Application of nodU gene in regulating nodulation and nitrogen fixation efficiency of A. tumefaciens

Abstract

The application discloses application of a nodU gene in regulating nodulation ability and nitrogen fixation efficiency of a stem-nodulating nitrogen-fixing rhizobium, and belongs to the technical field of biotechnology. The application finds that overexpression of the nodU gene in the stem-nodulating nitrogen-fixing rhizobium can simultaneously improve the nodulation and nitrogen fixation ability of the stem-nodulating nitrogen-fixing rhizobium. The application constructs a nodU overexpression strain of a stem-nodulating nitrogen-fixing rhizobium ORS571 nodulation gene, inoculates leguminous plants for symbiosis, and compared with the leguminous plants inoculated with wild-type rhizobium, can obviously increase the nodulation number of the leguminous plants, improve the nitrogen fixation ability of the nodulation, and improve the plant growth phenotype.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of the nodU gene in regulating the nodulation ability and nitrogen fixation efficiency of stem-nodulating nitrogen-fixing rhizobia. Background Technology

[0002] Rhizobia are Gram-negative bacteria that can establish a symbiotic nitrogen-fixing relationship with legumes. In natural ecosystems, the symbiotic nitrogen fixation between rhizobia and legumes helps improve soil fertility. Through nitrogen fixation, legumes can convert atmospheric nitrogen into nitrogen compounds that are available to the plant, thus significantly expanding their nitrogen utilization capacity. The nodulation process between rhizobia and legumes is mainly caused by nodulation factors. Nodulation factors are lipochitosan oligomers required for nodule development and intracellular root infection, and they are active at extremely low concentrations. The enzymes responsible for the biosynthesis of nodulation factors are encoded by genes such as nod, noe, and nol, which are located in symbiotic plasmids or genomic islands. The synthesis of active nodulation factors generally requires the participation of multiple nodulation factor genes. With the cooperation of multiple genes and substrates, rhizobia synthesize biologically active nodulation factors and form a nodulation symbiosis with the host.

[0003] Azorhizobium caulinodans ORS571 is a unique rhizobium possessing both symbiotic and autotrophic nitrogen-fixing capabilities. It can form nodules not only on the roots of its host plant, *Senecio scandens*, but also on its stems. This unique nitrogen-fixing ability promotes the growth of *Senecio scandens* and enhances its adaptability to saline-alkali environments. Bioinformatics analysis suggests that the symbiotic nitrogen-fixing function of ORS571 originates from genetic evolution, with the symbiotic islands likely integrated into the genome via horizontal transfer. These symbiotic islands primarily consist of nodulation gene clusters, lacking the *fix* and *nif* genes. The nodulation gene cluster is 87.6 kb in length, making cloning challenging. Currently, there are no reports of simultaneously regulating the nodulation and nitrogen-fixing capabilities of ORS571 using a single *nodU* gene. Summary of the Invention

[0004] The purpose of this invention, in view of the aforementioned prior art, is to provide the application of the nodU gene in regulating the nodulation ability and nitrogen fixation efficiency of stem-nodulated nitrogen-fixing rhizobia. This invention has found that overexpression of the nodU gene in stem-nodulated nitrogen-fixing rhizobia can simultaneously improve both the nodulation and nitrogen fixation abilities of the bacteria.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A first aspect of the present invention provides the use of the nodU gene in either (1) or (2):

[0007] (1) Simultaneously improve the nodulation ability and nitrogen fixation ability of stem-nodulated nitrogen-fixing rhizobia;

[0008] (2) Promote the symbiotic effect between rhizobia and plants;

[0009] The nodU gene is a DNA molecule as shown in i) or ii) below:

[0010] i) The nucleotide sequence is the DNA molecule shown in SEQ ID NO.1;

[0011] ii) DNA molecules other than i) encoding the amino acid sequence shown in SEQ ID NO.2.

[0012] In the above applications, the symbiotic effect between rhizobia and plants includes: increasing the number of nodules, enhancing nitrogen fixation capacity, and / or promoting plant growth.

[0013] The nodU gene encodes carbamoyltransferase. This invention has found that overexpressing the nodU gene alone in the stem-nodulating rhizobium ORS571 can simultaneously enhance both the nodulation and nitrogen-fixing abilities of ORS571. Inoculating legumes with ORS571 overexpressing the nodU gene for symbiosis significantly increases the number of nodules, enhances nitrogen-fixing ability, and promotes the growth of legumes.

[0014] A second aspect of the invention provides the use of the protein encoded by the nodU gene in either (1) or (2):

[0015] (1) Simultaneously improve the nodulation ability and nitrogen fixation ability of stem-nodulated nitrogen-fixing rhizobia;

[0016] (2) Promote the symbiotic effect between rhizobia and plants.

[0017] In the above applications, the amino acid sequence of the protein encoded by the nodU gene is shown in SEQ ID NO.2.

[0018] Proteins are the specific executors and manifestations of gene functions. Therefore, the application of the protein encoded by the nodU gene in simultaneously improving the nodulation and nitrogen fixation abilities of stem-nodulated nitrogen-fixing rhizobia, as well as promoting the symbiotic effect between rhizobia and plants, is also within the scope of protection of this invention.

[0019] A third aspect of the invention provides the use of an expression cassette or recombinant expression vector containing the nodU gene in any of the following (1)-(3):

[0020] (1) Construct recombinant rhizobia overexpressing the nodU gene;

[0021] (2) Simultaneously improve the nodulation and nitrogen fixation abilities of stem-nodulated nitrogen-fixing rhizobia;

[0022] (3) Promote the symbiotic effect between rhizobia and plants.

[0023] Preferably, the nucleotide sequence of the expression cassette containing the nodU gene is shown in SEQ ID NO.3; it consists of an upstream sequence of the nodU gene (438 bp) (positions 1-438 of SEQ ID NO.3), a sequence encoding the nodU gene (1683 bp) (positions 439-2121 of SEQ ID NO.3), and a downstream sequence of the nodU gene (432 bp) (positions 2122-2553 of SEQ ID NO.3).

[0024] As a preferred option, the base plasmid used to construct the recombinant expression vector is the pBBR1MCS-2 plasmid (sequence can be found at https: / / www.addgene.org / 85168 / sequences / ), which is a vector capable of delivering exogenous DNA or target genes into host cells for amplification and expression.

[0025] In a fourth aspect, the present invention provides a recombinant rhizobium overexpressing the nodU gene, prepared by the following method:

[0026] The expression cassette containing the nodU gene shown in SEQ ID NO.3 was ligated into the pBBR1MCS-2 plasmid to construct the recombinant plasmid pBBR1MCS-2-nodU;

[0027] The recombinant plasmid pBBR1MCS-2-nodU was introduced into the stem-nodated nitrogen-fixing rhizobium ORS571 to prepare a recombinant rhizobium overexpressing the nodU gene.

[0028] In a fifth aspect, the present invention provides the application of the recombinant rhizobium overexpressing the nodU gene described above in promoting plant nodulation and growth.

[0029] In the above application, the plant is sesquiterpene.

[0030] A sixth aspect of the present invention provides a method for promoting nodulation and growth of sesquiterpenes under low-nitrogen conditions, comprising the following steps:

[0031] Recombinant rhizobium overexpressing the nodU gene was used as an inoculum to soak germinating Sesbania pubescens seeds for 3 hours. The seeds were then transferred to sterilized vermiculite mixed with low-nitrogen nutrient solution and cultured at 25°C under a 12h:12h photoperiod to promote nodulation and growth of Sesbania pubescens.

[0032] The beneficial effects of this invention are:

[0033] This invention constructs a stem-nodulating nitrogen-fixing rhizobium strain ORS571 overexpressing the nodulation gene nodU. When inoculated onto legumes for symbiosis, this strain significantly increases the number of nodules, enhances nitrogen fixation capacity, and improves plant growth phenotype compared to legumes inoculated with wild-type rhizobium. Statistical analysis shows significant differences. The recombinant rhizobium constructed using this invention exhibits stronger nodulation capacity in the roots and stems of the host plant, *Senecio scandens*, exceeding that of the unmodified wild-type rhizobium, and its nitrogen fixation capacity is significantly enhanced. Furthermore, it demonstrates a stronger growth-promoting effect on the host plant after colonization. Attached Figure Description

[0034] Figure 1 The results of agarose gel electrophoresis of the double digestion products of the recombinant plasmid pBBR1MCS-2-nodU constructed in Example 1 of this invention are shown. Lane 1 is the product of double digestion of the extracted recombinant plasmid pBBR1MCS-2-nodU with restriction endonucleases HindIII and XbaI; Lane 2 is the nodU gene amplification product; Lane 3 is the product of double digestion of plasmid pBBR1MCS-2 with restriction endonucleases HindIII and XbaI. This indicates that the nodU sequence has been successfully ligated into the vector.

[0035] Figure 2 The growth curves of wild-type WT (ORS571) and the overexpression strain OEnodU constructed in this invention are shown in TY liquid medium.

[0036] Figure 3 This is a comparative image showing the nodulation of *Senecio scandens* after 48 days of inoculation with different bacterial strains in a double-layered pot with added low-nitrogen nutrient solution, as described in Example 3. In the image, A represents the root nodule phenotype; B represents the stem nodule phenotype; C represents the number of root nodules; and D represents the number of stem nodules.

[0037] Figure 4 This is a comparison of the growth of different strains of *Senecio scandens* in a double-layered pot with added low-nitrogen nutrient solution for 48 days, as shown in Example 3.

[0038] Figure 5 This refers to the nitrogen fixation capacity of root nodules and stem nodules of *Senecio scandens* after 48 days of inoculation with different strains in a double-layered pot with added low-nitrogen nutrient solution, as described in Example 3. Wherein, A represents root nodule nitrogenase activity; B represents stem nodule nitrogenase activity. Detailed Implementation

[0039] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0040] As mentioned earlier, the nodulation gene cluster of Azorhizobium caulinodans ORS571 is 87.6kb in length, making cloning quite difficult. How to further improve the nodulation and nitrogen fixation capabilities of Azorhizobium caulinodans ORS571 is currently the technical challenge.

[0041] The nodU gene encodes carbamoyltransferase, whose nucleotide sequence is shown in SEQ ID NO.1, as follows:

[0042]

[0043] The amino acid sequence of the protein encoded by the nodU gene is shown in SEQ ID NO.2, as follows:

[0044] .

[0045] To investigate the function of the nodU gene, this invention constructed an expression cassette containing the nodU gene, the nucleotide sequence of which is shown in SEQ ID NO.3, as follows:

[0046]

[0047] This invention discovered that overexpressing a single nodU gene in the stem-nodulating rhizobium ORS571 can simultaneously enhance both its nodulation and nitrogen-fixing abilities. Inoculating legumes with ORS571 overexpressing the nodU gene for symbiosis significantly increased the number of nodules, improved nitrogen-fixing capacity, and promoted legume growth, thus leading to this invention.

[0048] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0049] Unless otherwise specified, the test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Among them:

[0050] The strain *Azorhizobium caulinodans* ORS571 has been disclosed in non-patent literature, specifically in the journal "Bioinformatics Analysis of Secreted Proteins from the Genome of *Azorhizobium caulinodans* ORS571," *Genomics and Applied Biology*, 2012, Vol. 31, No. 4, pp. 394-400. This strain is available to the public from the applicant for replication of this invention for 20 years from the date of application.

[0051] Escherichia coli DH5α was purchased from TransGen Biotech.

[0052] TY medium (solid medium with an additional 15 g / L agar powder): tryptone 5 g / L, yeast extract 3 g / L, anhydrous calcium chloride 0.6 g / L, pH = 7.0, sterilize at 121℃ for 20 min.

[0053] LB medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, agar powder 15 g / L. pH = 7.0, sterilize at 121℃ for 20 min.

[0054] Low-nitrogen nutrient solution for plants: ferric citrate 0.075 g / L, calcium nitrate 0.03 g / L, potassium chloride 0.075 g / L, magnesium sulfate 0.06 g / L, potassium hydrogen phosphate 0.136 g / L, calcium sulfate 0.46 g / L, and trace element mixture 1 mL / L (the trace element mixture consists of boric acid 2.86 g / L, manganese sulfate 1.81 g / L, copper sulfate pentahydrate 0.8 g / L, zinc sulfate 0.22 g / L, and molybdic acid 0.02 g / L); pH = 7.0, sterilized in a high-pressure steam oven at 121℃ for 20 min.

[0055] Unless otherwise specified in the embodiments of this invention, the experimental conditions and methods are generally as follows: such as J. Sambrook et al., eds., Molecular Cloning: A Laboratory Manual (3rd Edition), Science Press, 2002; DL Spector et al., eds., Cell Laboratory Manual, Science Press, 2001; or the conditions recommended by the manufacturer.

[0056] In the quantitative experiments described in this example, each experiment was repeated three times. GraphPad Prism 8 statistical software was used to process the data. Experimental results are presented as mean ± standard deviation in line and bar charts. The Student's test was used to detect whether there were differences between samples and whether these differences were significant. * indicates a significant difference (p < 0.05), and this is indicated above the bar chart.

[0057] Example 1: Construction of recombinant rhizobia overexpressing the nodU gene

[0058] The genome of *O. 571*, a nitrogen-fixing rhizobium in stem nodules, was extracted using the Tiangen Bacterial Genome Extraction Kit (extraction method as per the included instructions). The concentration of the extracted sample was determined using a Nanodrop 2000 (100-300 ng / μL is recommended), and the sample was stored at -20℃ for later use. Using the extracted genomic DNA as a template, the target gene was amplified using primers nodU-HB-F and nodU-HB-R, respectively. The amplified fragments were confirmed to be of the designed length by 1% agarose gel electrophoresis.

[0059] nodU-HB-F:CCAAGCTTCAGAGTCTAACGGTCGTCGA;

[0060] nodU-HB-R:GCTCTAGAGCATCGTTAAGCGCCGCATACC.

[0061] The amplified gene fragment was purified into a specific amplified band using a PCR product purification kit, and the target fragment nodU was recovered by gel extraction. Plasmid pBBR1MCS-2 was extracted using a plasmid mini-extraction kit. The obtained plasmid pBBR1MCS-2 was double-digested with XbaI and HindIII, then cleaned and recovered to obtain a linear vector with sticky ends. The target fragment nodU was also double-digested using the same method to obtain the target fragment with sticky ends. The digested pBBR1MCS-2 plasmid and nodU fragment were ligated overnight at 16°C using Thermofisher Scientific T4 DNA ligase. The ligated system was introduced into DH5α E. coli competent cells, diluted, and plated onto LB agar plates containing kanamycin and ampicillin. The plates were incubated at 37°C for 24 h, and positive recombinants were screened. Positive plaques were picked and inoculated into test tubes, and cultured at 37°C for 24 hours. Plasmids were extracted using a plasmid mini-extraction kit, and after double digestion with XbaⅠ and HindⅢ, agarose gel electrophoresis was performed to confirm the successful construction of the recombinant plasmid pBBR1MCS-2-nodU.

[0062] Agarose gel electrophoresis results are as follows Figure 1 As shown, the results indicate that the nodU gene sequence has been successfully ligated into the vector pBBR1MCS-2, and the recombinant plasmid has been successfully constructed.

[0063] Recipient bacteria (wild-type ORS571 strain), donor bacteria (DH5α containing the pBBR1MCS-2-nodU recombinant strain), and helper bacteria (DH5α containing the pRK2013 plasmid) were cultured separately to obtain bacterial suspensions. The bacterial cells were collected by centrifugation at 5000 rpm for 3 min, washed twice with antibiotic-free TY medium, and finally resuspended in 1 mL of antibiotic-free TY medium. 300 μL of donor bacteria, 200 μL of helper bacteria, and 100 μL of recipient bacteria were mixed thoroughly and suspended in the center of a TY plate. After drying, the plates were incubated at 37°C for 2 days. The cultured bacterial cells were scraped off with a sterile pipette tip and resuspended in 1 mL of sterile water, diluted to a final concentration of 10. -3 The bacterial suspension was obtained by diluting the amount of bacteria, and 100 μL was spread onto TY solid medium containing ampicillin (100 μg / mL) and kanamycin (50 μg / mL), and incubated at 37°C for 2 days.

[0064] The obtained single colonies were cultured in liquid TY medium containing ampicillin (100 μg / mL) and kanamycin (50 μg / mL) at 37°C with shaking at 180 rpm for 24 h. Plasmids were extracted using a plasmid mini-extraction kit, digested with XbaI and HindIII, and then subjected to agarose gel electrophoresis to confirm the successful construction of recombinant rhizobium (OEnodU) overexpressing the nodU gene. The verified positive strain, OEnodU, was stored at -80°C in glycerol for later use.

[0065] Example 2: Determination of the growth curve of rhizobia in TY liquid medium.

[0066] Wild-type rhizobium WT (ORS571) and the overexpressing rhizobium OEnodU constructed in Example 1 were inoculated into test tubes containing 5 mL of TY medium and cultured at 37°C and 180 rpm for 24 h. The OD values ​​of each strain were then calculated. 600 Adjust the concentration to 0.6, and take 500 μL of each culture medium to be inoculated into Erlenmeyer flasks containing 50 mL of TY medium. Incubate at 37 °C and 180 rpm. Measure the OD at 600 nm every 4 h. After 48 h, plot the growth curve.

[0067] The results are as follows Figure 2 As shown, the growth curves of the overexpressing strain OEnodU showed no difference compared to the wild-type rhizobium WT (i.e., the difference was not significant, ns). This indicates that the recombinant rhizobium overexpressing the nodU gene did not cause growth inhibition in TY medium compared to the wild-type rhizobium, thus ruling out the influence of the recombinant plasmid on the growth rate of the strain.

[0068] Example 3: Symbiotic Experiment between Rhizobium and Leguminosae

[0069] 1. Experimental Method:

[0070] Seed disinfection: Select sesbania seeds of similar size and weight and place them in a 50mL sterile Erlenmeyer flask. Soak the seeds in 98% concentrated sulfuric acid for 10 minutes to soften the seed coat, and then rinse off the sulfuric acid with plenty of sterile water. Next, soak the seeds in 3% sodium hypochlorite solution for 5 minutes and then in 75% ethanol for 5 minutes to disinfect the seed surface. Finally, wash the seeds three times with sterile water and place them on sterile moist filter paper to germinate for 2 days.

[0071] Co-culture: Wild-type rhizobium WT (ORS571) and overexpressing rhizobium OEnodU were inoculated into test tubes containing 5 mL of TY medium and cultured at 37°C and 180 rpm for 24 h. After centrifugation, the OD600 of each strain was adjusted to 0.6, and 500 μL of each strain was inoculated into Erlenmeyer flasks containing 50 mL of TY medium and cultured at 37°C and 180 rpm for 24 h. After centrifugation at 5000 rpm for 5 min, the cultures were resuspended in sterile water to OD600.600 =0.6% bacterial solution. Thirty seedlings of uniform growth were selected and placed in each bacterial solution, soaking for 3 hours at 25℃; seedlings soaked in sterile water served as the control group. After soaking, the seedlings were planted in double-layered pots filled with sterilized vermiculite and low-nitrogen nutrient solution, one seedling per pot, with 10 replicates per treatment. Twenty days after planting, the same bacterial solution as the initial soaking was applied to the stems of the plants. Observations and photographs were taken 48 days after planting, and the number of root nodules and stem nodules was counted. The nitrogenase activity of root nodules and stem nodules formed by the symbiosis of wild-type WT and overexpressing rhizobium OEnodU with sesquiterpenoids was determined using the acetylene reduction method (ARA). The determination method is as follows:

[0072] Twenty root nodules and 20 stem nodules were collected from plants inoculated with different strains, weighed, and placed in 20 mL sterile glass bottles. The bottles were sealed with rubber stoppers and sealing film. 10% (v / v) of air was extracted using a syringe, followed by the injection of 10% (v / v) of high-purity acetylene gas. The mixture was then incubated at 37°C for 24 h. One mL of the mixed gas was extracted from the sealed bottle using a sampler, and the gas components were determined using a gas chromatograph. Three replicates were set up for each strain, with sterile injection of acetylene gas as a negative control. One mL of acetylene gas was injected to determine the position of the acetylene peak, and one mL of pure ethylene was injected to determine the amount of ethylene peak. Nitrogenase activity was calculated as the amount of ethylene produced per unit time.

[0073] Nitrogenase activity calculation formula: ARA = Asa × (Vt / Vs) / (Ast / H / P); where ARA represents nitrogenase activity, in μmol·h⁻¹ -1 ·g -1 Asa represents the peak area of ​​ethylene, in cm². 2 Vt is the gas volume in the vial, in mL; Vs is the injection volume, in mL; Ast is the peak area of ​​standard ethylene at 1 nmol, in cm². 2 H represents the reaction time in hours (h); P represents the protein content in grams (g).

[0074] 2. Experimental Results:

[0075] Both wild-type rhizobium WT and overexpressing rhizobium OEnodU can induce root and stem nodules in Sesbania pubescens, but compared with wild-type rhizobium WT, overexpressing rhizobium OEnodU significantly increases the number of root and stem nodules. Figure 3 ), and further promoted the growth of the plant ( Figure 4 ).

[0076] The symbiotic relationship between the overexpressing strain OEnodU and Sesbania pubescens exhibits excellent nitrogen fixation capacity, with nitrogenase activity significantly higher than that of root nodules and stem nodules formed by the wild-type strain WT (ORS571) and Sesbania pubescens. The nitrogen fixation efficiency of the root nodules is 20.48 μmol·h⁻¹.-1 ·g -1 It represents a 29.27% ​​improvement over ORS571; the nitrogen fixation efficiency of the stem nodules reaches as high as 24.77 μmol·h⁻¹. -1 ·g -1 It is 31.92% better than ORS571. Figure 5 ).

[0077] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. An overexpression nodU Recombinant rhizobia with genes, characterized in that, It is prepared by the following method: The one shown in SEQ ID NO.3 contains nodU The gene expression cassette was ligated into the pBBR1MCS-2 plasmid to construct the recombinant plasmid pBBR1MCS-2. nodU ; The recombinant plasmid pBBR1MCS-2- nodU The expression was introduced into *Oryza sativa* ORS571, and an overexpression was obtained. nodU Recombinant rhizobia.

2. The overexpression as described in claim 1 nodU The application of recombinant rhizobia in promoting plant nodulation and growth is characterized by, The plant in question is sesquiterpene.

3. A method for promoting nodulation and growth of Sesbania pubescens under low-nitrogen conditions, characterized in that, Includes the following steps: The overexpression described in claim 1 nodU After soaking germinating Sesbania pubescens seeds in a recombinant rhizobium inoculum for 3 hours, the seeds were transferred to sterilized vermiculite mixed with low-nitrogen nutrient solution and cultured at 25°C under a 12h:12h photoperiod to promote nodulation and growth of Sesbania pubescens.

Images