Nucleic acid aptamers conjugated to Bst DNA polymerase and their applications

Abstract

The application relates to the field of biotechnology, and discloses a nucleic acid aptamer combined with Bst DNA polymerase and application thereof. The nucleic acid aptamer provided by the application has high Bst enzyme affinity, can specifically recognize and combine with Bst enzyme, and protects the active site of the Bst enzyme, so as to serve as a hot start molecule of the Bst enzyme, and can also improve the reaction activity of the Bst enzyme and prolong the storage time of the Bst enzyme.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a nucleic acid aptamer that binds to Bst DNA polymerase and its applications. Background Technology

[0002] Bst DNA polymerase, derived from *Bacillus stearothermophilus*, is widely used for isothermal DNA amplification due to its high thermostability, strong strand displacement activity, and strong dUTP tolerance. Applications include loop-mediated isothermal amplification (LAMP), multiple displacement amplification (MDA), and whole genome amplification (WGA). Furthermore, Bst DNA polymerase exhibits significant advantages in polymerization rate, thermostability, salt tolerance, and dUTP tolerance during isothermal amplification, making it a promising candidate for widespread applications.

[0003] However, in actual isothermal amplification processes, non-specific amplification can occur, leading to a decrease in the purity of the amplified product. Furthermore, the high-temperature activation of enzyme activity increases the reaction time and reduces reaction efficiency. Summary of the Invention

[0004] The purpose of this invention is to overcome the aforementioned problems in the prior art and provide a nucleic acid aptamer that binds to Bst DNA polymerase and its applications. The nucleic acid aptamer provided by this invention has a high affinity for Bst DNA polymerase, can specifically recognize and bind to Bst DNA, and can be used as a hot-start molecule and stabilizer for Bst DNA polymerase.

[0005] To achieve the above objectives, the present invention provides a nucleic acid aptamer that binds to Bst DNA polymerase, wherein the nucleotide sequence of the nucleic acid aptamer has at least 30% homology with the sequences of (1) and / or (2) below:

[0006] (1) The DNA sequence shown in SEQ ID NO:1;

[0007] (2) The DNA sequence shown in SEQ ID NO:2.

[0008] A second aspect of the present invention provides an application of the nucleic acid aptamer described in the first aspect, the application comprising at least one of the following:

[0009] (a) Application in the detection of Bst DNA polymerase;

[0010] (b) Application in the purification of Bst DNA polymerase;

[0011] (c) Application in extending the storage time of Bst DNA polymerase;

[0012] (d) Application as a hot-start molecule for Bst DNA polymerase;

[0013] (e) Application in the preparation of drugs targeting Bst DNA polymerase.

[0014] A third aspect of the present invention provides a Bst DNA polymerase preparation, the preparation comprising a nucleic acid aptamer and a Bst DNA polymerase, wherein the nucleic acid aptamer is the nucleic acid aptamer described in the first aspect.

[0015] The fourth aspect of this invention provides the use of the nucleic acid aptamer described in the first aspect, or the formulation described in the third aspect, in isothermal amplification of nucleic acids and related reactions.

[0016] The fifth aspect of the present invention provides a method for in vitro isothermal amplification of nucleic acids, the method comprising using the preparation described in the third aspect as a nucleic acid amplification enzyme for in vitro isothermal amplification of nucleic acids.

[0017] Through the above technical solution, the present invention can achieve at least the following beneficial effects:

[0018] (1) The nucleic acid aptamer provided by the present invention can recognize and bind to Bst enzyme with high specificity and has high Bst enzyme affinity.

[0019] (2) The nucleic acid aptamers provided by the present invention have small molecular weight, stable chemical properties, and are easy to preserve and label. They can be used for the detection, purification, and imaging of Bst enzymes, and can also be used to prepare drugs or reagents targeting Bst enzymes. They have good and broad application prospects.

[0020] (3) The nucleic acid aptamer provided by the present invention can improve the stability of Bst enzyme and extend its storage time after specifically binding to Bst enzyme, especially the storage time at room temperature and non-freezing low temperature.

[0021] (4) The nucleic acid aptamer provided by this invention can reversibly bind to Bst enzyme. At room temperature, the two bind, thereby inactivating Bst enzyme. At high temperature (i.e., reaching the melting temperature of the nucleic acid aptamer), the secondary structure of the nucleic acid aptamer opens, and enzyme activity is restored. Therefore, by using the nucleic acid aptamer provided by this invention, the release of Bst enzyme activity can be controlled by temperature, avoiding non-specific amplification in in vitro isothermal nucleic acid amplification processes such as LAMP.

[0022] (5) The nucleic acid aptamers provided by the present invention can be mass-produced in a short period of time through artificial synthesis, and have a single composition, resulting in low quality inspection and usage costs. Attached Figure Description

[0023] Figure 1 This is a graph showing the detection results of the recognition and binding ability of each round of screening products with Bst enzyme by SPR during the aptamer screening process in Example 1.

[0024] Figure 2 This is a graph showing the affinity test results between aptamer XY01 and Bst enzyme in Example 2.

[0025] Figure 3 This is a graph showing the affinity test results between aptamer XY02 and Bst enzyme in Example 2.

[0026] Figure 4 This is a comparison chart of the detection results of loop-mediated isothermal amplification using the aptamer XY01 conjugate with Bst enzyme and Bst enzyme as a DNA amplification enzyme in Example 3.

[0027] Figure 5 This is a comparison chart of the detection results of loop-mediated isothermal amplification using the Bst enzyme, which was placed at 4°C for 3 days, and the conjugate of aptamer XY01 and Bst enzyme as a DNA amplification enzyme. Detailed Implementation

[0028] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0029] In this invention, unless otherwise specified, "Bst DNA polymerase", "Bst polymerase" and "Bst enzyme" have the same meaning and can be used interchangeably.

[0030] In this invention, the "KD value" is a characterization parameter used to describe the affinity between nucleic acid aptamers and Bst enzymes. The smaller the value, the higher the affinity between the nucleic acid aptamer and Bst enzymes. The formula for calculating the KD value is as follows:

[0031] KD = Kd / Ka; where Kd is the dissociation constant and Ka is the binding constant.

[0032] Typically, the KD value can be detected using methods such as surface plasmon resonance (the KD value detection result can usually be read directly by the software accompanying the detection instrument).

[0033] In this invention, unless otherwise specified, "non-freezing low temperature" refers to a temperature below normal room temperature that does not reach freezing conditions, such as conventional refrigeration temperature (e.g., 1-10℃); "room temperature" refers to a temperature below the melting temperature of nucleic acid aptamers, usually room temperature, i.e., below 30℃ (e.g., 20-30℃); "high temperature" refers to a temperature that reaches or exceeds the opening of the secondary structure of the nucleic acid aptamer, thereby restoring the activity of the Bst enzyme that binds to it (this process can also be called the "melting" of the nucleic acid aptamer), usually above 55℃, preferably 55-60℃.

[0034] During their research, the inventors of this invention screened and obtained a nucleic acid aptamer with high affinity for the Bst enzyme. Further research revealed that this aptamer binds to the active site of the Bst enzyme, resulting in the loss of Bst enzyme activity upon binding. When the temperature rises above the melting temperature of the aptamer, the aptamer melts, and Bst enzyme activity is restored. Therefore, when this nucleic acid aptamer is used in combination with the Bst enzyme in in vitro isothermal nucleic acid amplification methods such as LAMP, WGA, and MDA, it can effectively avoid non-specific amplification and improve the purity of the reaction products. Typically, enzymes and enzyme preparations need to be stored under frozen (e.g., -20°C) or ultra-low temperature (e.g., -80°C) conditions to extend their shelf life. However, this often leads to unstable or even lost enzyme activity due to repeated freeze-thaw cycles. While refrigerated storage avoids the effects of repeated freeze-thaw cycles, the enzyme activity decreases rapidly due to the higher storage temperature. Therefore, conventional enzyme solutions or preparations cannot be stored for long periods at non-freezing low temperatures (e.g., refrigerated temperatures). The nucleic acid aptamer of the present invention can better protect the enzyme active site when it binds to Bst enzyme, thereby enabling it to be stored for a long time at room temperature or non-freezing low temperature.

[0035] Based on this, a first aspect of the present invention provides a nucleic acid aptamer that binds to Bst DNA polymerase, wherein the nucleotide sequence of the nucleic acid aptamer has at least 30% homology with the sequences of (1) and / or (2) below:

[0036] (1) The DNA sequence shown in SEQ ID NO:1;

[0037] (2) The DNA sequence shown in SEQ ID NO:2.

[0038] GCACGGACACAAGAACAAAGAGCGGTCAAGGGAATGTTGGCCGT AATCAAACCGTGCTTGTGCTGCCTTTGTTCTG (SEQ ID NO: 1)

[0039] GCACGGACACAAGAACAAAGCAGGTGCCGTGTCCGCCGTACCAG CCGGTCTGTAACCTTGTGCTGCCTTTGTTCTG (SEQ ID NO: 2)

[0040] In this invention, "having at least x% homology" means that the nucleotide sequence of the nucleic acid aptamer is at least x% identical to the specified sequence, that is, the above sequences (1) and / or (2). For example, the nucleotide sequence of the nucleic acid aptamer may contain additional nucleotides at the 3' end and / or 5' end based on the specified sequence, or the nucleotide sequence of the nucleic acid aptamer may also be based on the specified sequence with partial nucleotide deletions at one or more sites (for example, in some cases, it may be a partial continuous sequence truncated based on the specified sequence, preferably the partial continuous sequence truncated based on the specified sequence includes at least 15 continuous nucleotides in the specified sequence, for example, 15-20 continuous nucleotides), or the nucleotide sequence of the nucleic acid aptamer may also be based on the specified sequence with nucleotide substitutions at one or more sites, or the nucleotide sequence of the nucleic acid aptamer may also have a combination of the above situations.

[0041] The nucleotide sequence of the nucleic acid aptamer provided by the present invention can be a sequence that has at least 30% homology with any one of the sequences in (1) and (2), or it can be a combination of sequences that simultaneously contain at least 30% homology with each of the two sequences in (1) and (2).

[0042] According to a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer has at least 50% homology with the sequence of (1) and / or (2), preferably at least 80% homology.

[0043] For example, they can have homology of 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100%.

[0044] Preferably, the nucleotide sequence of the nucleic acid aptamer includes the sequence of (1) and / or (2). That is, the nucleotide sequence of the nucleic acid aptamer may be a sequence that contains several additional nucleotides on the basis of the sequence of (1) and / or (2), and has the homology as described above.

[0045] Preferably, the KD value of the nucleic acid aptamer and Bst DNA polymerase does not exceed 10 nM, and more preferably is 0.5 nM-7 nM.

[0046] For example, the KD value of the nucleic acid aptamer and Bst DNA polymerase can be 0.5nM, 1nM, 1.5nM, 2nM, 2.5nM, 3nM, 3.5nM, 4nM, 4.5nM, 5nM, 5.5nM, 6nM, 6.5nM, or 7nM, or it can be a range consisting of any two of the above values, or any intermediate value within that range.

[0047] According to a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO:1.

[0048] According to a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO:2.

[0049] According to a preferred embodiment of the present invention, the nucleic acid aptamer may further be modified or altered. In this invention, modification or alteration can be a conventional modification or alteration performed on nucleic acid sequences, especially nucleic acid aptamers, in the art.

[0050] Preferably, the modification or alteration includes: chemical modification or backbone modification based on the nucleic acid aptamer.

[0051] For example, backbone modification can include modifying the backbone of nucleic acid aptamers through at least one of the following methods: phosphorylation, methylation, amination, thiolation, replacing oxygen with sulfur, replacing oxygen with selenium, and isotopes.

[0052] For example, backbone modification can transform the nucleotide sequence backbone of a nucleic acid aptamer into a phosphate thioester backbone or a peptide nucleic acid.

[0053] Preferably, the modification or alteration includes: attaching a chemical modifying group to the nucleic acid aptamer. Any chemical group commonly used in the art for nucleic acid modification can be used to modify the nucleic acid aptamer of the present invention.

[0054] It should be understood that in the aptamer provided by the present invention, there may be only one of the above-mentioned modifications or alterations, or there may be multiple modifications simultaneously. For example, in the aptamer, only chemical modification groups may be connected, or only the skeleton may be modified; or, for another example, in the aptamer, both skeleton modification and modification groups may be connected simultaneously.

[0055] The term "thiophosphate backbone" as used in this invention has the meaning commonly understood by those skilled in the art, referring to the fact that the non-bridging oxygen atoms of the phosphodiester backbone of RNA and DNA nucleic acid aptamers can be replaced by one or two sulfur atoms to produce thiophosphate backbones with thiophosphate or dithiophosphate bonds, respectively.

[0056] The term "peptide nucleic acid" as used in this invention has the meaning commonly understood by those skilled in the art, referring to a synthetically produced DNA molecule analog first reported by Nielsen et al. in 1991. As shown in formulas (I) and (II) below, oligonucleotide analogs linked by peptide bonds were synthesized by replacing the sugar-phosphate backbone with N-2-(aminoethyl)-glycine units as repeating structural units, and are called peptide nucleic acids.

[0057]

[0058] Preferably, after modification and / or alteration, the nucleic acid aptamer still has the ability to bind to Bst enzyme, and its affinity is not less than 85% of the affinity of the nucleic acid aptamer to Bst enzyme before modification and / or alteration.

[0059] Preferably, after modification and / or alteration, the stability of the nucleic acid aptamer is not less than 90% of the stability of the nucleic acid aptamer before modification and / or alteration.

[0060] Preferably, after modification and / or alteration, the nucleic acid aptamer exhibits resistance to nuclease degradation of no less than 90% of the resistance of the nucleic acid aptamer before modification and / or alteration.

[0061] According to a preferred embodiment of the present invention, the nucleic acid aptamer is further linked to a marker. In this invention, the "marker" can be a substance commonly used in the art to label nucleic acids for therapeutic, detection, research, and other purposes.

[0062] Preferably, the marker includes at least one of fluorescent markers, radioactive markers, siRNA, nanoluminescent markers, chemiluminescent markers, enzyme markers, and drugs.

[0063] For example, the label can be a fluorescent group (such as FAM, ROX, VIC, etc.), a radioactive isotope, a drug (such as biotin, digoxin), a nanomaterial (such as upconversion particles, MOF, gold nanoparticles, etc.), a small peptide (such as His-tag, etc.), siRNA, or an enzyme label, etc.

[0064] Preferably, after ligation with the marker, the nucleic acid aptamer still has the ability to bind to the Bst enzyme, and its affinity is not less than 85% of the affinity of the nucleic acid aptamer before ligation with the marker to the Bst enzyme, preferably not less than 90%.

[0065] Preferably, after ligation with the marker, the stability of the nucleic acid aptamer is not less than 90% of the stability of the nucleic acid aptamer before ligation with the marker.

[0066] Preferably, after ligation with the marker, the resistance of the nucleic acid aptamer to nuclease degradation is not less than 90% of the resistance of the nucleic acid aptamer before ligation with the marker.

[0067] A second aspect of the present invention provides an application of the nucleic acid aptamer described in the first aspect, the application comprising at least one of the following:

[0068] (a) Application in the detection of Bst DNA polymerase;

[0069] (b) Application in the purification of Bst DNA polymerase;

[0070] (c) Application in extending the storage time of Bst DNA polymerase (especially in extending the storage time of Bst DNA polymerase at room temperature or non-freezing low temperature).

[0071] (d) Application as a hot-start molecule for Bst DNA polymerase;

[0072] (e) Application in the preparation of drugs targeting Bst DNA polymerase;

[0073] According to a preferred embodiment of the present invention, application (a) can be used to detect the sample to be tested using the nucleic acid aptamer provided by the present invention, and to quantitatively or qualitatively detect the Bst enzyme in the sample.

[0074] According to a preferred embodiment of the present invention, application (b) may involve mixing the nucleic acid aptamer provided by the present invention with a sample containing Bst enzyme, and purifying the sample by utilizing the characteristic that the nucleic acid aptamer can specifically bind to Bst enzyme.

[0075] According to a preferred embodiment of the present invention, application (c) may include adding the nucleic acid aptamer provided by the present invention to a solution sample containing Bst enzyme. Through the specific binding of the nucleic acid aptamer to the active site of Bst enzyme and its protective effect on the active site, the Bst enzyme after the addition of the nucleic acid aptamer can be stored for a long time at room temperature or at non-freezing low temperatures. For example, after adding the nucleic acid aptamer of the present invention, the storage time of Bst enzyme (solution) at 25°C or 4°C can be more than twice the storage time before addition, preferably three to five times. Storage time refers to the time required for the enzyme activity of the solution sample containing Bst enzyme to decrease to 90% of its freshly prepared enzyme activity.

[0076] According to a preferred embodiment of the present invention, application (c) may further include mixing the nucleic acid aptamer provided by the present invention with the Bst enzyme in solution and allowing it to specifically bind, followed by drying (e.g., freeze-drying). The resulting lyophilized formulation contains the Bst enzyme, which, similar to the solution sample, can be stored at room temperature or at non-freezing low temperatures for extended periods. For example, after binding with the nucleic acid aptamer of the present invention, the storage time of the Bst enzyme (lyophilized agent) at 25°C or 4°C can be more than twice, preferably three to five times, that of the Bst enzyme without the binding nucleic acid aptamer. Storage time refers to the time required for the enzyme activity in the solution obtained when the Bst enzyme lyophilized agent or the lyophilized agent of the Bst enzyme and the nucleic acid aptamer conjugate is reconstituted in equal amounts to decrease to 90% of the enzyme activity when the freshly prepared lyophilized agent is reconstituted in equal amounts.

[0077] According to a preferred embodiment of the present invention, application (d) may include binding the nucleic acid aptamer provided by the present invention to the Bst enzyme, controlling the structural changes of the nucleic acid aptamer by temperature, thereby controlling the release and shutdown of Bst enzyme activity.

[0078] Preferably, application (d) may include using an aptamer-Bst enzyme conjugate as a nucleic acid amplification enzyme in the isothermal nucleic acid amplification reaction process for nucleic acid amplification.

[0079] Preferably, application (d) may further include using the aptamer of the present invention (at room temperature) to inhibit the activity of Bst enzyme (i.e., using the aptamer of the present invention as a Bst enzyme inhibitor).

[0080] According to a preferred embodiment of the present invention, application (e) may include linking the nucleic acid aptamer provided by the present invention to a drug molecule, utilizing the specific recognition and binding ability of the nucleic acid aptamer to the Bst enzyme to target the drug molecule to the Bst enzyme. For example, it can be used in research to investigate the effects of certain drug molecules on the Bst enzyme, or to target the Bst enzyme with drugs known to have specific modification or alteration functions.

[0081] A third aspect of the present invention provides a Bst DNA polymerase preparation, the preparation comprising a nucleic acid aptamer and a Bst DNA polymerase, wherein the nucleic acid aptamer is the nucleic acid aptamer described in the first aspect.

[0082] According to a preferred embodiment of the present invention, the content of nucleic acid aptamers in the formulation is 1-20 nM relative to 1 U of Bst DNA polymerase. For example, the content of nucleic acid aptamers relative to 1 U of Bst DNA polymerase can be 1 nM, 2 nM, 3 nM, 4 nM, 5 nM, 6 nM, 7 nM, 8 nM, 9 nM, 10 nM, 11 nM, 12 nM, 13 nM, 14 nM, 15 nM, 16 nM, 17 nM, 18 nM, 19 nM, or 20 nM, or it can be a range consisting of any two of the above values, or any intermediate value in the range, preferably 5-15 nM.

[0083] According to a preferred embodiment of the present invention, the formulation may be a liquid formulation or a solid formulation.

[0084] Preferably, the liquid formulation comprises water and / or TE buffer. That is, the liquid formulation is prepared using water or TE buffer. The water used to prepare the liquid formulation in this invention can be any water commonly used in the art for preparing nucleic acid liquid formulations, such as ultrapure water, deionized water, sterile water, etc. To avoid degradation of nucleic acid aptamers in the liquid formulation, it is preferable that the water and TE buffer used to prepare the liquid formulation do not contain nucleases. TE buffer is a buffer solution prepared with Tris and EDTA, which can be used to stably preserve nucleic acids. This invention does not particularly limit the specific source of the TE buffer used in the liquid formulation; it can be a commercially available product purchased directly or prepared using existing technology.

[0085] According to a preferred embodiment of the present invention, the Bst enzyme and nucleic acid aptamer in the formulation can be mixed and packaged together, or they can be packaged separately.

[0086] For example, the formulation may be a liquid formulation in which the Bst enzyme and nucleic acid aptamer conjugate are dissolved in water / buffer; it may be a buffer solution kit in which the Bst enzyme and nucleic acid aptamer are dissolved in water / buffer and stored separately; it may be a reagent kit in which powdered Bst enzyme and water / buffer solution containing nucleic acid aptamer are stored separately; it may be a solid formulation (lyophilized powder) obtained by lyophilizing the liquid formulation in which the Bst enzyme and nucleic acid aptamer conjugate is dissolved in water / buffer; it may be a solid reagent kit in which powdered Bst enzyme and nucleic acid aptamer are stored separately after lyophilization; it may be a mixed solid (powder) reagent packaged with separately lyophilized powdered Bst enzyme and nucleic acid aptamer.

[0087] To simplify operation and reduce packaging costs, according to some preferred embodiments of the present invention, the nucleic acid aptamer and Bst DNA polymerase are packaged together in the formulation, and the nucleic acid aptamer and Bst DNA polymerase are combined in the formulation.

[0088] The formulation provided by this invention can replace Bst enzyme as an amplification enzyme in in vitro isothermal nucleic acid amplification reactions such as loop-mediated isothermal amplification (LAMP), whole-genome amplification (WGA), and multiple strand displacement amplification (MDA). When using this formulation, because the nucleic acid aptamers in the formulation bind to Bst enzyme and can achieve the shutdown and release of Bst enzyme activity under the influence of temperature, non-specific amplification during the reaction process can be effectively avoided compared with using Bst enzyme alone, thus improving the purity of the reaction product.

[0089] The fourth aspect of this invention provides the use of the nucleic acid aptamer described in the first aspect, or the formulation described in the third aspect, in nucleic acid isothermal amplification reactions and related reactions.

[0090] According to a preferred embodiment of the present invention, the relevant reaction includes at least one of whole genome amplification (WGA), multiple strand substitution amplification (MDA), helicase-dependent amplification (HDA), rolling circle amplification (RCA), and loop-mediated isothermal amplification (LAMP).

[0091] This invention further provides the application of the nucleic acid aptamer described in the first aspect, or the formulation described in the third aspect, in improving the purity of reaction products from isothermal nucleic acid amplification and related reactions (such as WGA, MDA, HAD, RCA, LAMP, etc.). When the nucleic acid aptamer provided by this invention is combined with Bst enzyme, the Bst enzyme can exert its activity as an isothermal amplification enzyme once the temperature reaches the aptamer's melting temperature, without the need for enzyme activation, thereby shortening the overall reaction time.

[0092] The present invention further provides the use of the nucleic acid aptamer described in the first aspect, or the formulation described in the third aspect, in shortening the reaction time of nucleic acid isothermal amplification reactions and related reactions (or improving the reaction efficiency of nucleic acid isothermal reactions and related reactions).

[0093] The fifth aspect of the present invention provides a method for in vitro isothermal amplification of nucleic acids, the method comprising using the preparation described in the third aspect as a nucleic acid amplification enzyme for in vitro isothermal amplification of nucleic acids.

[0094] According to a preferred embodiment of the present invention, the in vitro nucleic acid isothermal amplification includes at least one of LAMP, WGA, MDA, RCA, and HDA.

[0095] According to a preferred embodiment of the present invention, the initiation temperature for in vitro nucleic acid amplification is above 50°C, preferably 50-55°C. At this temperature, the nucleic acid aptamers in the formulation melt, releasing Bst enzyme activity, thereby achieving the amplification of the target nucleic acid.

[0096] The present invention will be described in detail below through embodiments. It should be understood that the following embodiments are only used to further explain and illustrate the content of the present invention by way of example, and are not intended to limit the present invention.

[0097] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available products purchased from regular chemical or biological reagent / material suppliers, and the purity of all reagents is analytical grade.

[0098] Example 1

[0099] This embodiment is used to illustrate the screening of nucleic acid aptamers provided by the present invention.

[0100] The method for screening ssDNA aptamers that bind to Bst DNA polymerase in this embodiment includes the following steps:

[0101] 1. Synthesize the random single-stranded DNA library and primers shown in the following sequences:

[0102] The DNA library was synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the primers were synthesized by Nanjing Genscript Biotech Co., Ltd.

[0103] Random single-stranded DNA library: composed of the nucleotide sequence shown in SEQ ID NO:3 from the 5' end to the 3' end, the 36N sequence, and the nucleotide sequence shown in SEQ ID NO:4 linked together in sequence. The 36N sequence refers to a sequence composed of 36 arbitrary nucleotide bases linked together.

[0104] GCACGGACACAAGAAAAAG(SEQ ID NO:3)

[0105] CTTGTGCTGCCTTTGTTCTG(SEQ ID NO:4)

[0106] See Table 1 for primer sequences. In the primer names, S represents the forward primer and A represents the reverse primer.

[0107] Table 1 Primers and their sequences

[0108] Primer name Sequence (5'-3') SEQ ID NO LibS1 GCACGGACACAAGAACAAAG 5 Lib-FAM-S1 FAM-GCACGGACACAAGAACAAAG 6 Lib-Biotin-A2 Biotin-CAGAACAAAGGCAGCACAAG 7 LibA2 CAGAACAAAGGCAGCACAAG 8

[0109] The primers were prepared into 100 μM stock solutions using DPBS buffer and stored at -20°C for later use.

[0110] 2. Magnetic bead screening method

[0111] The aptamers in the above library were screened using the magnetic bead method, with a total of 9 rounds of screening.

[0112] Each round of screening includes reverse screening and forward screening. Reverse screening uses carboxyl magnetic beads (MB-His) coupled with His peptides (6 His peptides tandemly, chemically synthesized by Nanjing Genscript Biotech Co., Ltd.); forward screening uses carboxyl magnetic beads (MB-Bst) coupled with Bst enzyme. The specific screening process is as follows:

[0113] Round 1 screening: Take 1 OD from the synthesized DNA library, centrifuge at 14000 rpm for 5 minutes, discard the supernatant, and add DPBS buffer to prepare a 10 μM library solution. Aliquot the library solution into PCR tubes, place them in a PCR instrument, and incubate at 95°C for 10 minutes to allow the secondary structure of the aptamers to open (i.e., aptamer denaturation), then incubate at 4°C for 5 minutes and equilibrate to room temperature.

[0114] The processed library solution was added to 50 μL of MB-His magnetic beads, mixed well, and incubated at room temperature on a vertical mixer. After incubation, the mixture was placed on a magnetic rack, and the supernatant was collected. The collected supernatant was then mixed with 50 μL of MB-Bst and incubated at room temperature (25 °C) on a vertical mixer. After incubation, the mixture was placed on a magnetic rack, the supernatant was removed, and the magnetic beads were washed four times with 200 μL of DPBS buffer. After washing, the magnetic beads were resuspended in 200 μL of DPBS buffer and boiled in a water bath for 10 min. The resulting supernatant was named elution-Bst.

[0115] Using the nucleic acid molecules in elution-Bst as templates, amplification was performed using conventional PCR. The method is as follows: All elution-Bst template was added to 2 ml of PCR mix (purchased from Baorui Biotechnology, 2X STR Premix (079201)) and mixed well. The template and PCR mix mixture was divided into 100 μL / tube and added to PCR tubes. The tubes were placed in a PCR instrument and amplified under the following conditions: 95℃ pre-denaturation for 2 minutes, 95℃ denaturation for 60 seconds, 60℃ annealing for 60 seconds, 72℃ extension for 60 seconds, for a total of 25 cycles, and stored at 4℃.

[0116] The amplification products were purified using commercially available Tiandiren SA magnetic beads (SM017100) to prepare a secondary library for the next round of screening.

[0117] Rounds 2-9 of screening: The operation is the same as round 1, except that each round uses the secondary library obtained from the previous round as the starting library for screening.

[0118] During the screening process, surface plasmon resonance (SPR) was used to detect changes in the recognition ability of the DNA single-stranded library for Bst DNA polymerase. When the recognition ability of the DNA single-stranded library for Bst DNA polymerase met the requirements, that is, the binding ability of the screened DNA single-stranded library to the target protein gradually increased. Figure 1 ),from Figure 1 As can be seen, the retention rate increased significantly from the fourth round of screening, reaching a peak in the eighth round, indicating that the binding affinity between the aptamer and the target was significantly improved with the increase of screening rounds. The obtained library was then analyzed using high-throughput sequencing to meet sequencing requirements.

[0119] 3. Analysis and identification of the nucleic acid aptamers obtained after screening: After high-throughput sequencing analysis of the enriched library products, the two aptamer sequences with the strongest affinity were finally selected and named XY01 and XY02, respectively. Their nucleotide sequences are shown in Table 2 below.

[0120] Table 2 shows the aptamers obtained through screening.

[0121]

[0122] Example 2

[0123] This embodiment is used to illustrate the affinity of the nucleic acid aptamer for the Bst enzyme provided by the present invention.

[0124] The nucleic acid aptamers with sequences as shown in SEQ ID NO:1 and SEQ ID NO:2 were synthesized by Suzhou Genewiz Biotechnology Co., Ltd., and diluted with DPBS buffer to prepare 12.5 nM, 25 nM, 50 nM, 100 nM, 200 nM and 400 nM for later use.

[0125] 1. Bst DNA polymerase was coupled to channel 2 of the CM5 chip (purchased from Beijing Bio-Tech Biotechnology Co., Ltd.) using the following method: First, the chip was cleaned with 50 mM NaOH, and 20 μL of the polymerase was injected at a flow rate of 10 μL / min. Then, 50 μL of a mixture of equal volumes of EDCC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4 M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1 M aqueous solution) was injected to activate the chip at a flow rate of 5 μL / min. The Bst DNA polymerase was diluted to a final concentration of 50 μg / mL with 10 mM NaAc solution at pH 4 and injected at a flow rate of 5 μL / min. The Bst polymerase coupling amount was 3500 RU. After injection, 100 μL of ethanolamine was injected to block the chip at a flow rate of 10 μL / min. Where RU is the response value, which is the unit of resonance angle in SPR, 1RU = 10⁻⁶. -4Based on measurement experience, for every 1000 RU increase in the resonance angle, approximately 1 ng / mm is obtained. 2 The protein is attached to the surface.

[0126] The first and second channels were treated in the same way, except that the Bst enzyme was replaced with 3500 RUBSA as a control channel.

[0127] 2. Detection: Using a surface plasmon resonance spectrometer (GE Healthcare, model: Biacore 8K), the detection parameters were set. The two diluted aptamer samples were sequentially flowed through channels 1 and 2. The procedure for each aptamer was as follows: injection 30 μL / min, time 2 min; dissociation 30 μL / min, time 2 min; regeneration 1M NaCl 30 μL / min, time 30 s. The two diluted nucleic acid aptamers were then sequentially injected.

[0128] Affinity assay data for nucleic acid aptamers and Bst DNA polymerase are shown in the figures below. Figure 2-3 , Figure 2 Affinity assay of aptamer XY01 with Bst DNA polymerase; Figure 3 The graph shows the affinity of aptamer XY02 to Bst DNA polymerase. The KD values ​​were read using the instrument's software; a smaller KD value indicates greater affinity. Specific results are shown in Table 3. It can be seen that the KD values ​​of both nucleic acid aptamers are relatively small, reaching the nM level, indicating a strong binding affinity between the corresponding nucleic acid aptamers and the target protein Bst polymerase.

[0129] Table 3. Affinity of nucleic acid aptamers to Bst polymerase

[0130] Nucleic acid aptamer sequence Affinity to Bst DNA polymerase KD (nM) XY01 (SEQ ID NO:1) 1.65 XY02 (SEQ ID NO:2) 1.45

[0131] Example 3

[0132] This embodiment is used to illustrate the stability of the nucleic acid aptamer provided by the present invention and its effect on prolonging the storage time of Bst enzyme.

[0133] 1. Stability of nucleic acid aptamers

[0134] Prepare a 10x primer mixture for loop-mediated isothermal amplification (LAMP) according to the sequences shown in Table 4.

[0135] Using the genomic cDNA of 2019nCoV virus (GenBank ID: NC_045512.2) as a template, loop-mediated isothermal amplification (LAMP) reaction was performed using the primer mixture in Table 4.

[0136] Table 4 10x primer mixture preparation

[0137]

[0138]

[0139] The isothermal amplification reaction system was prepared as shown in Table 5, with the remainder being an RNaes-free aqueous solution, and New England Biolabs (NEB) WarmStart was used. TM The reaction is carried out using LAMP2×MasterMix(DNA & RNA).

[0140] Table 5. Isothermal amplification reaction system (25 μL)

[0141] reagents Dosage / μL 10x isothermal amplification buffer 2.5 <![CDATA[MgSO4(100mM)]]> 1 dNTPs (10mM) 3.5 SYTO-9 1 10x primer mixture 3 Apt-Bst 2 template 3

[0142] The preparation method of Atp-Bst is as follows:

[0143] 1. Aptamer treatment: Add 1.5 μL of 100 μM aptamer to 98.5 μL of binding solution, incubate at 95°C for 5 min, then immediately quench at -20°C for 5 min to obtain the quenched aptamer solution. The binding solution is Tris-HCl buffer.

[0144] 2. Binding of aptamer and enzyme: Add 30 μL of LBst proenzyme solution (5 U / μL, prepared with Tris-HCl buffer) directly to 100 μL of quenched aptamer, mix well and incubate at 4°C for 20 min to obtain Atp-Bst solution (enzyme activity 5 U / μL).

[0145] Test results as follows Figure 4 As shown in the figure, when Atp-Bst is used for isothermal amplification, its activity as a DNA amplification enzyme is significantly higher than that of Bst enzyme alone.

[0146] Similar results were obtained when the conjugate of aptamer XY02 and Bst enzyme were detected using the same method.

[0147] 2. The effect of nucleic acid aptamers on the storage time of Bst enzyme

[0148] Following the method described in Example 3, the genomic RNA of the 2019nCoV virus (GenBank ID: NC_045512.2) was amplified using the aptamer XY01 conjugate with Bst enzyme (Atp-Bst) and the Bst enzyme, respectively. The difference was that the Atp-Bst and Bst enzyme used in this example were incubated at 4°C for 3 days before use. Figure 5The isothermal amplification and melting curves using Atp-Bst and Bst as amplification enzymes are shown. As can be seen from the figure, after storage at 4℃ for 3 days, the melting curve of Atp-Bst shows a single peak, indicating no non-specific products. However, the melting curve of Bst enzyme shows mixed peaks, and the peak of the amplification product is significantly reduced, indicating the occurrence of non-specific amplification.

[0149] Using the same method, isothermal amplification was performed using the conjugate of aptamer XY02, which was placed at 4℃ for 3 days, and Bst enzyme as the amplification enzyme, and similar results were obtained.

[0150] Therefore, it can be seen that the aptamer provided by the present invention has better stability with Bst enzyme compared with Bst enzyme alone, which also shows that the binding of the nucleic acid aptamer provided by the present invention has a promoting effect on the long-term preservation of Bst enzyme.

[0151] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. A nucleic acid aptamer that binds to Bst DNA polymerase, characterized in that, The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO:1 or SEQ ID NO:

2.

2. The nucleic acid aptamer according to claim 1, wherein, The nucleic acid aptamers have also been modified or altered.

3. The nucleic acid aptamer according to claim 2, wherein, The modification or alteration includes: modifying the backbone based on the nucleic acid aptamer.

4. The nucleic acid aptamer according to claim 2, wherein, The modification or alteration includes: attaching chemical modification groups to a nucleic acid aptamer.

5. The nucleic acid aptamer according to claim 1, wherein, The nucleic acid aptamer is also linked to a marker.

6. The nucleic acid aptamer according to claim 5, wherein, The markers include at least one of fluorescent markers, radioactive markers, nanoluminescent markers, chemiluminescent markers, enzyme markers, and drugs.

7. The nucleic acid aptamer according to claim 6, wherein, The drug in question is siRNA.

8. The application of the nucleic acid aptamer according to any one of claims 1-7, characterized in that, The application includes at least one of the following: (a) Application in the detection of Bst DNA polymerase; (b) Application in the purification of Bst DNA polymerase; (c) Application in extending the storage time of Bst DNA polymerase; (d) Application as a hot-start molecule for Bst DNA polymerase.

9. A Bst DNA polymerase preparation, characterized in that, The formulation comprises a nucleic acid aptamer and Bst DNA polymerase, wherein the nucleic acid aptamer is the nucleic acid aptamer according to any one of claims 1-7.

10. The formulation according to claim 9, wherein, In the formulation, the content of nucleic acid aptamers is 1-20 nM relative to 1 U of Bst DNA polymerase.

11. The formulation according to claim 9, wherein, The formulation is a liquid formulation.

12. The formulation according to claim 11, wherein, The formulation contains water and / or TE buffer.

13. The formulation according to claim 9, wherein, The formulation is a solid dosage form.

14. The formulation according to any one of claims 9-13, wherein, In the formulation, the nucleic acid aptamer and Bst DNA polymerase are packaged separately, or the nucleic acid aptamer and Bst DNA polymerase are packaged together.

15. The formulation according to claim 14, wherein, The formulation contains a mixed packaging of nucleic acid aptamers and Bst DNA polymerase, and the nucleic acid aptamers and Bst DNA polymerase are combined in the formulation.

16. The use of the nucleic acid aptamer according to any one of claims 1-7, or the formulation according to any one of claims 9-15, in nucleic acid isothermal amplification reactions and related reactions.

17. The application according to claim 16, wherein, The relevant reactions include at least one of whole genome amplification, multiple strand substitution amplification, helicase-dependent amplification, rolling circle amplification, and loop-mediated isothermal amplification.

18. A method for in vitro isothermal amplification of nucleic acids, characterized in that, The method includes in vitro isothermal amplification of nucleic acids using the preparation described in any one of claims 9-15 as a nucleic acid amplification enzyme.

19. The method according to claim 18, wherein, The in vitro isothermal amplification of nucleic acids is initiated at a temperature above 50°C.

20. The method according to claim 19, wherein the initiation temperature for the in vitro isothermal amplification of nucleic acids is 50-55°C.

Images