SgRNA and CRISPR / Cas9 gene editing system targeting hoxB5-like gene of Japanese prawn and application thereof

Abstract

The application discloses a kind of SgRNA and CRISPR / Cas9 gene editing system of targeting Japanese prawn hoxB5- like SgRNA of targeting Japanese prawn hoxB5- The sequence of the SgRNA of the gene is shown as SEQ ID No.1-SEQ ID No.4.The SgRNA and the Cas9 protein are jointly injected into the fertilized eggs of the Japanese prawn according to the application, the gene knockout is realized like hoxB5- like The mutant with limb development defect is obtained, the mutant trait is obvious, the effect is remarkable, and the gene editing technology is marked with a new breakthrough in the Japanese prawn.The technical scheme of the application has important reference significance for the application of the gene editing technology in crustaceans.

Description

Technical Field

[0001] This invention belongs to the field of gene editing technology, specifically relating to a method for targeting Japanese shrimp. hoxB5-like SgRNA and CRISPR / Cas9 gene editing systems and their applications. Background Technology

[0002] Japanese shrimp ( Marsupenaeus japonicus Originally known as the Japanese prawn, it belongs to the order Decapoda, family Penaeidae, and genus Penaeus. It is one of the main farmed shrimp species in China. Japanese prawns are fast-growing, tolerant of both dry and hot conditions, have vibrant colors, and high economic value, making them popular in the aquatic product market and among farmers. They are farmed in various provinces and cities from southern to northern my country, forming a considerable scale. Therefore, breeding superior varieties is of great significance to the Japanese prawn farming industry.

[0003] Traditional breeding methods rely on phenotypic selection, which has disadvantages such as long cycles and instability. Currently, shrimp breeding technology in my country has evolved from traditional selection breeding and hybridization breeding to precision design breeding technologies such as sex-controlled breeding, molecular marker-assisted selection breeding, whole-genome selection breeding, and molecular design breeding. These technologies have driven the formation and vigorous development of my country's aquatic seed industry. However, cutting-edge breeding technologies are not widely applied in practice, and some technologies remain at the laboratory stage. CRISPR / Cas9 gene editing technology can delete or insert DNA sequences at the DNA level. Currently, this technology has been applied in the genetic breeding of crops and some aquatic animals, but research on decapods such as shrimp and crabs is relatively lacking. Establishing and implementing CRISPR / Cas9 gene editing technology in Japanese shrimp will, on the one hand, contribute to the study of Japanese shrimp gene function, and on the other hand, provide important technical support for precision shrimp breeding, laying the foundation for the cultivation of superior Japanese shrimp breeds. Summary of the Invention

[0004] The purpose of this invention is to provide a targeted method for treating Japanese shrimp. hoxB5-like SgRNA and CRISPR / Cas9 gene editing systems and their applications, wherein the SgRNA can target Japanese shrimp hoxB5-like Genes, and thus achieve hoxB5-like Gene knockout resulted in mutants with limb developmental defects.

[0005] To achieve the above-mentioned objectives, the present invention employs the following technical solution: This invention provides a targeted method for treating Japanese shrimp. hoxB5-like The SgRNA of the gene, the sequence of which is shown in SEQ ID No. 1 to SEQ ID No. 4.

[0006] The present invention provides amplification primers for the SgRNA, the sequences of which are shown in SEQ ID No. 5 to SEQ ID No. 9.

[0007] This invention provides a CRISPR / Cas9 gene editing system, which includes the Cas9 protein and the SgRNA.

[0008] The present invention provides a vector comprising the SgRNA described above.

[0009] This invention provides the application of the CRISPR / Cas9 gene editing system in editing the DNA of Japanese shrimp.

[0010] Furthermore, the method of application is as follows: injecting a mixture of Cas9 protein and the SgRNA into fertilized eggs of Japanese shrimp, culturing to obtain mutants, and determining the mutation type by PCR amplification, TA cloning, and sequencing.

[0011] Furthermore, the mass ratio of the SgRNA to the Cas9 protein is 1:1 to 2.

[0012] Furthermore, the concentration of the SgRNA is 100 ng / μL to 150 ng / μL; the concentration of the Cas9 protein is 200 ng / μL to 250 ng / μL.

[0013] This invention provides the application of the described SgRNA or the described CRISPR / Cas9 gene editing system in the construction of Japanese shrimp mutants.

[0014] This invention provides the application of the described SgRNA or the described CRISPR / Cas9 gene editing system in the breeding of superior Japanese shrimp.

[0015] Compared with the prior art, the advantages and technical effects of the present invention are: the present invention is specifically designed for Japanese shrimp. hoxB5- like Gene design knockout of target sites resulted in the acquisition of genes capable of targeting Japanese shrimp. hoxB5-like This invention utilizes CRISPR / Cas9 technology to perform single-gene multi-target mixed injection in Japanese shrimp, achieving the desired SgRNA expression. hoxB5-like Gene knockout resulted in a mutant with limb developmental defects, exhibiting distinct and significant traits, marking a new breakthrough in gene editing technology for Japanese shrimp. The technical solution of this invention provides important reference for the application of gene editing technology in crustaceans. Attached Figure Description

[0016] Figure 1 It is Japanese shrimp hoxB5-like Schematic diagram of gene target sites; Figure 2 yes hoxB5-like A summary of mutation types at various target sites after gene mutation; Figure 3 It is a target hoxB5-like The Japanese shrimp with gene mutations exhibit abnormal limb development. Detailed Implementation

[0017] The technical solution of the present invention will be further described in detail with reference to the following specific examples.

[0018] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods, and the materials and reagents used can be purchased from biological or chemical reagent companies.

[0019] Example 1 1. Experimental materials The Japanese white shrimp broodstock used in this invention were obtained from the Rizhao Municipal Institute of Oceanography and Fisheries, aged 280 days and weighing approximately 220g. Rearing conditions: natural seawater, 18℃, temporary rearing for 10 days, continuous aeration, daily feeding with sterilized sandworms, and water changes and cleaning.

[0020] 2. Targeted hoxB5-like Design and synthesis of SgRNA in genes This invention selects genes related to the control of limb development in Japanese shrimp. hoxB5-like Multi-target editing of target genes, hoxB5-like The gene has three exons. This invention designs four target sites on exon 1 (three on the antisense strand and one on the sense strand). Figure 1 As shown, the specific operation steps are as follows: Design using sgRNA target prediction (http: / / www.crisprscan.org / ?page=sequence) hoxB5-like The four SgRNAs: SgRNA 1: GTAGTCTGTGTTCACACCACTGG (SEQ ID No. 1); SgRNA 2: GTGACTTCGGCGTCGGCGGGAGG (SEQ ID No. 2); SgRNA 3: GAGGCGGAGGAGGAGGCCTGCGG (SEQ ID No. 3); SgRNA 4: GGGGCGGCAGCAGCAACTCCGG (SEQ ID No. 4).

[0021] Amplification primers were designed based on the pT7-gRNA plasmid sequence and target site. The primer sequences are as follows: F1: TGtaatacgactcactataGGAGTCTGTGTTCACACCACgttttagagctagaa (SEQ IDNo.5); F2: TGtaatacgactcactataGGGACTTCGGCGTCGGCGGGgttttagagctagaa (SEQ IDNo. ​​6); F3:TGtaatacgactcactataGGGGCGGAGGAGGAGGCCTGgttttagagctagaa (SEQ IDNo.7); F4: TGtaatacgactcactataGGGGCCGGCAGCAGCAACTCgttttagagctagaa (SEQ IDNo.8); R1: AAAAAAAGCACCGACTCGGTGCCAC (SEQ ID No. 9).

[0022] Using pT7-gRNA plasmid as a template, amplification was performed according to the following system (Table 1): Table 1. PCR amplification system using pT7-gRNA plasmid as template

[0023] The amplification conditions were: 98℃ for 3 min; (94℃, 30 s; 55℃, 30 s; 68℃, 20 s) × 30 cycles; 68℃ for 7 min. The obtained PCR product was purified, recovered, and stored at -20℃.

[0024] The PCR product obtained in the previous step was used as a template for in vitro transcription using the T7 in vitro transcription kit. The specific transcription system is as follows (Table 2): Table 2 Transcription System

[0025] SgRNA was obtained by incubation at 37°C for 4 hours and purification using the RNeasy Mini kit.

[0026] 3. Microinjection sample preparation The concentration and quality of the purified SgRNA were measured using a Nanodrop microspectrophotometer and 1.5% agarose gel electrophoresis, respectively. The four types of SgRNA were diluted to 100 ng / μL and mixed in equal volumes for later use. Commercially available Cas9 protein (Invitrogen) was diluted with enzyme-free water to 200 ng / μL for later use. The mixed SgRNA and diluted Cas9 protein were then formulated into injection samples at a 1:1 volume ratio.

[0027] 4. Processing of Japanese shrimp broodstock Select female shrimp with well-developed ovaries, remove one eye stalk, disinfect, and then raise them at 18℃ with continuous aeration. Feed them with disinfected sandworms at 4 pm every day.

[0028] 5. Microinjection of one-celled embryos in Japanese shrimp The day before injection, a groove was made using a mold and 1.5% agarose, and then cooled for later use. Seawater with a salinity of 30‰ was prepared and filtered through a 0.22μm filter membrane for sterilization.

[0029] Acquisition of single-celled fertilized eggs from Japanese shrimp: Multiple personnel worked in shifts, conducting real-time monitoring of broodstock Japanese shrimp from 7:00 PM to 2:00 AM to collect freshly laid fertilized eggs. As soon as spawning began, the eggs were immediately filtered through a 200-mesh sieve to obtain the fertilized eggs. Under a stereomicroscope, the fertilized eggs were gently arranged in agarose grooves filled with sterile seawater. Each fertilized egg was injected using a pneumatic pipette pump. After injection, the embryos were left to stand for 2 hours, then cultured in aerated seawater at a salinity of 30‰ at 22˚C. Dead embryos were removed at any time.

[0030] 6. Detect mutations in the injected samples. Forty-eight hours after injection, 60 embryos were collected, and genomic DNA was extracted using the "Animal Tissue Genome Extraction Kit" from Kangwei Century Company. Primers flanking the target site were designed, and their sequences are shown in Table 3. Table 3. Detection primers for each target site

[0031] PCR was performed using genomic DNA as a template. The PCR reaction system is shown in Table 4: Table 4. PCR reaction system using genomic DNA as a template

[0032] The amplification conditions were: 95℃ for 3 min; (95℃, 30 s; 55℃, 30 s; 72℃, 20 s) × 30 cycles; 72℃ for 7 min. The obtained PCR products were purified and recovered using a gel extraction kit (QIAGEN) after 1.5% agarose gel electrophoresis. The DNA fragments were ligated into the pmd-18T vector for TA cloning. The ligated PCR products were transformed into DH5α competent cells. After 12 h, single clones were picked and cultured at 37℃ and 180 rpm for 2 h. After PCR identification of the single clones, a certain number of positive clones for each target site were selected for sequencing (Sangon Biotech Shanghai Co., Ltd.).

[0033] The mutation type of each target was identified using BLAST software, and the identification results are as follows: Figure 2 As shown. The overall mutation efficiency is 24.32%, and the overall mutation efficiency = 1 - (1 - E1) × (1 - E2) × (1 - E3) × (1 - E4). Where E represents the mutation efficiency of a single target site = number of detected mutated clones / total number of successfully sequenced clones, E1 = 8%, E2 = 6.4%, E3 = 6%, E4 = 6.52%.

[0034] 7. Phenotypic observation of the embryos after injection. Every morning, the survival and development of the injected embryos are observed under a stereoscope, and photographs are taken. The results are as follows: Figure 3 As shown, Figure 3 WT represents wild-type individuals; hoxB5-like represent hoxB5-like Gene knockout individuals prove that... hoxB5-like Gene knockout yields mutants with limb developmental defects, and these mutants exhibit distinct traits.

[0035] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A targeted method for Japanese shrimp hoxB5-like The SgRNA combination of genes is characterized by, The SgRNA combination consists of the SgRNAs shown in SEQ ID No. 1 to SEQ ID No.

4.

2. The amplification primers for the SgRNA combination as described in claim 1, characterized in that, The amplification primers consist of SEQ ID No. 5 to SEQ ID No.

9.

3. A CRISPR / Cas9 gene editing system, characterized in that, It includes the Cas9 protein and the SgRNA combination as described in claim 1.

4. The application of the CRISPR / Cas9 gene editing system according to claim 3 in editing the DNA of Japanese shrimp, characterized in that, The method of application is as follows: injecting a mixture of Cas9 protein and the SgRNA combination described in claim 1 into the fertilized eggs of Japanese shrimp, and culturing to obtain mutants, and determining the mutation type by PCR amplification, TA cloning and sequencing; the mass ratio of the SgRNA combination to Cas9 protein is 1:1~2.

5. The application according to claim 4, characterized in that, The concentration of the SgRNA combination is 100 ng / μL to 150 ng / μL; the concentration of the Cas9 protein is 200 ng / μL to 250 ng / μL.

6. The application of the SgRNA combination of claim 1 or the CRISPR / Cas9 gene editing system of claim 3 in the construction of Japanese shrimp mutants.

Images