Dengue attenuated strains and uses thereof

Abstract

This invention discloses an attenuated dengue virus strain and its applications, relating to the field of biomedical technology. The attenuated dengue virus strain comprises re-encoded functional domains of the NS2A protein, the NS2B protein, and / or the NS1 protein; the coding sequences of these re-encoded functional domains exhibit reduced codon pair bias compared to the corresponding parental protein domain coding sequences. It can elicit a favorable host protective immune response and possesses excellent genetic stability, facilitating the rapid development of effective dengue vaccines.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to attenuated dengue strains and their applications. Background Technology

[0002] Dengue fever is an acute vector-borne infectious disease caused by dengue virus (DENV), prevalent in over 100 countries and regions in tropical and subtropical regions, putting nearly 3 billion people worldwide at risk of infection. Dengue virus belongs to the Flaviviridae genus and is a single-stranded positive-sense RNA virus with a genome length of approximately 11 kb, consisting of a 5-terminal untranslated region, a 3-terminal untranslated region, and a single open reading frame (ORF). The ORF encodes a viral precursor protein, which is eventually cleaved into three viral structural proteins (C, prM, and E) and seven viral non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5). Based on the antigenicity of the E protein, dengue virus is classified into four serotypes: DENV-1, DENV-2, DENV-3, and DENV-4. Dengue virus infection in humans often induces antibody-dependent enhancement, rendering many vaccines that only induce humoral immunity ineffective, and showing shortcomings in protecting young children and inducing a balanced immune response. Summary of the Invention

[0003] This invention aims to address at least one of the technical problems existing in the prior art. To this end, this invention proposes a dengue attenuated strain that significantly weakens viral pathogenicity while inducing a favorable host protective immune response, thus facilitating the rapid development of an effective dengue vaccine.

[0004] The present invention also provides a method for preparing the above-mentioned dengue attenuated strain.

[0005] The present invention also provides a biomaterial.

[0006] The present invention also provides the application of the above-mentioned dengue attenuated strains or biological materials.

[0007] The present invention also provides a vaccine comprising the above-mentioned dengue attenuated strain.

[0008] According to a first aspect of the present invention, a dengue attenuated strain comprises a recoded functional domain of an NS2A protein, a functional domain of an NS2B protein, and / or a functional domain of an NS1 protein.

[0009] The coding sequences of the recoded functional domains of the NS2A protein, the NS2B protein, and / or the NS1 protein have reduced codon pair bias compared to the coding sequences of the corresponding parental protein domains.

[0010] The furin cleavage site of the prM protein of the dengue attenuated strain contains at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, or at least nine amino acid mutations.

[0011] The attenuated dengue strain according to embodiments of the present invention has at least the following beneficial effects:

[0012] The dengue attenuated strains described in this example exhibit good safety profiles and can be used to prevent dengue virus infection. They elicit a favorable protective immune response in the host and demonstrate excellent genetic stability, which is beneficial for the rapid development of effective dengue vaccines. Selecting appropriate mutations at the furin cleavage site of the prM protein can significantly promote the viral maturation process, facilitating the amplification of the dengue attenuated strains in cell lines. Furthermore, adequate maturation helps reduce the adverse drug reaction (ADE) effect.

[0013] According to some embodiments of the present invention, the dengue attenuated strain includes functional domains of recoded non-structural proteins. The non-structural proteins include NS2A, NS2B, and / or NS1 proteins.

[0014] According to some embodiments of the present invention, the dengue attenuated strain includes at least one of dengue virus type I, dengue virus type II, dengue virus type III, and dengue virus type IV.

[0015] According to some embodiments of the present invention, the dengue attenuated strain is dengue virus type I, and the amino acid sequence of the functional domain of the NS2A protein is positions 1 to 218 of the NS2A protein.

[0016] According to some embodiments of the present invention, the dengue attenuated strain is dengue virus type II, and the amino acid sequence of the functional domain of the NS2A protein is positions 1 to 218 of the NS2A protein.

[0017] According to some embodiments of the present invention, the dengue attenuated strain is dengue virus type II, and the amino acid sequence of the functional domain of the NS2B protein is positions 1 to 130 of the NS2B protein.

[0018] According to some embodiments of the present invention, the dengue attenuated strain is dengue virus type II, and the amino acid sequence of the functional domain of the NS1 protein is positions 1 to 352 of the NS1 protein.

[0019] According to some embodiments of the present invention, the dengue attenuated strain comprises re-encoded NS2A, NS2B and / or NS1 proteins; the coding sequences of the re-encoded NS2A, NS2B and / or NS1 proteins have reduced codon pair bias compared to the coding sequences of the corresponding parental proteins.

[0020] According to some embodiments of the present invention, the reduced codon pair bias is a reduced codon pair bias relative to mammals. These mammals are susceptible to dengue virus.

[0021] According to some embodiments of the present invention, the mammals include, but are not limited to, humans and rats.

[0022] According to some embodiments of the present invention, the codon pair bias (CPB) of the coding sequences of the recoded NS2A, NS2B, and / or NS1 proteins of the dengue attenuated strain is reduced by more than 0.3 compared to the parental protein. The CPB value is calculated with reference to the literature "Virus Attenuation by Genome-Scale Changes in Codon Pair Bias" (Coleman JR, Papamichail D, Skiena S, et al. Virus Attenuation by Genome-Scale Changes in Codon Pair Bias[J]. Science, 2008, 320(5884):p.1784-1787.DOI:10.1126 / science.1155761.). For example, the CPB value can be reduced by 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44 or 0.45.

[0023] According to some embodiments of the present invention, the furin protease cleavage site is the 83rd to 92nd amino acid sequence of the prM protein.

[0024] According to some embodiments of the present invention, at least one, at least two, or at least three of the amino acids at positions 85, 86, and 89 of the prM protein of the dengue attenuated strain are mutated.

[0025] According to some embodiments of the present invention, the prM protein of the dengue attenuated strain has mutations at amino acid positions 85, 86, and 89.

[0026] According to some embodiments of the present invention, the dengue attenuated strain is dengue virus type II, and the prM protein of the dengue attenuated strain has amino acid mutations E85A, H86G, and E89S at position 89.

[0027] According to some embodiments of the present invention, an amino acid mutation exists at position 89 of the prM protein of the dengue attenuated strain.

[0028] According to some embodiments of the present invention, the dengue attenuated strain is dengue virus type I, and the attenuated dengue strain has an amino acid mutation D89K at position 89 of the prM protein.

[0029] According to some embodiments of the present invention, the dengue attenuated strain is dengue virus type II, and the coding sequence of the recoded NS2A protein of the dengue attenuated strain is shown as nucleotide sequence 3478-4131 of SEQ ID NO:2.

[0030] According to some embodiments of the present invention, the dengue attenuated strain is dengue virus type II, and the coding sequence of the recoded NS2B protein of the dengue attenuated strain is shown as nucleotide sequence 4132-4521 of SEQ ID NO:3.

[0031] According to some embodiments of the present invention, the dengue attenuated strain is dengue virus type II, and the coding sequence of the recoded NS1 protein of the dengue attenuated strain is shown as nucleotide sequence 2422-3477 of SEQ ID NO:4.

[0032] According to some embodiments of the present invention, the dengue attenuated strain is dengue virus type I, and the coding sequence of the recoded NS2A protein of the dengue attenuated strain is shown as nucleotide sequence 3476-4129 of SEQ ID NO:6.

[0033] According to some embodiments of the present invention, the dengue attenuated strain further includes C protein, prM protein, E protein, NS3 protein, NS4A protein, NS4B protein, and NS5 protein.

[0034] According to some embodiments of the present invention, the nucleotide sequence of the cDNA corresponding to the genomic RNA of the dengue attenuated strain is shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:6. Therefore, codon pair bias can be reduced without changing the overall codon utilization rate and without significantly altering the local and overall free energy of the RNA.

[0035] The method for preparing the above-mentioned dengue attenuated strain according to a second aspect embodiment of the present invention includes the following steps:

[0036] The attenuated dengue strain was obtained in cells using a vector carrying the genome of the attenuated dengue strain via reverse genetics.

[0037] According to some embodiments of the present invention, the culture temperature of the cells is 34°C to 37°C.

[0038] According to a third aspect of the present invention, a biomaterial is selected from any one of A1) to A6);

[0039] A1) The isolated nucleic acid molecules, including the complete genome nucleic acid sequence of the above-mentioned dengue attenuated strain;

[0040] A2) An expression cassette containing the nucleic acid molecules described in A1);

[0041] A3) A carrier containing the nucleic acid molecule described in A1) or the expression cassette described in A2);

[0042] A4) Recombinant microorganisms containing the nucleic acid molecule described in A1), the expression cassette described in A2), or the vector described in A3);

[0043] A5) Cells containing the nucleic acid molecule described in A1), the expression cassette described in A2), or the vector described in A3);

[0044] A6) The dengue attenuated strain produced by cell culture described in A5).

[0045] According to some embodiments of the present invention, the nucleic acid sequence is a gene RNA or its corresponding cDNA.

[0046] According to some embodiments of the present invention, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:6.

[0047] According to some embodiments of the present invention, the vector is an expression vector or a cloning vector. For example, the vector is a pCC1 vector.

[0048] According to some embodiments of the present invention, the nucleic acid molecule contains a promoter at its 5' end. The promoter includes at least one of the T7 promoter and the CMV promoter. The nucleotide sequence of the T7 promoter is shown in SEQ ID NO:7.

[0049] According to some embodiments of the present invention, the nucleic acid molecule contains a hepatitis D ribozyme sequence at its 3' end. The nucleotide sequence of the hepatitis D ribozyme sequence is shown in SEQ ID NO:8.

[0050] According to some embodiments of the present invention, the recombinant microorganism is a bacterium, yeast, algae, or fungus.

[0051] According to some embodiments of the present invention, the cell is an isolated animal cell. For example, the cell may be a Vero cell.

[0052] According to some embodiments of the present invention, the cells do not include reproductive material.

[0053] Application of the above-described dengue attenuated strain or the above-described biological material according to the fourth aspect of the present invention in any one of B1) to B3):

[0054] B1) Products for preparing and screening drugs against dengue virus;

[0055] B2) Screening for drugs to prevent and / or treat dengue virus;

[0056] B3) Prepare products for evaluating the efficacy of anti-dengue virus drugs.

[0057] According to some embodiments of the present invention, the product is selected from pharmaceuticals and reagent kits.

[0058] According to a fifth aspect embodiment of the present invention, the active ingredient of the vaccine comprises the aforementioned attenuated dengue strain. Since the vaccine employs all the technical solutions of the attenuated dengue strain of the above embodiments, it possesses at least all the beneficial effects brought about by the technical solutions of the above embodiments.

[0059] According to some embodiments of the present invention, the vaccine further includes a pharmaceutically acceptable adjuvant or carrier.

[0060] According to some embodiments of the present invention, the dosage form of the vaccine is at least one of liquid injection, injection powder, and injection tablet.

[0061] According to some embodiments of the present invention, the adjuvant is selected from at least one of oil adjuvants, oil-in-water adjuvants, water-in-oil adjuvants, water-in-oil-in-water adjuvants, aluminum salts, and polysaccharide adjuvants.

[0062] Other features and advantages of the invention will be set forth in the description which follows, and will be apparent in part from the description, or may be learned by practicing the invention. Attached Figure Description

[0063] Figure 1 This is a schematic diagram of the region where negative codon pair optimization is performed on the dengue virus genome;

[0064] Figure 2 DENV2-NS1-CPD recombinant virus, DENV2-NS2A-CPD recombinant virus, DENV2-NS2B-CPD recombinant virus, and DENV1-NS2A-CPD recombinant virus were diluted 10... 3 Later, the 16681 recombinant virus and the Western Pacific recombinant virus were diluted 10... 4 The morphology of viral plaques after phagocytosis;

[0065] Figure 3The replication levels of human cell lines after infection with recombinant viruses 16681, DENV2-NS2A-CPD, DENV2-NS2B-CPD, and DENV2-NS1-CPD were defined; "ns" indicates no significant difference, "**" indicates a significant difference (p<0.01), and "****" indicates an extremely significant difference (p<0.0001).

[0066] Figure 4 The replication levels of Western Pacific recombinant virus and DENV1-NS2A-CPD recombinant virus after infection with human cell lines are represented; "ns" indicates no significant difference, and "****" indicates a highly significant difference (p<0.0001).

[0067] Figure 5 The replication levels of the DENV2-NS2A-CPD recombinant virus at different temperatures; "*" indicates a significant difference (p<0.05), and "****" indicates an extremely significant difference (p<0.0001);

[0068] Figure 6 The changes in viral RNA levels in the blood of AG6 mice after infection with recombinant viruses 16681, DENV2-NS1-CPD, DENV2-NS2A-CPD, and DENV2-NS2B-CPD were shown. "*" indicates a significant difference relative to the 16681 recombinant virus group (p<0.05), "***" indicates an extremely significant difference relative to the 16681 recombinant virus group (p<0.001), and "****" indicates an extremely significant difference relative to the 16681 recombinant virus group (p<0.0001).

[0069] Figure 7 The survival of AG6 mice after infection with 16681 recombinant virus, DENV2-NS1-CPD recombinant virus, DENV2-NS2A-CPD recombinant virus, and DENV2-NS2B-CPD recombinant virus;

[0070] Figure 8 The titers of specific IgG antibodies in the serum of AG6 mice 25 days after infection with 16681 recombinant virus, DENV2-NS1-CPD recombinant virus, DENV2-NS2A-CPD recombinant virus, and DENV2-NS2B-CPD recombinant virus; A: titer of specific IgG antibodies against protein E; B: titer of specific IgG antibodies against protein NS1; "ns" indicates no significant difference, "*" indicates a significant difference (p<0.05);

[0071] Figure 9 The viral infection status of mice immunized by different methods at 2 and 4 days after challenge with dengue virus type II;

[0072] Figure 10 The changes in body weight of mice after challenge with dengue virus type II following different immunization methods; "**" indicates a highly significant difference relative to the DPBS group (p<0.01), "***" indicates a highly significant difference relative to the DPBS group (p<0.001), and "****" indicates a highly significant difference relative to the DPBS group (p<0.0001).

[0073] Figure 11 The changes in viral RNA levels in the blood of AG6 mice after infection with Western Pacific recombinant virus and DENV1-NS2A-CPD recombinant virus; "**" indicates a highly significant difference relative to the Western Pacific recombinant virus group (p<0.01), and "****" indicates a highly significant difference relative to the Western Pacific recombinant virus group (p<0.0001).

[0074] Figure 12 The survival of AG6 mice after infection with Western Pacific recombinant virus and DENV1-NS2A-CPD recombinant virus;

[0075] Figure 13 The viral infection status of mice immunized by different methods on days 2 and 4 after challenge with dengue virus type I. Detailed Implementation

[0076] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0077] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0078] Example 1: Obtaining attenuated dengue virus strains

[0079] (1) Negative codon pair optimization of the dengue virus gene:

[0080] The codon pair bias of genes was calculated based on the human codon pair bias table and CPB calculation formula provided in the paper "Virus Attenuation by Genome-Scale Changes in Codon Pair Bias" published by Coleman et al.

[0081] Based on the type II wild-type dengue virus strain 16681 (the viral genome cDNA sequence is shown in SEQ ID NO:1), the nucleotide sequences of its NS1, NS2A, and NS2B genes were rearranged to reduce the codon pair bias of these three genes. The NS2A gene was negatively optimized, reducing its CPB value from -0.031995392 to -0.339525346. Three amino acid mutations were introduced into the prM gene: glutamic acid at position 85 was replaced with alanine (E85A), histidine at position 86 was replaced with glycine (H86G), and glutamic acid at position 89 was replaced with serine (E89S), resulting in the type II attenuated dengue strain DENV2-NS2A-CPD, whose viral genome cDNA sequence is shown in SEQ ID NO:2. Negative optimization of the NS2B gene reduced its CPB value from 0.038294574 to -0.368937984. Three amino acid mutations (E85A, H86G, E89S) were introduced into the prM gene, yielding the type II dengue attenuated strain DENV2-NS2B-CPD. Its viral genomic cDNA sequence is shown in SEQ ID NO:3. Negative optimization of the NS1 gene reduced its CPB value from 0.038102564 to -0.329988604. Three amino acid mutations (E85A, H86G, E89S) were introduced into the prM gene, yielding the type II dengue attenuated strain DENV2-NS1-CPD. Its viral genomic cDNA sequence is shown in SEQ ID NO:4.

[0082] Based on the type I dengue wild-type strain Western Pacific (virus genomic cDNA sequence shown in SEQ ID NO:5), the nucleotide sequence of its NS2A gene was rearranged to reduce the CPB. The NS2A gene was negatively optimized, reducing its CPB value from -0.011981567 to -0.375963134. Furthermore, a single amino acid mutation was introduced into the prM gene, specifically changing the aspartic acid at position 89 of prM to lysine (D89K), resulting in the type I dengue attenuated strain DENV1-NS2A-CPD, whose viral genomic cDNA sequence is shown in SEQ ID NO:6.

[0083] Regions in the dengue virus genome that have undergone negative codon pair optimization, such as Figure 1 As shown.

[0084] (2) Construction of infectious clonal plasmids of dengue attenuated strains:

[0085] The viral genome cDNA sequences (SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6) of the synthetic dengue wild-type strain 16681, dengue attenuated strain DENV2-NS2A-CPD, dengue attenuated strain DENV2-NS2B-CPD, dengue attenuated strain DENV2-NS1-CPD, dengue wild-type strain WesternPacific, and dengue attenuated strain DEN V1-NS2A-CPD were obtained. The viral cDNA fragment was amplified by PCR and cloned into the pCC1 vector. The T7 promoter (TAATACGACTCACTATAG (SEQ ID NO:7)) and the hepatitis D ribozyme sequence (HDVr) (GGGTCGGCATGGCATCTCCACCTCCTCGCGGTCCGACCTGGGCTACTTCGGTA GGCTAAGGGAGAAG (SEQ ID NO:8)) were added to the 5' and 3' ends of the viral cDNA, respectively, to obtain infectious cloning plasmids pCC1-16681, pCC1-DENV2-NS2A-CPD, pCC1-DENV2-NS2B-CPD, pCC1-DENV2-NS1-CPD, pCC1-WesternPacific, and pCC1-DENV1-NS2A-CPD.

[0086] (3) Obtaining recombinant viruses:

[0087] DENV2 infectious cloning plasmids (pCC1-16681, pCC1-DENV2-NS2A-CPD, pCC1-DENV2-NS2B-CPD, pCC1-DENV2-NS1-CPD) were digested with restriction endonuclease ClaI, and DENV1 infectious cloning plasmids (pCC1-Western Pacific, pCC1-DENV1-NS2A-CPD) were digested with restriction endonuclease PacI. The digestion products were purified by phenol-chloroform extraction and then precipitated with ethanol to obtain linearized plasmid fragments. Subsequently, in vitro transcription was performed using the T7 promoter located upstream of the viral genome to obtain the full-length RNA of the 16681, DENV2-NS2A-CPD, DENV2-NS2B-CPD, DENV2-NS1-CPD, Western Pacific, and DENV1-NS2A-CPD viruses, respectively. Viral RNA was transfected into BHK-21 cells via liposomes. After culturing at 30°C for 6 days, the cell supernatant was collected from the culture medium containing recombinant viruses 16681, DENV2-NS2A-CPD, DENV2-NS2B-CPD, DENV2-NS1-CPD, WesternPacific, and DENV1-NS2A-CPD.

[0088] Experimental Example 1: Plaque morphology and growth characteristics of dengue attenuated vaccine

[0089] (1) Press 1×10 5 BHK-21 cells were seeded in 24-well plates, and 10 cells were transferred to each well after 24 hours. 5 ~10 7Recombinant viruses of 16681, DENV2-NS2A-CPD, DENV2-NS2B-CPD, DENV2-NS1-CPD, Western Pacific, and DENV1-NS2A-CPD titers (PFU / mL) were serially diluted 10-fold in culture medium, with six dilutions for each virus. 200 μL of virus dilution was added to each well and the mixture was incubated at 37°C for 1 h. Subsequently, 1 mL of overlay medium containing 0.8% methylcellulose was added to each well and the mixture was incubated at 37°C. On day 6 post-infection, the culture medium was removed, and 1 mL of fixative (acetone and methanol mixed at a 1:1 volume ratio) was added to each well for 30 min. The fixative was then removed, and 0.5 mL of... Wash three times with PBS, then add 0.5 mL of blocking buffer (PBS containing 3% FBS) and incubate at room temperature for 1 h. Remove the blocking buffer, add 150 μL of dengue virus antibody dilution buffer (dengue virus antibody D1-11(3)(Invitrogen, MA1-27093) diluted with blocking buffer at a ratio of 1:2000), and incubate at 4 °C overnight. Then remove the antibody, wash three times with PBS, add 150 μL of secondary antibody dilution buffer (horseradish peroxidase-labeled mouse secondary antibody (Thermo, 31430) diluted with blocking buffer at a ratio of 1:1000), and incubate at room temperature for 1 h. Remove the secondary antibody, wash three times with PBS, then add 150 μL of peroxidase substrate (Seracare, 5510-0030) and treat in the dark for 30 min. Wash three times with water to terminate the reaction, and photograph and record the staining of viral plaques.

[0090] The results are as follows Figure 2 As shown.

[0091] The DENV2-NS1-CPD, DENV2-NS2A-CPD, and DENV2-NS2B-CPD recombinant viruses all exhibited smaller plaque morphology compared to the 16681 recombinant virus, while the DENV1-NS2A-CPD recombinant virus showed smaller plaque morphology compared to the Western Pacific recombinant virus. This indicates that the cytopathic effects induced by the DENV2-NS1-CPD, DENV2-NS2A-CPD, DENV2-NS2B-CPD, and DENV1-NS2A-CPD recombinant viruses were weaker compared to their corresponding wild-type viruses 16681 and Western Pacific.

[0092] (2) Recombinant viruses 16681, DENV2-NS2A-CPD, DENV2-NS2B-CPD, DENV2-NS1-CPD, Western Pacific, and DENV1-NS2A-CPD were used to infect Huh7 cells (4 × 10⁶ cells per 6-well plate) with an MOI of 0.1. 5 Cells / well were infected at 37°C for 1 hour, after which the virus solution was removed, the cells were washed three times with PBS, and then the culture medium was replaced with fresh medium and cultured at 37°C. At 24, 48, 72, 96, and 120 hours after infection, 150 μL of cell supernatant was collected from each well, viral RNA was extracted, and the viral RNA copy number was detected by real-time quantitative fluorescence PCR.

[0093] The results are as follows Figure 3 , Figure 4 As shown.

[0094] The viral copy numbers of DENV2-NS2A-CPD recombinant viruses, DENV2-NS2B-CPD recombinant viruses, and DENV2-NS1-CPD recombinant viruses were significantly lower than those of the 16681 recombinant virus at 72h, 96h, and 120h after cell infection; in particular, the copy number at 120h was more than 100-fold lower than that of the 16681 recombinant virus. The viral copy numbers of DENV1-NS2A-CPD recombinant virus were significantly lower than those of the Western Pacific recombinant virus at 96h and 120h after cell infection; in particular, the copy number at 120h was more than 50-fold lower than that of the Western Pacific recombinant virus. This indicates that the replication capacity of DENV2-NS2A-CPD, DENV2-NS2B-CPD, DENV2-NS1-CPD, and DENV1-NS2A-CPD recombinant viruses in cells is reduced, revealing their attenuated characteristics in cellular systems.

[0095] Experiment Example 2: Optimization of growth conditions for attenuated dengue strains

[0096] The DENV2-NS2A-CPD recombinant virus was used to infect Vero cells (4 × 10⁴ cells) in 6-well plates at an MOI of 0.1. 5 Cells / well were infected at 37°C for 1 hour, after which the virus solution was removed, the cells were washed three times with PBS, and fresh culture medium was added. The cells were then cultured at 37°C and 34°C, respectively. 150 μL of cell supernatant was collected from each well after 72 h and 96 h of infection, and viral RNA was extracted. The viral RNA copy number was detected by real-time quantitative fluorescence PCR.

[0097] The results are as follows Figure 5 As shown.

[0098] The DENV2-NS2A-CPD recombinant virus exhibited a higher viral copy number at 34°C compared to 37°C; moreover, the viral copy number increased more than 20-fold after 72 hours of infection. This indicates that 34°C is more suitable for the growth of the DENV2-NS2A-CPD recombinant virus.

[0099] Experiment Example 3: Safety and efficacy evaluation of attenuated dengue strains

[0100] Animal experiments were conducted using C57BL / 6 mice (AG6) with type I and II interferon receptor defects provided by the Shanghai Pasteur Institute of the Chinese Academy of Sciences.

[0101] (1) Twenty-five 4-week-old female AG6 mice were randomly divided into 5 groups, with 5 mice in each group. The control group mice were subcutaneously injected with 100 μL of DPBS; the other four groups were subcutaneously immunized with an equal volume of 10 μL of DPBS. 5 TCID 50 Blood samples were collected 2–7 days post-immunization with recombinant viruses 16681, DENV2-NS1-CPD, DENV2-NS2A-CPD, and DENV2-NS2B-CPD. Viral RNA levels were detected by qPCR. Mice survival was monitored after immunization. Serum was collected 25 days post-immunization, and the titers of specific IgG antibodies against DENV2 viral protein E or NS1 were detected by ELISA. Challenge experiments were conducted 28 days post-immunization, with all mice receiving an intraperitoneal injection of 10... 6 TCID 50 Blood samples were collected from mice 2 and 4 days after challenge with a dose of type II wild-type dengue virus strain 43 (NCBI Sequence ID: AF204178). Viral titers were detected by plaque assay, and the weight changes of mice were monitored daily.

[0102] The results are as follows Figures 6 to 10 As shown.

[0103] On day 4 post-immunization, the viremia induced by DENV2-NS1-CPD recombinant virus, DENV2-NS2A-CPD recombinant virus, and DENV2-NS2B-CPD recombinant virus in mice was significantly lower than that induced by 16681 recombinant virus (488-fold, 19-fold, and 60-fold reductions, respectively). Furthermore, mice immunized with DENV2-NS1-CPD recombinant virus, DENV2-NS2A-CPD recombinant virus, and DENV2-NS2B-CPD recombinant virus did not die, while immunization with 16681 recombinant virus caused death in mice.

[0104] Immunization with DENV2-NS1-CPD recombinant virus, DENV2-NS2A-CPD recombinant virus, and DENV2-NS2B-CPD recombinant virus can induce antibodies in mice. Among them, DENV2-NS2A-CPD and DENV2-NS2B-CPD recombinant viruses showed higher antibody levels after immunization; compared with DENV2-NS1-CPD, the titer of E protein-specific antibodies after immunization with DENV2-NS2A-CPD recombinant virus was significantly increased by more than 4 times.

[0105] Mice immunized with DPBS or DENV2-NS1-CPD recombinant virus showed detectable infectious virus in their blood after challenge, and their body weight began to decrease from day 4 after challenge. In contrast, mice pre-immunized with DENV2-NS2A-CPD recombinant virus or DENV2-NS2B-CPD recombinant virus were completely protected from dengue virus type II infection, and their body weight was significantly higher than that of mice immunized with DPBS from day 4 to day 8 after challenge.

[0106] This indicates that the DENV2-NS2A-CPD recombinant virus and the DENV2-NS2B-CPD recombinant virus can prevent infection with dengue virus type II and protect the health of mice, thus showing potential as attenuated vaccines.

[0107] (2) Thirty four-week-old female AG6 mice were randomly divided into three groups of ten each. The control group was subcutaneously injected with 100 μL of DPBS; the other two groups were subcutaneously immunized with an equal volume of DPBS. 4 TCID 50 Western Pacific recombinant virus and DENV1-NS2A-CPD recombinant virus were administered at specific doses. Blood samples were collected 2–7 days post-immunization, and viral RNA levels were detected by qPCR. Challenge experiments were conducted 28 days post-immunization, with all mice receiving an intraperitoneal injection of 10 mg / L Western Pacific recombinant virus. 6 TCID 50 Blood samples were collected 2 and 4 days after challenge with a dose of type I wild dengue virus strain DENV1-1_AUS_H_T1_9 (NCBI Sequence ID: OK605753) and viral titer was detected by plaque assay.

[0108] The results are as follows Figures 11 to 13 As shown.

[0109] On days 4, 6, and 7 post-immunization, the viremia induced by the DENV1-NS2A-CPD recombinant virus in mice was significantly reduced compared to that induced by the Western Pacific recombinant virus; in particular, the RNA copy number decreased by more than 5,000 times on day 4.

[0110] 11-17 days post-immunization, all 10 mice immunized with Western Pacific recombinant virus died, while only 2 mice immunized with DENV1-NS2A-CPD recombinant virus died at day 20. This indicates that the toxicity of DENV1-NS2A-CPD was significantly lower than that of Western Pacific.

[0111] Mice immunized with DPBS showed detectable infectious virus in their blood after challenge, while mice pre-immunized with the DENV1-NS2A-CPD recombinant virus were completely protected against dengue virus type I infection. This indicates that the DENV1-NS2A-CPD recombinant virus has the potential to serve as an attenuated vaccine.

[0112] The embodiments of the present invention have been described in detail above with reference to the examples. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention.

Claims

1. A dengue attenuated strain, characterized in that, The dengue attenuated strain contains the recoded functional domains of the NS2A protein, the NS2B protein, and / or the NS1 protein. The coding sequences of the recoded functional domains of the NS2A protein, the NS2B protein, and / or the NS1 protein have reduced codon pair bias compared to the coding sequences of the corresponding parental protein domains. The dengue attenuated strain is dengue virus type I, and the attenuated dengue strain has an amino acid mutation D89K at position 89 of the prM protein; The dengue attenuated strain is dengue virus type II, and the prM protein of the dengue attenuated strain has amino acid mutations E85A, H86G, and E89S. The nucleotide sequences of the cDNA corresponding to the genomic RNA of the dengue attenuated strain are shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:

6.

2. The method of preparing the attenuated dengue virus strain according to claim 1, characterized in that, Includes the following steps: The attenuated dengue strain was obtained in cells using a vector carrying the genome of the attenuated dengue strain via reverse genetics.

3. A biomaterial, characterized by, The biomaterial is selected from any one of A1) to A6); A1) The isolated nucleic acid molecules, including the complete genome nucleic acid sequence of the dengue attenuated strain as described in claim 1; A2) An expression cassette containing the nucleic acid molecules described in A1); A3) A carrier containing the nucleic acid molecule described in A1) or the expression cassette described in A2); A4) Recombinant microorganisms containing the nucleic acid molecule described in A1), the expression cassette described in A2), or the vector described in A3); A5) Cells containing the nucleic acid molecule described in A1), the expression cassette described in A2), or the vector described in A3); A6) The dengue attenuated strain produced by cell culture described in A5).

4. A vaccine, characterized in that, The active ingredient of the vaccine comprises the dengue attenuated strain as described in claim 1.

Images