtained was the crude enzyme solution.

[0040] Therefore, the present invention has the following beneficial effects:

[0041] (1) This invention improves the catalytic activity and stereoselectivity of lipase CALB to racemic 3-cyclohexene-1-carboxylic acid methyl ester by designing mutations at multiple different sites of amino acids.

[0042] (2) The present invention has the advantages of mild reaction conditions, high substrate concentration, high stereoselectivity, simple catalyst treatment steps, and environmental friendliness. It also reduces equipment requirements and greatly reduces production costs, showing broad application prospects in industrial applications.

[0043] (3) Compared with the traditional chemical method for preparing (S)-3-cyclohexene-1-carboxylic acid, the lipase CALB mutant provided by this invention has high stereoselectivity and high conversion rate. At 10℃, 40 g / L of the lipase CALB mutant can catalyze 70 g / L of racemic 3-cyclohexene-1-carboxylic acid methyl ester within 6 h, with a maximum conversion rate of 52%. p The value can reach as high as 72%. Attached Figure Description

[0044] Figure 1 This is an SDS-PAGE image of CALB lipase.

[0045] Figure 2 A schematic diagram of the enzymatic resolution of racemic 3-cyclohexene-1-carboxylic acid methyl ester.

[0046] Figure 3 This is a schematic diagram of the high-performance gas chromatography (GC) detection of S / R-3-cyclohexene-1-carboxylic acid, the product of the recombinant lipase CALB mutant CALB-D134S / A281Q, after 6 h of catalytic reaction.

[0047] Figure 4 This is a schematic diagram showing the conversion rates of wild-type lipase CALB and recombinant lipase CALB mutants.

[0048] Figure 5 This is a schematic diagram showing the eep values ​​of wild-type lipase CALB and recombinant lipase CALB mutants. Detailed Implementation

[0049] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0050] Example 1: Construction of the CALB lipase-producing genetically engineered strain E. coli BL21(DE3) / CALB. The CALB lipase gene sequence (amino acid sequence as shown in SEQ ID NO. 1, nucleotide sequence as shown in SEQ ID NO. 2) from the gene library derived from Candida antarctica was synthesized as a whole gene and transformed into the vector pET28b(+) plasmid to obtain the pET28b(+)-CALB recombinant plasmid. This recombinant plasmid was then transformed into E. coli BL21(DE3) to obtain the wild-type CALB lipase-producing genetically engineered strain E. coli BL21(DE3) / CALB. The corresponding lipase is designated as wild-type CALB lipase.

[0051] Example 2: Construction of recombinant esterase mutant genetically engineered E. coli BL21(DE3) / CALB-muts by site-directed mutagenesis. Primers were synthesized according to the mutation site. Using the pET28b(+)-CALB recombinant plasmid containing the gene encoding Candida antarcticis lipase B as a template, site-directed mutagenesis was performed by PCR extension amplification (see Table 1 for site-directed mutagenesis primers).

[0052] Table 1: Nucleic acid sequences of primers

[0053] Primer name Sequence (5'-3') T40K-R ATTTTACTGGTTCCAGGAAAGGGTACTACTGGA T40K-L TCCTGGAACCAGTAAAATAGGTTTACTAACGGA D134S-R CTTATGGCCTTTGCTCCTTCTTACAAAGGTACCG D134S-L AGGAGCAAAGGCCATAAGTCTGTCGACCTTTGA V154I-R GCAGTGTCCGCTCCTTCCAGGTGGCAACAAACC V154I-L GGAAGGAGCGGACACTGCCAAGGCGTCAAGTGG I189R-R TACTCAGCTACAGACGAAAGGGTTCAGCCTCAA I189R-L TTCGTCTGTAGCTGAGTATAGGTTAGTAGTGGG L278N-R GTCGCTGCCGCAGCCCTGAATGCTCCAGCAGCT L278N-L CAGGGCTGCGGCAGCGACCTTTTGTTCAGGGGT A281Q-R GCAGCCCTGCTGGCTCCACCAGCTGCCGCTATC A281Q-L TGGAGCCAGCAGGGCTGCGGCAGCGACCTTTTG

[0054] The PCR reaction procedure was as follows: 95℃ for 5 min; 95℃ for 30 s, 60℃ for 30 s, 72℃ for 3 min, repeated for 30 cycles; extension at 72℃ for 10 min. After the PCR reaction, DpnI was added to the product and the mixture was treated at 37℃ for 3 h. After treatment, the product was inactivated at 80℃ for 10 min, then chemically transformed into E. coli BL21(DE3) competent cells and plated on LB agar plates containing a final concentration of 50 mg / L ampicillin resistance. The cells were then incubated at 37℃ for 12 h. Single colonies were randomly selected for sequencing analysis, yielding recombinant E. coli BL21(DE3) / CALB-muts containing the recombinant lipase CALB mutant gene, namely E. coliBL21(DE3) / CALB-T40K, E. coli BL21(DE3) / CALB-D134S, E. coli BL21(DE3) / CALB-V154I, E. coli BL21(DE3) / CALB-I189R, E. coli BL21(DE3) / CALB-L278N, E. coli BL21(DE3) / CALB-A281Q, and E. coli BL21(DE3) / CALB-D134S / A281Q. The corresponding CALB lipase mutants are denoted as mutants CALB-T40K, CALB-D134S, CALB-V154I, CALB-I189R, CALB-L278N, CALB-A281Q, and CALB-D134S / A281Q, respectively.

[0055] Example 3: Preparation of wet cells of recombinant lipase CALB mutant genetically engineered bacteria. Recombinant *E. coli* BL21(DE3) / CALB-muts containing the recombinant lipase CALB mutant gene obtained in Example 2 were inoculated into 10 mL LB test tubes containing ampicillin resistance at a final concentration of 50 μg / mL. The culture was carried out at 37°C and 180 rpm for 10–12 h. Then, 2% (v / v) inoculum was added to 100 mL LB shake flasks containing ampicillin resistance at a final concentration of 50 μg / mL. The culture was carried out at 37°C and 180 rpm until the bacterial OD600 reached 0.6–0.8. IPTG was added to a final concentration of 1 mM, and the culture was carried out at 28°C for 12 h. The culture was then centrifuged at 4°C and 8000 rpm for 10 min. The supernatant was discarded, and the precipitate was collected to obtain wet cells of recombinant *E. coli* expressing the recombinant lipase CALB mutant gene. These wet cells can be used directly as a biocatalyst or for preparing crude enzyme solutions. Recombinant E. coli BL21(DE3) / CALB wet cells containing the recombinant lipase CALB gene were prepared using the same method.

[0056] Example 4: Preparation of crude enzyme solution of recombinant esterase and its mutants

[0057] Preparation of crude recombinant lipase CALB enzyme solution: The wet bacterial cells collected according to the method in Example 3 were resuspended in 9.6 mL of 200 mM sodium phosphate buffer (pH 7.0) per 0.4 g of wet bacterial cells. The cells were then sonicated under ice bath conditions (60 W power, 2 s duration, 4 s interval, continuous sonication for 10 min) to obtain cell lysate. The cell lysate obtained after sonication was centrifuged at 8000 rpm, 4 °C for 10 min. The supernatant obtained was the desired crude recombinant lipase CALB enzyme solution. The SDS-PAGE images of the cell lysate supernatant and precipitate of E. coli BL21(DE3) / CALB (i.e., the SDS-PAGE image of lipase CALB) are shown below. Figure 1 As shown. Among them, Figure 1 Lane 1 (from left to right) is the protein molecular weight marker; lane 2 is the crude enzyme sample of the original strain's lipase CALB; and lane 3 is the broken-up precipitate sample of the original strain's lipase CALB. Figure 1 The recombinant lipase CALB was found to exist in a soluble form.

[0058] Example 5: Determination of the stereoselectivity of lipase in CALB

[0059] The wet cells of wild-type lipase CALB and recombinant lipase CALB mutants CALB-T40K, CALB-D134S, CALB-V154I, CALB-I189R, CALB-L278N, CALB-A281Q, and CALB-D134S / A281Q obtained in Example 3 were used to catalyze racemic methyl 3-cyclohexene-1-carboxylate.

[0060] The enzyme catalytic system and catalytic conditions are as follows: 40 g / L wet bacterial cells were added, followed by 70 g / L racemic 3-cyclohexene-1-carboxylic acid methyl ester. A 10 mL reaction system was prepared using 200 mM sodium phosphate buffer (pH 7.0). The reaction was carried out at 10℃ and 700 rpm for 6 h. After the reaction, 100 μL of the reaction solution was taken, and an equal volume of 100 μL of 3M HCl was added to terminate the reaction. The mixture was extracted three times with ethyl acetate, with a total of 800 μL of ethyl acetate added. The mixture was centrifuged at 12000 rpm for 1 min to separate the aqueous and organic phases. The organic phase was collected, and a certain amount of anhydrous sodium sulfate was added to dry it to remove water. After centrifugation at 12000 rpm for 1 min, 200 μL of the supernatant was collected. A schematic diagram of the enzymatic resolution of racemic 3-cyclohexene-1-carboxylic acid methyl ester is shown below. Figure 2 As shown.

[0061] The supernatant contained methyl (S)-3-cyclohexene-1-carboxylate, methyl (R)-3-cyclohexene-1-carboxylate, (S)-3-cyclohexene-1-carboxylic acid, and (R)-3-cyclohexene-1-carboxylic acid. High-performance gas chromatography (GC) was used to detect the content of the substrates (methyl (S)-3-cyclohexene-1-carboxylate and methyl (R)-3-cyclohexene-1-carboxylate) and products ((S)-3-cyclohexene-1-carboxylic acid and (R)-3-cyclohexene-1-carboxylic acid), and the conversion rate and ee were calculated. p Value. The schematic diagram of high-performance gas chromatography (GC) detection of S / R-3-cyclohexene-1-carboxylic acid, the product of the recombinant lipase CALB mutant CALB-D134S / A281Q, after 6 h of catalytic reaction is shown in Figure [image missing]. Figure 3 As shown in the diagram. A schematic diagram illustrating the conversion rates of wild-type lipase CALB and recombinant lipase CALB mutants is shown below. Figure 4 As shown. Wild-type lipase CALB and recombinant lipase CALB mutant ee p Value diagram as shown Figure 5 As shown.

[0062] ee p The formula for calculating the value is as follows:

[0063] ee p / % = (Sp-Rp) / (Sp+Rp), where Sp represents the content of (S)-3-cyclohexene-1-carboxylic acid and Rp represents the content of (R)-3-cyclohexene-1-carboxylic acid.

[0064] The GC detection method was as follows: Trace1610 gas chromatograph (Thermo Fisher Scientific Trace1610); chiral gas column: B-DM (0.25mm×30m×0.12mm), injection port temperature: 250℃; FID detector temperature: 250℃; air flow rate: 350mL / min, make-up gas flow rate: 40mL / min; constant pressure: 137.9kPa; constant flow rate: 1mL / min. Column oven temperature program: initial temperature 50℃, hold for 2 min, increase to 120℃ at 6℃ / min, hold for 2 min, increase to 144℃ at 2℃ / min, hold for 2 min.

[0065] from Figures 2-5 Analysis showed that compared with wild-type lipase CALB, lipase CALB with single point mutations (T40K, D134S, V154I, I189R, L278N, A281Q) exhibited significantly improved selectivity. Lipase CALB with combined site mutations (D134S / A281Q) showed superior selectivity and transformation rate compared to wild-type, with a transformation rate reaching up to 52%. p The value can reach up to 72%, which shows that the present invention can significantly improve the activity and selectivity of lipase CALB by designing mutations at multiple different sites of amino acids.

[0066] In summary, this invention creatively discovers that by designing mutations at multiple different sites of amino acids, the activity and stereoselectivity of lipase CALB catalyzing racemic 3-cyclohexene-1-carboxylic acid methyl ester can be improved, which is more conducive to the production of (S)-3-cyclohexene-1-carboxylic acid, reduces production costs, is environmentally friendly, facilitates large-scale production through microbial fermentation, and is more suitable for commercial and industrial applications.

[0067] The above description is merely a detailed explanation of preferred embodiments and principles of the present invention. For those skilled in the art, there may be changes in specific implementation methods based on the ideas provided by the present invention, and these changes should also be considered within the scope of protection of the present invention.

Claims

1. A method for preparing (S)-3-cyclohexene-1-carboxylic acid using a CALB lipase mutant, characterized in that, The CALB lipase mutant was obtained by mutating leucine at position 278 of the amino acid sequence shown in SEQ ID NO.1 to asparagine. The method is as follows: phosphate buffer solution, methyl 3-cyclohexene-1-carboxylate, and wet bacterial cells obtained by fermentation culture of recombinant genetically engineered bacteria containing the CALB lipase mutant encoding gene, or crude enzyme solution extracted after ultrasonic disruption of wet bacterial cells, are mixed evenly and subjected to a catalytic reaction to obtain (S)-3-cyclohexene-1-carboxylic acid.

2. The method according to claim 1, characterized in that, The reaction temperature for the catalytic reaction is 0~40℃, and the reaction time is 2~12h.

Images