An excipient for delivering exogenous plasmid DNA and preparation and use thereof

Abstract

The present application relates to the technical field of nucleic acid delivery, in particular to an excipient for delivering exogenous plasmid DNA and preparation and application thereof. The excipient is a liquid mixture or a lyophilized product of the liquid mixture, the liquid mixture comprising an amino acid substance and a buffer, wherein the effective delivery concentration of the amino acid substance is above 3 mmol / L when delivering the exogenous plasmid DNA. The present application mixes the excipient with the exogenous plasmid DNA to obtain an exogenous plasmid DNA preparation, wherein the effective delivery concentration of the amino acid substance in the exogenous plasmid DNA preparation is above 3 mmol / L, and the effective delivery concentration of the exogenous plasmid DNA is above 0.05 ug / uL. The exogenous plasmid DNA preparation provided by the present application can achieve the purpose of more efficient, more extensive and longer time course delivery of exogenous plasmid DNA to muscle and skin tissues in multiple species, and can increase the transfection range, improve the protein expression amount of the target gene and enhance the immune response. The tumor vaccine and infectious disease vaccine with better immune effect can be developed, and have clinical value.

Description

Technical Field

[0001] This invention relates to the field of nucleic acid delivery technology, specifically an excipient for delivering exogenous plasmid DNA and its application. Background Technology

[0002] Since Wolff et al. reported in 1990 that naked plasmids could be directly injected intramuscularly to transfect muscle cells and express exogenous genes, it has been found that direct injection of exogenous plasmid DNA into certain tissues or organs of animals can achieve low levels of gene expression. These tissues and organs mainly include muscle tissue, skin tissue, and liver. However, this method of directly injecting exogenous nucleic acids is considered inefficient, as both the number of transfected cells and the level of exogenous gene expression in the transfected cells are too low to meet the threshold for application. For example, it cannot elicit an effective immune response or repair genetic defects in the organism. Therefore, existing in vivo transfection technologies targeting plasmid DNA rely on further assistance from physical and biochemical methods to deliver exogenous nucleic acids.

[0003] Physical methods refer to creating momentary pores on the cell membrane surface by applying external forces such as sound, light, electricity, and heat to facilitate the delivery of exogenous nucleic acids. Therefore, physical methods often require additional equipment to treat the muscle when assisting in exogenous nucleic acid delivery, such as electroporation and ultrasound. However, existing physical methods typically suffer from high operating costs, poor patient compliance, and the potential to cause local tissue damage.

[0004] Biochemical methods refer to the use of bioactive materials or molecules to form nanoparticles with exogenous nucleic acids, thereby enhancing exogenous nucleic acid uptake and lysosomal escape, and thus assisting in exogenous nucleic acid delivery. However, existing biochemical methods typically suffer from high tissue toxicity, high cost, poor targeting, and poor stability. Furthermore, both existing physical and biochemical methods exhibit relatively low delivery efficiency to some extent. Summary of the Invention

[0005] Problems with existing technologies: Existing technologies have the problem that after plasmid DNA encoding the target gene sequence is delivered into an organism, the transfection range within the organism is small and the expression level of the target gene is low.

[0006] To address the problems existing in the prior art, the present invention provides an excipient for delivering exogenous plasmid DNA, its preparation, and its application.

[0007] Specifically, the present invention provides the following technical solution:

[0008] In a first aspect, there is an excipient for delivering exogenous plasmid DNA, which is a liquid mixture or a lyophilized form of a liquid mixture, said liquid mixture comprising amino acid substances and buffer solutions.

[0009] Preferably, when delivering exogenous plasmid DNA, the effective delivery concentration of amino acid substances is 3 mmol / L or higher.

[0010] Preferably, the effective delivery concentration of the amino acid substance is 3-300 mmol / L; more preferably, the effective delivery concentration of the amino acid substance is 10-300 mmol / L; more preferably, the effective delivery concentration of the amino acid substance is 100-300 mmol / L.

[0011] Preferably, the delivery method is intramuscular injection or subcutaneous injection.

[0012] Preferably, when the delivery method is intramuscular injection, the amino acid substance includes one or more substances selected from the group consisting of glycine, γ-aminobutyric acid, L-histidine, histamine, L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine, L-isoleucine, tetrahydropyrimidine, homoserine, and polyglutamic acid.

[0013] More preferably, the amino acid substance includes one or more substances selected from the group consisting of L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine, L-isoleucine, tetrahydropyrimidine, homoserine, and polyglutamic acid.

[0014] Preferably, when the delivery method is intramuscular injection, the amino acid substance includes one or more substances selected from the group consisting of L-leucine, D-histidine, L-alanine, L-glutamic acid, tetrahydropyrimidine, homoserine, and polyglutamic acid.

[0015] More preferably, when the delivery method is intramuscular injection, the amino acid substance is selected from one or more substances in the group consisting of L-leucine, D-histidine, L-alanine, L-glutamic acid, tetrahydropyrimidine, homoserine and polyglutamic acid.

[0016] Preferably, when the delivery method is intramuscular injection, the amino acid substance is selected from two substances in the group consisting of L-leucine, D-histidine, L-alanine, L-glutamic acid, tetrahydropyrimidine, homoserine, and polyglutamic acid.

[0017] More preferably, when the delivery method is intramuscular injection, the ratio of the effective delivery concentrations of the two substances constituting the amino acid substance is 1-5:1-5, and more preferably, the ratio of the effective delivery concentrations is 1-2:1-2.

[0018] Preferably, when the delivery method is intramuscular injection, the amino acid is a combination of L-glutamic acid and tetrahydropyrimidine.

[0019] When delivered via intramuscular injection, the amino acid is a combination of L-glutamic acid and L-leucine.

[0020] Preferably, when the delivery method is subdermal injection, the amino acid substance includes one or more substances selected from the group consisting of L-proline, L-valine, L-lysine, homoserine, L-serine, glycine, D-histidine, L-leucine, L-glutamic acid, L-glutamine, tetrahydropyrimidine, and polyglutamic acid.

[0021] More preferably, the amino acid substances include one or more substances selected from the group consisting of D-histidine, L-leucine, L-glutamic acid, L-glutamine, tetrahydropyrimidine, homoserine, and polyglutamic acid.

[0022] Most preferably, when the delivery method is skin injection, the amino acid substance is selected from one or more substances in the group consisting of D-histidine, L-leucine, L-glutamic acid, L-glutamine, tetrahydropyrimidine, homoserine and polyglutamic acid.

[0023] Preferably, when the delivery method is subdermal injection, the amino acid substance is selected from two substances in the group consisting of D-histidine, L-leucine, L-glutamic acid, L-glutamine, tetrahydropyrimidine, homoserine, and polyglutamic acid.

[0024] More preferably, when the delivery method is skin injection, the ratio of the effective delivery concentrations of the two substances constituting the amino acid substance is 1-5:1-5, based on the effective delivery concentration of the amino acid substance. More preferably, the ratio of the effective delivery concentrations is 1-2:1-2.

[0025] Preferably, the excipient has the function of expanding the transfection range of exogenous plasmid DNA encoding the target gene in vivo and increasing the expression level of the target gene.

[0026] Preferably, the buffer solution is an isotonic buffer solution, and more preferably, the isotonic buffer solution is PBS or physiological saline.

[0027] In a second aspect, the present invention provides a method for preparing a product containing the excipients described above, comprising the following steps: mixing components including amino acids and buffer solutions to obtain a liquid mixture, or lyophilizing the liquid mixture to obtain a lyophilized liquid mixture.

[0028] Thirdly, the present invention provides the application of the excipients described above or the excipients prepared by the preparation method described above in the preparation of exogenous plasmid DNA formulations.

[0029] Fourthly, the present invention provides an exogenous plasmid DNA preparation containing the excipient or the excipient prepared by the preparation method described above, and exogenous plasmid DNA, wherein the amino acid substance in the exogenous plasmid DNA preparation is used to deliver the exogenous plasmid DNA, and wherein the effective delivery concentration of the amino acid substance is 3 mmol or more.

[0030] Preferably, in the exogenous plasmid DNA preparation, the effective delivery concentration of the exogenous plasmid DNA is 0.05 ug / uL or higher; more preferably, the effective delivery concentration of the exogenous plasmid DNA is 0.05-5 ug / uL; and more preferably, the effective delivery concentration of the exogenous plasmid DNA is 0.05-1 ug / uL.

[0031] And / or in the exogenous plasmid DNA preparation, the effective delivery concentration of amino acid substances is 3 mmol / L or higher, preferably 3-300 mmol / L, more preferably 10-300 mmol / L, and most preferably 100-300 mmol / L.

[0032] Preferably, the exogenous plasmid DNA is exogenous plasmid DNA encoding the target gene sequence; more preferably, the target gene is the gene sequence of a functional protein.

[0033] Preferably, the functional protein includes one or more substances selected from the group consisting of ovalbumin, fluorescent protein, luciferase, cytokines, nanobodies, monoclonal antibodies and recombinant antibodies.

[0034] Preferably, the exogenous DNA is pVAX-luci-tdT plasmid DNA or pVAX-Ova plasmid DNA. More preferably, the exogenous DNA is purified pVAX-luci-tdT plasmid DNA and / or purified pVAX-Ova plasmid DNA.

[0035] Fifthly, the present invention provides a method for preparing the exogenous plasmid DNA preparation, comprising the following steps: mixing a substance containing an excipient and exogenous plasmid DNA to obtain an exogenous plasmid DNA preparation, wherein, when the amino acid substance delivers the exogenous plasmid DNA, the effective delivery concentration of the amino acid substance is above 3 mmol / L, and the effective delivery concentration of the exogenous plasmid DNA is above 0.05 ug / uL.

[0036] Sixthly, the present invention provides the application of the exogenous plasmid DNA preparation described herein or the exogenous plasmid DNA preparation prepared by the aforementioned method in the preparation of vaccine products or non-vaccine pharmaceutical products.

[0037] In a seventh aspect, the present invention provides a vaccine product containing the exogenous plasmid DNA preparation described above or the exogenous plasmid DNA preparation prepared by the preparation method described above. Preferably, the vaccine product is an intramuscular injection type or a skin injection type.

[0038] In one aspect, the present invention provides a non-vaccine pharmaceutical product containing the exogenous plasmid DNA preparation described above or the exogenous plasmid DNA preparation prepared by the preparation method described above. Preferably, the non-vaccine pharmaceutical product is an intramuscular injection type or a skin injection type.

[0039] Beneficial effects of this invention:

[0040] (1) This invention uses a specific concentration of amino acid-based substances as excipients. After mixing the excipients with plasmid DNA encoding the target gene, the plasmid DNA is delivered to muscle / skin tissue via injection. Compared with not using excipients, this increases the transfection range of plasmid DNA. Increase the protein expression level of the target gene This enables the efficient, widespread, and long-term delivery of plasmid DNA encoding exogenous proteins into muscle / skin tissues.

[0041] (2) The exogenous plasmid DNA preparation containing excipients provided by the present invention has the characteristics of low cost, good reproducibility, and easy availability of raw materials. Furthermore, it does not require the use of additional electroporation equipment during injection, does not cause tissue damage or additional pain, and has better applicability compared to existing technologies.

[0042] (3) The exogenous plasmid DNA preparation containing excipients provided by the present invention can encode antigen proteins. After intramuscular or skin injection, it can generate an effective immune response against the encoded antigen proteins, thereby producing the effect of preventing or treating tumors. Attached Figure Description

[0043] Figure 1The graph shows the correlation statistics of in vivo imaging signal values, in vitro luciferase signal values, and relative expression levels of luciferase in mice that were injected intramuscularly with solutions of different concentrations of L-glutamate-plasmid DNA.

[0044] Figure 2 The relative expression levels of luciferase in the amino acid group, amino acid derivative group, polyglutamic acid group, saline group, and electroporation group relative to the PBS group are shown. Figure 2 The vertical axis represents the multiple of expression level relative to the PBS group, which is the multiple of relative luciferase expression level relative to the PBS group.

[0045] Figure 3 Immunofluorescence images of tibialis anterior muscle sections from mice in the amino acid group (where the amino acids are glycine, D-histidine, L-alanine, or L-glutamic acid), amino acid derivative group (where the amino acid derivatives are tetrahydropyrimidine or homoserine), polyglutamic acid group, PBS group, and electroporation group.

[0046] Figure 4 The values ​​represent the in vivo imaging signal values ​​of luciferase in mice on days 1, 3, 7, 11, 15, and 30 post-injection. The results showed that the L-glutamate group exhibited several times the protein expression level of the PBS group over a period of up to 30 days. Figure 5 This is a stereofluorescence microscopy image of the tibialis anterior muscle in mice 30 days after injection.

[0047] Figure 6 The number of myofilaments in a mouse anterior tibialis muscle section on day 30 after injection is a quantitative result of the number of myofilaments marked on the muscle section.

[0048] Figure 7 The quantitative results show the mean fluorescence intensity of mouse anterior tibialis muscle slices on day 30 after injection.

[0049] Figure 8 This is an immunoblot image of the anterior tibialis muscle tissue from a mouse.

[0050] Figure 9 This is a graph showing the detection results of the live imaging signal values.

[0051] Figure 10 The relative expression levels of luciferase in the amino acid group, amino acid derivative group, and polyglutamate group relative to the PBS group are shown as folds. Figure 10 The vertical axis represents the multiple of expression level relative to the PBS group, which is the multiple of relative luciferase expression level relative to the PBS group. Figure 11Immunofluorescence images of skin sections from mice in the amino acid group (containing glycine, tetrahydropyrimidine, L-glutamic acid, or L-glutamine), the amino acid derivative group (containing tetrahydropyrimidine), the polyglutamic acid group, and the PBS group.

[0052] Figure 12 The image shows the detection results of in vivo imaging signal values ​​in rats in the L-glutamate group, PBS group, and electroporation group.

[0053] Figure 13 Immunofluorescence images of tibialis anterior muscle sections from rats in the L-glutamate group, PBS group, and electroporation group.

[0054] Figure 14 Immunofluorescence images of rabbit tibialis anterior muscle sections from the L-glutamate group, tetrahydropyrimidine group, and PBS group.

[0055] Figure 15 The flowchart shows the collection of immune sequence samples, and the construction diagram of the pVax-Ova plasmid encoding the immunogen gene sequence (ovalbumin gene sequence), which is a schematic diagram of the ovalbumin DNA vaccine structure.

[0056] Figure 16 This image shows the number of IFN-γ-positive spleen cells in response to spike protein after intramuscular injection in mice immunized with pVAX-Ova, including the amino acid group (where the amino acid is L-glutamic acid, tetrahydropyrimidine, L-leucine, or D-histidine), the amino acid derivative group (where the amino acid derivative is tetrahydropyrimidine), the PBS group, the electroporation group, the control group, and the blank immunized mice. Figure 16 In this context, ovalbumin antigen stimulation is represented as pVAX-Ova immunization, and the unstimulated control is represented as blank immunization.

[0057] Figure 17 The number of IFN-γ-positive spleen cells in response to spike protein after intramuscular injection in mice immunized with pVAX-Ova was shown in the amino acid group (where the amino acid was L-glutamic acid, L-leucine, or D-histidine), the amino acid derivative group (where the amino acid derivative was tetrahydropyrimidine), the PBS group, and the electroporation group.

[0058] Figure 18 The table shows the titers of OVA-specific antibodies administered intramuscularly to mice in the following groups after pVAX-Ova immunization: amino acid group (where the amino acid is L-glutamic acid, L-leucine, or D-histidine), amino acid derivative group (where the amino acid derivative is tetrahydropyrimidine), PBS group, and electroporation group. Figure 18 In this context, the first dose refers to the first immunization, the second dose refers to the second immunization, and the third dose refers to the third immunization.

[0059] Figure 19 The figure shows the titer of OVA-specific antibodies after skin injection in mice in the L-glutamate and PBS groups. The vertical axis represents absorbance, and the horizontal axis represents the dilution factor.

[0060] Figure 20 The figure shows the OVA-specific antibody titers after skin injection in rats in the L-glutamate, tetrahydropyrimidine, and PBS groups.

[0061] Figure 21 The figure shows the results of OVA-specific antibody titers after intramuscular injection in rats in the L-glutamate group, electroporation group, and PBS group.

[0062] Figure 22 A flowchart of experimental procedures and sample collection for tumor immunoprophylaxis.

[0063] Figure 23 This is a graph comparing the survival rates of subcutaneously transplanted melanoma cells in mice with different amino acid groups (L-glutamic acid, L-leucine, or a combination of L-glutamic acid and L-leucine), PBS groups, and blank immunized mice within 90 days. Detailed Implementation

[0064] To better understand the above technical solutions, the technical solutions of the present invention will be clearly and completely explained below in conjunction with specific embodiments. It should be noted that the content of the specific embodiments is only a specific implementation and explanation of the technical solutions of the present invention, and should not be construed as a limitation on the scope of protection of the present invention.

[0065] (i) Regarding the excipients for delivering exogenous plasmid DNA provided by the present invention.

[0066] In some specific embodiments, the present invention provides an excipient for delivering exogenous plasmid DNA. The excipient is a liquid mixture or a lyophilized form of a liquid mixture, wherein the liquid mixture includes amino acids and a buffer solution, and the effective delivery concentration of the amino acids is 3 mmol / L or higher when delivering the exogenous plasmid DNA. The exogenous plasmid DNA is delivered via intramuscular or subcutaneous injection. When administered via intramuscular or subcutaneous injection, the excipient and exogenous plasmid DNA are mixed and injected to transfect muscle or skin tissue at the injection site, promoting the expression of the target gene and thus producing a therapeutic or immunomodulatory effect.

[0067] Preferably, the effective delivery concentration of the amino acid substance is 3-300 mmol / L; more preferably, the effective delivery concentration of the amino acid substance is 10-300 mmol / L; most preferably, the effective delivery concentration of the amino acid substance is 100-300 mmol / L.

[0068] Preferably, when the excipient is a liquid mixture, the liquid mixture comprises an amino acid compound and a buffer solution. The present invention does not limit the concentration of amino acids in the liquid mixture, as long as the effective delivery concentration of amino acids is 3 mmol / L or higher when delivering exogenous plasmid DNA; preferably, the effective delivery concentration of the amino acid compound is 3-300 mmol / L.

[0069] In other words, when the concentration of amino acids in the liquid mixture is high, solvents such as buffer solutions can be used to reduce the concentration of amino acids, thereby adjusting the effective delivery concentration of amino acids to 3-300 mmol / L when delivering exogenous plasmid DNA; when the concentration of amino acids in the liquid mixture is low, the lyophilized form of the liquid mixture or the amino acids themselves can be used to increase the concentration of amino acids, thereby adjusting the effective delivery concentration of amino acids to 3-300 mmol / L when delivering exogenous plasmid DNA.

[0070] It should be noted that the excipient of the present invention can be a liquid mixture of one amino acid substance or a liquid mixture of two or more amino acid substances. The effective delivery concentration ratio of the two or more amino acid substances is not particularly limited, as long as the total effective delivery concentration of the two or more amino acid substances is 3 mmol / L or more when delivering exogenous plasmid DNA.

[0071] In some specific embodiments, the present invention provides an excipient for delivering exogenous plasmid DNA, characterized in that it is a liquid mixture or a lyophilized liquid mixture, wherein the liquid mixture comprises an amino acid substance and a buffer solution, wherein the effective delivery concentration of the amino acid substance is above 3 mmol / L.

[0072] Preferably, in some specific embodiments, the effective delivery concentration of the amino acid substance is 100-300 mmol / L.

[0073] More preferably, in some specific embodiments, the effective delivery concentration of the amino acid-like substance may be 100 mmol / L, 101 mmol / L, 102 mmol / L, 103 mmol / L, 104 mmol / L, 105 mmol / L, 106 mmol / L, 107 mmol / L, 108 mmol / L, 109 mmol / L, 110 mmol / L, 111 mmol / L, 112 mmol / L, 113 mmol / L, 114 mmol / L, 115 mmol / L, 116 mmol / L, 117 mmol / L, 118 mmol / L, 119 mmol / L, 120 mmol / L, 121 mmol / L, etc. ol / L, 122mmol / L, 123mmol / L, 124mmol / L, 125mmol / L, 126mmol / L, 127mmol / L, 128mmol / L, 129mmol / L, 130mmol / L, 131mmol / L, 132mmol / L, 133mmol / L , 134mmol / L, 135mmol / L, 136mmol / L, 137mmol / L, 138mmol / L, 139mmol / L, 140mmol / L, 141mmol / L, 142mmol / L, 143mmol / L, 144mmol / L, 145mmol / L, 146 mmol / L, 147mmol / L, 148mmol / L, 149mmol / L, 150mmol / L, 151mmol / L, 152mmol / L, 153mmol / L, 154mmol / L, 155mmol / L, 156mmol / L, 157mmol / L, 158mmol / L, 159mmol / L, 160mmol / L, 161mmol / L, 162mmol / L, 163mmol / L, 164mmol / L, 165mmol / L, 166mmol / L, 167mmol / L, 168mmol / L, 169mmol / L, 170mmol / L, 1 71mmol / L, 172mmol / L, 173mmol / L, 174mmol / L, 175mmol / L, 176mmol / L, 177mmol / L, 178mmol / L, 179mmol / L, 180mmol / L, 181mmol / L, 182mmol / L, 183mm ol / L, 184mmol / L, 185mmol / L, 186mmol / L, 187mmol / L, 188mmol / L, 189mmol / L, 190mmol / L, 191mmol / L, 192mmol / L, 193mmol / L, 194mmol / L, 195mmol / L,196mmol / L、197mmol / L、198mmol / L、199mmol / L、200mmol / L、201mmol / L、20 2mmol / L、203mmol / L、204mmol / L、205mmol / L、206mmol / L、207mmol / L、208mm ol / L、209mmol / L、210mmol / L、211mmol / L、212mmol / L、213mmol / L、214mmol / L、215mmol / L、216mmol / L、217mmol / L、218mmol / L、219mmol / L、220mmol / L、 221mmol / L、222mmol / L、223mmol / L、224mmol / L、225mmol / L、226mmol / L、22 7mmol / L、228mmol / L、229mmol / L、230mmol / L、231mmol / L、232mmol / L、233mm ol / L、234mmol / L、235mmol / L、236mmol / L、237mmol / L、238mmol / L、239mmol / L、240mmol / L、241mmol / L、242mmol / L、243mmol / L、244mmol / L、245mmol / L、 246mmol / L、247mmol / L、248mmol / L、249mmol / L、250mmol / L、251mmol / L、25 2mmol / L、253mmol / L、254mmol / L、255mmol / L、256mmol / L、257mmol / L、258mm l / L、259mmol / L、260mmol / L、261mmol / L、262mmol / L、263mmol / L、264mmol / L、265mmol / L、266mmol / L、267mmol / L、268mmol / L、269mmol / L、270mmol / L、 271mmol / L、272mmol / L、273mmol / L、274mmol / L、275mmol / L、276mmol / L、27 7mmol / L、278mmol / L、279mmol / L、280mmol / L、281mmol / L、282mmol / L、283mm ol / L、284mmol / L、285mmol / L、286mmol / L、287mmol / L、288mmol / L、289mmol / L、290mmol / L、291mmol / L、292mmol / L、293mmol / L、294mmol / L、295mmol / L、Effective delivery concentrations of amino acids within the range of any two of the above specific values, ranging from 296 mmol / L, 297 mmol / L, 298 mmol / L, 299 mmol / L, or 300 mmol / L.

[0074] (II) Regarding the exogenous plasmid DNA preparation provided by the present invention.

[0075] In some specific embodiments, the present invention provides an exogenous plasmid DNA preparation containing the above-mentioned excipients, wherein the effective delivery concentration of amino acid substances in the excipients in the exogenous plasmid DNA preparation is 3 mmol / L or more, and the effective delivery concentration of exogenous plasmid DNA is 0.05 ug / uL or more.

[0076] Preferably, the effective delivery concentration of the exogenous plasmid DNA is 0.05-5 ug / uL.

[0077] More preferably, in some specific embodiments, the effective delivery concentration of the exogenous plasmid DNA may be 0.05 ug / uL, 0.06 ug / uL, 0.07 ug / uL, 0.08 ug / uL, 0.09 ug / uL, 0.1 ug / uL, 0.11 ug / uL, 0.12 ug / uL, 0.13 ug / uL, 0.14 ug / uL, 0.15 ug / uL, 0.16 ug / uL, 0.17 ug / uL, 0.18 ug / uL, 0.19 ug / uL, 0.2 ug / uL, 0.21 ug / uL, 0.22 ug / uL, 0.23 ug / uL, 0.24 ug / uL, 0.25 ug / uL, 0.26 ug / uL, etc. uL, 0.27ug / uL, 0.28ug / uL, 0.29ug / uL, 0.3ug / uL, 0.31ug / uL, 0.32ug / uL, 0.33ug / uL, 0.34ug / uL, 0.35ug / uL, 0.36ug / uL, 0.37ug / uL, 0.38ug / uL, 0. 39ug / uL, 0.4ug / uL, 0.41ug / uL, 0.42ug / uL, 0.43ug / uL, 0.44ug / uL, 0.45ug / uL, 0.46ug / uL, 0.47ug / uL, 0.48ug / uL, 0.49ug / uL, 0.5ug / uL, 0.51ug / uL ,0.52ug / uL, 0.53ug / uL, 0.54ug / uL, 0.55ug / uL, 0.56ug / uL, 0.57ug / uL, 0.58ug / uL, 0.59ug / uL, 0.6ug / uL, 0.61ug / uL, 0.62ug / uL, 0.63ug / uL, 0.64 ug / uL, 0.65ug / uL, 0.66ug / uL, 0.67ug / uL, 0.68ug / uL, 0.69ug / uL, 0.7ug / uL, 0.71ug / uL, 0.72ug / uL, 0.73ug / uL, 0.74ug / uL, 0.75ug / uL, 0.76ug / uL, 0.77ug / uL, 0.78ug / uL, 0.79ug / uL, 0.8ug / uL, 0.81ug / uL, 0.82ug / uL, 0.83ug / uL, 0.84ug / uL, 0.85ug / uL, 0.86ug / uL, 0.87ug / uL, 0.88ug / uL, 0.89ug / uL、0.9ug / uL、0.91ug / uL、0.92ug / uL、0.93ug / uL、0.94ug / uL、0.95ug / uL、0.96ug / uL、0.97ug / uL、0.98ug / uL、0.99ug / uL、1.00ug / uL、1.05ug / uL、1.1ug / uL, 1.15ug / uL, 1.2ug / uL, 1.25ug / uL, 1.3ug / uL, 1.35ug / uL, 1.4ug / uL, 1.45ug / uL, 1.5ug / uL, 1.55ug / uL, 1.6ug / uL, 1.65ug / uL, 1.7ug / uL, 1.75ug / uL, 1.8ug / uL, 1.85ug / uL, 1.9ug / uL, 1.95ug / uL, 2.00ug / uL, 2.05ug / uL, 2.1ug / uL, 2.15ug / uL, 2.2ug / uL, 2.25ug / uL, 2.3ug / uL, 2.35ug / uL, 2.4ug / uL, 2.45ug / uL, 2.5ug / uL, 2.55ug / uL, 2.6ug / uL, 2.65 ug / uL, 2.7ug / uL, 2.75ug / uL, 2.8ug / uL, 2.85ug / uL, 2.9ug / uL, 2.95ug / uL, 3.00ug / uL, 3.05ug / uL, 3.1ug / uL, 3.15ug / u L, 3.2ug / uL, 3.25ug / uL, 3.3ug / uL, 3.35ug / uL, 3.4ug / uL, 3.45ug / uL, 3.5ug / uL, 3.55ug / uL, 3.6ug / uL, 3.65ug / uL, 3. 7ug / uL, 3.75ug / uL, 3.8ug / uL, 3.85ug / uL, 3.9ug / uL, 3.95ug / uL, 3.00ug / uL, 4.05ug / uL, 4.1ug / uL, 4.15ug / uL, 4.2ug / The effective delivery concentrations of exogenous plasmid DNA are 4.25 μg / μL, 4.3 μg / μL, 4.35 μg / μL, 4.4 μg / μL, 4.45 μg / μL, 4.55 μg / μL, 4.6 μg / μL, 4.65 μg / μL, 4.7 μg / μL, 4.75 μg / μL, 4.8 μg / μL, 4.85 μg / μL, 4.9 μg / μL, 4.95 μg / μL, or 5.00 μg / μL, or concentrations falling within the range defined by any two of the above specific values ​​as endpoints.

[0078] Preferably, the exogenous DNA is pVAX-luci-tdT plasmid DNA or pVAX-Ova plasmid DNA. More preferably, the exogenous DNA is purified pVAX-luci-tdT plasmid DNA and / or purified pVAX-Ova plasmid DNA. It should be noted that the choice of plasmid DNA is not limited to the above: pVAX-luci-tdT plasmid DNA and / or pVAX-OVA plasmid. These two plasmids encoding gene sequences of specific functional proteins are only used to illustrate the specific usage and effects of the present invention. Injection can be performed using a syringe via intramuscular or intradermal injection, or using a needle-free injector. Preferably, the functional protein includes one or more substances selected from the group consisting of catalytic proteins, transport proteins, immune proteins, and regulatory proteins.

[0079] (III) Regarding the exogenous plasmid DNA preparation for intramuscular injection provided by the present invention.

[0080] In some specific embodiments, the present invention provides an intramuscularly injectable exogenous plasmid DNA formulation containing the aforementioned excipients and exogenous plasmid DNA, wherein the effective delivery concentration of the exogenous plasmid DNA in the exogenous plasmid DNA formulation is 0.05 μg / μL or higher, preferably 0.05-5 μg / μL, and more preferably 0.05-1 μg / μL.

[0081] And / or in the exogenous plasmid DNA preparation, the effective delivery concentration of amino acid substances is 3 mmol / L or higher, preferably 3-300 mmol / L, more preferably 10-300 mmol / L, and most preferably 100-300 mmol / L.

[0082] Specifically, when a liquid mixture containing the aforementioned effective delivery concentration of amino acid substances is used as an excipient for intramuscular injection, the expression level of the target gene in the exogenous plasmid DNA is greater than 0 and less than or equal to 60 times that of the exogenous plasmid DNA without excipients.

[0083] When administered intramuscularly with a liquid mixture containing an amino acid-based substance at the above-mentioned effective delivery concentration as an excipient, the number of cells successfully transfected in muscle tissue by the pVAX-luci-tdT plasmid DNA is 5-80 times that of the pVAX-luci-tdT plasmid DNA without an excipient, wherein the muscle tissue is mouse, rat, or rabbit muscle tissue.

[0084] Preferably, in some specific embodiments, the exogenous plasmid DNA is purified pVAX-luci-tdT plasmid DNA, which simultaneously encodes the luciferase gene sequence and the red fluorescent protein gene sequence.

[0085] Preferably, in some specific embodiments, the amino acid substance includes one or more substances selected from the group consisting of glycine, γ-aminobutyric acid, L-histidine, histamine, L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine, L-isoleucine, tetrahydropyrimidine, homoserine, and polyglutamic acid.

[0086] Preferably, in some specific embodiments, the amino acid substance includes one or more substances selected from the group consisting of L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine, L-isoleucine, tetrahydropyrimidine, homoserine, and polyglutamic acid.

[0087] More preferably, in some specific embodiments, the amino acid is one of L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine, L-isoleucine, tetrahydropyrimidine, homoserine, and polyglutamic acid.

[0088] Most preferably, in some specific embodiments, when intramuscular injection is performed using a liquid mixture containing L-glutamic acid at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 10 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 ug / uL.

[0089] When administered intramuscularly with / or using a liquid mixture containing L-proline at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 10 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL.

[0090] When administered intramuscularly with / or using a liquid mixture containing an effective delivery concentration of 100-300 mmol / L of L-threonine as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 10 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL.

[0091] When administered intramuscularly with a liquid mixture containing L-asparagine at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 10 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL.

[0092] When administered intramuscularly with / or using a liquid mixture containing D-histidine at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL.

[0093] When administered intramuscularly with / or using a liquid mixture containing L-serine at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 10 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL.

[0094] When administered intramuscularly with / or using a liquid mixture containing L-alanine at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL.

[0095] When administered intramuscularly with / or using a liquid mixture containing L-methionine at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL.

[0096] When administered intramuscularly with / or using a liquid mixture containing L-leucine at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL.

[0097] When administered intramuscularly with a liquid mixture containing D-alanine at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL.

[0098] When administered intramuscularly with a liquid mixture containing L-phenylalanine at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL.

[0099] When administered intramuscularly with / or using a liquid mixture containing L-valine at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL.

[0100] When administered intramuscularly with / or using a liquid mixture containing L-isoleucine at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL.

[0101] When administered intramuscularly with a liquid mixture containing tetrahydropyrimidine at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL.

[0102] When administered intramuscularly with a liquid mixture containing a high-serine content at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 30 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL.

[0103] When administered intramuscularly with a liquid mixture containing polyglutamic acid at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 50 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 ug / uL.

[0104] More preferably, in some specific embodiments, the amino acid is one or a combination of two of L-glutamic acid, L-leucine, and tetrahydropyrimidine.

[0105] Most preferably, in some specific embodiments, when a liquid mixture containing L-glutamic acid at an effective delivery concentration of 3-300 mmol / L is used as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 60 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1 μg / μL.

[0106] When administered intramuscularly with a liquid mixture containing L-glutamic acid at an effective delivery concentration of ≥30 mmol / L and ≤20 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1 μg / μL.

[0107] When administered intramuscularly with a liquid mixture containing L-glutamic acid at an effective delivery concentration of ≥20 mmol / L and ≤100 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 25 times that of the pVAX-luci-tdT plasmid DNA without excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1 μg / μL.

[0108] When administered intramuscularly with a liquid mixture containing L-glutamic acid at an effective delivery concentration of ≥100 mmol / L and ≤300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 60 times that of the pVAX-luci-tdT plasmid DNA without excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1 μg / μL.

[0109] When administered intramuscularly with a liquid mixture containing an amino acid compound at an effective delivery concentration of 3-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 60 times that of the pVAX-luci-tdT plasmid DNA without the excipient. The amino acid compound is a combination of L-glutamic acid and tetrahydropyrimidine; preferably, the concentration ratio of L-glutamic acid to tetrahydropyrimidine is 1:5-1:5; more preferably, the concentration ratio is 1:2-1:2; and the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1 μg / μL.

[0110] In some specific embodiments, when a liquid mixture containing an amino acid compound at an effective delivery concentration of 3-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 40 times that of the pVAX-luci-tdT plasmid DNA without the excipient. The amino acid compound is a combination of L-glutamic acid and L-leucine; preferably, the concentration ratio of L-glutamic acid to L-leucine is 1:5-1:5; more preferably, the concentration ratio is 1:2-1:2; and the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1 μg / μL.

[0111] In some specific embodiments, when a liquid mixture containing an amino acid compound at an effective delivery concentration of 3-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without the excipient. The amino acid compound is a combination of L-glutamic acid and glycine; preferably, the concentration ratio of L-glutamic acid to glycine is 1:5-1:5; more preferably, the concentration ratio is 1:2-1:2; and the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1 μg / μL.

[0112] Preferably, in some specific embodiments, when intramuscular injection is performed using a liquid mixture containing an amino acid-based substance at an effective delivery concentration of 100-300 mmol / L as an excipient, the number of cells successfully transfected in mouse muscle tissue by the pVAX-luci-tdT plasmid DNA is 10-40 times that of pVAX-luci-tdT plasmid DNA without an excipient. The effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL. The amino acid-based substance is selected from one or more substances in the group consisting of L-glutamic acid, tetrahydropyrimidine, homoserine, D-histidine, L-alanine, and L-glutamic acid.

[0113] Preferably, in some specific embodiments, when intramuscular injection is performed using a liquid mixture containing an amino acid substance at an effective delivery concentration of 100-300 mmol / L as an excipient, the number of cells successfully transfected in rat muscle tissue by the pVAX-luci-tdT plasmid DNA is 10-80 times that of pVAX-luci-tdT plasmid DNA without an excipient. The effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL. The amino acid substance is selected from one or more substances in the group consisting of L-glutamic acid, tetrahydropyrimidine, homoserine, D-histidine, L-alanine, and L-glutamic acid. Preferably, the amino acid substance is L-glutamic acid.

[0114] Preferably, in some specific embodiments, when intramuscular injection is performed using a liquid mixture containing an amino acid-based substance at an effective delivery concentration of 100-300 mmol / L as an excipient, the number of cells successfully transfected in rabbit muscle tissue by the pVAX-luci-tdT plasmid DNA is 5-20 times that of pVAX-luci-tdT plasmid DNA without an excipient. The effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL. The amino acid-based substance is selected from one or more substances in the group consisting of L-glutamic acid, tetrahydropyrimidine, homoserine, D-histidine, L-alanine, and L-glutamic acid. More preferably, the amino acid-based substance is L-glutamic acid or tetrahydropyrimidine.

[0115] (iv) Regarding the exogenous plasmid DNA preparation for skin injection provided by the present invention.

[0116] In some specific embodiments, the present invention provides a transdermal injection exogenous plasmid DNA formulation containing the aforementioned excipients and exogenous plasmid DNA, wherein the effective delivery concentration of the exogenous plasmid DNA in the exogenous plasmid DNA formulation is 0.05 μg / μL or higher, preferably 0.05-5 μg / μL, and more preferably 0.05-1 μg / μL.

[0117] And / or in the exogenous plasmid DNA preparation, the effective delivery concentration of amino acid substances is 3 mmol / L or higher, preferably 3-300 mmol / L, more preferably 10-300 mmol / L, and most preferably 100-300 mmol / L.

[0118] Specifically, when a liquid mixture containing the aforementioned effective delivery concentration of amino acid substances is used as an excipient for skin injection, the expression level of the target gene in the exogenous plasmid DNA is greater than 0 and less than or equal to 80 times that of the exogenous plasmid DNA without excipients.

[0119] When the pVAX-luci-tdT plasmid DNA is injected into the skin as an excipient and / or when a liquid mixture containing an amino acid-based substance at the above effective delivery concentration is used as an excipient, the number of cells successfully transfected in the skin tissue by the pVAX-luci-tdT plasmid DNA is 10-80 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the skin tissue is mouse, rat, or rabbit skin tissue.

[0120] Preferably, in some specific embodiments, the exogenous plasmid DNA is purified pVAX-luci-tdT plasmid DNA, which simultaneously encodes the luciferase gene sequence and the red fluorescent protein gene sequence.

[0121] More preferably, in some specific embodiments, the amino acid substances include one or more substances selected from the group consisting of L-proline, L-valine, L-lysine, homoserine, L-serine, glycine, D-histidine, L-leucine, L-glutamic acid, L-glutamine, tetrahydropyrimidine, and polyglutamic acid.

[0122] More preferably, in some specific embodiments, the amino acid substance includes one or more substances selected from the group consisting of D-histidine, L-leucine, L-glutamic acid, L-glutamine, tetrahydropyrimidine, homoserine and polyglutamic acid.

[0123] More preferably, the amino acid is selected from one or more substances chosen from the group consisting of D-histidine, L-leucine, L-glutamic acid and L-glutamine, tetrahydropyrimidine, homoserine and polyglutamic acid. Preferably, the ratio of the effective delivery concentrations of the two substances constituting the amino acid is 1-5:1-5, and more preferably, the ratio is 1-2:1-2.

[0124] Most preferably, in some specific embodiments, when a liquid mixture containing D-histidine at an effective delivery concentration of 100-300 mmol / L is used as an excipient for skin injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1 μg / μL.

[0125] When applied to the skin with a liquid mixture containing L-leucine at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1 μg / μL.

[0126] When applied to the skin and / or using a liquid mixture containing polyglutamic acid at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 40 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1 μg / μL.

[0127] When applied to the skin with a liquid mixture containing L-glutamic acid at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 40 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1 μg / μL.

[0128] When applied to the skin and / or using a liquid mixture containing tetrahydropyrimidine at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than or equal to 20 and less than or equal to 60 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1 μg / μL.

[0129] When applied to the skin with a liquid mixture containing L-glutamine at an effective delivery concentration of 100-300 mmol / L as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than or equal to 40 and less than or equal to 80 times that of the pVAX-luci-tdT plasmid DNA without the excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1 μg / μL.

[0130] And / or in some specific embodiments, when a liquid mixture containing an amino acid-based substance at an effective delivery concentration of 100-300 mmol / L is used as an excipient for skin injection, the number of cells successfully transfected in mouse skin tissue by the pVAX-luci-tdT plasmid DNA is 10-80 times that of pVAX-luci-tdT plasmid DNA without an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 μg / μL, and wherein the amino acid-based substance is selected from one or more substances in the group consisting of L-glutamic acid, L-glutamine, tetrahydropyrimidine, and polyglutamic acid.

[0131] Unless otherwise stated, all reagents / instruments used in the embodiments of this invention are conventional commercially available products. The sources of the experimental reagents used in this invention are shown in Table 1, and the sources of information on the experimental instruments are shown in Table 2.

[0132] Table 1. Experimental Reagent Information

[0133]

[0134]

[0135] Table 2. Experimental Instrument Information Sheet

[0136]

[0137] 1. The preparation of the reagents involved in the examples or application examples is as follows:

[0138] (1) Lysis buffer: Add 2 tablets of EDTA-free cOmplete to 100 mL of firefly luciferase reporter gene cell lysis buffer. TM The protease inhibitors were mixed and dissolved to obtain a lysis buffer.

[0139] (2) Electrophoresis buffer: Mix 100 mL of Tris-Glycine SDS-PAGE electrophoresis buffer (10×) with ultrapure water and bring the volume to 1 L to obtain the electrophoresis buffer.

[0140] (3) Rapid transfer buffer: Mix 100 mL of ice-free transfer buffer (10×) with 200 mL of anhydrous ethanol, and bring the volume up to 1 L with ultrapure water to obtain rapid transfer buffer.

[0141] (4) TBST buffer: Mix 100 mL of TBST buffer (10×) with ultrapure water and bring the volume up to 1 L to obtain TBST.

[0142] Blocking solution: Mix PBS (1x) with 2.5g BSA powder and bring the volume to 50mL to obtain the blocking solution.

[0143] (5) PBST: Mix PBS (1x) with 500 μL of Tween 20 and bring the volume to 500 mL to obtain PBST.

[0144] (6) RPMI 1640 Medium containing 1% P / S: Mix 5 mL of P / S with RPMI 1640 Medium and bring the volume to 500 mL.

[0145] (7) PBS containing 2% P / S: Mix 1 mL of P / S with PBS (1x) and bring the volume to 50 mL.

[0146] (8) Lymphocyte separation medium containing 1% P / S: Mix 0.5 mL of P / S with the lymphocyte separation medium and dilute to 50 mL.

[0147] (9) Culture medium with a peptide library stimulant concentration of 0.2 mg / mL: Mix 60 μL of DMSO containing 0.1 mg / mL peptide library stimulant with serum-free lymphocyte culture medium and dilute to 3 mL to obtain a culture medium with a peptide library stimulant concentration of 0.2 mg / mL.

[0148] 2. Preparation of the purified pVAX-luci-tdT plasmid DNA involved in the examples (this plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), the specific preparation method is as follows:

[0149] The construction method of plasmid pVAX-luci-tdT is as follows:

[0150] The plasmid backbone pVAX was obtained from Invitrogen. Luciferase and tdTomato were amplified using primer pairs. The primer pairs for amplifying luciferase were: Luci-F: CCGTCAGACTCGAGGCCACCATGGAAGACGCCAAAAACAT (Sequence No. 1), Luci-R: CCTCGACGTCACCGCATGTTAGCAGACTTCCTCTGCCCTCCACGGCGATCTTTCCGCCCT (Sequence No. 2); the primer pairs for amplifying tdTomato were: tdT-F: TAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAATGGTGAGCAAGGGCGAGGAG (Sequence No. 3), tdT-R: GGCTGATCAGCGGGTTTAAACTTACTTGTACAGCTCGTCCATGCC (Sequence No. 4). The amplified products were analyzed for size using agarose gel electrophoresis and recovered using a gel extraction kit. The vector backbone was digested with restriction endonucleases XhoI and PmeI. The digestion products were detected by agarose gel electrophoresis to ensure complete digestion, and the corresponding fragments were recovered using a gel extraction kit for later use. Plasmid construction was performed using a seamless cloning kit (Novizan, C116). Specifically, the digested vector and the two fragments were mixed at a ratio of 40 ng, 20 ng, and 20 ng, and the 2x premix component from the C116 kit was added. The mixture was incubated at 50°C for 5 minutes. The product was transformed into *E. coli* DH5α and plated overnight. Single clones were picked the following day for PCR identification and sequencing. Single clones with correct sequences and high plasmid yields were selected for preservation. Single clones were preserved using glycerol. Specifically, bacterial culture grown to the logarithmic growth phase (OD600 = 0.6–1.2) was mixed with 40% (w / v) sterile glycerol in equal proportions and stored at -80°C.

[0151] The purification method for pVAX-luci-tdT plasmid DNA is as follows:

[0152] 1. Lysis of bacterial cells:

[0153] (1) Escherichia coli containing the pVAX-luci-tdT plasmid was inoculated into 6L LB medium at a ratio of 1:1000 for cell expansion culture. The cell expansion culture parameters were 37℃ and 220rpm for 16h. The expanded cells were collected by centrifugation at 8000g and 4℃ for 10min to obtain 36g of wet cells.

[0154] (2) 36g of bacterial cells were mixed with 120mL of the first solution (10mM ethylenediaminetetraacetic acid + 50mM tris(hydroxymethyl)aminomethane hydrochloride and pH=8.0) to resuspend the bacterial cells. After resuspension, 120mL of the second solution (200mM sodium hydroxide + 1% sodium dodecyl sulfate) was added to lyse the bacterial solution. The lysis was carried out at room temperature for 3min. Then, 270mL of the third solution (4M ammonium sulfate solution and pH=5.5) was added. After thorough mixing, the solution was allowed to stand to obtain the lysate. At this time, the final concentration of ammonium sulfate in the lysate was 2.12M. The lysate was centrifuged at 10000g and 4℃ for 30min to collect the supernatant, which is the crude solution containing plasmids.

[0155] 2. Purify plasmid DNA:

[0156] (3) The crude solution containing the plasmid is loaded onto a hydrophobic chromatography column, and the hydrophobic chromatographic product is obtained through a hydrophobic chromatography process: 1. Column equilibration: Equilibrate the column to two column volumes using solution A at a flow rate of 10 mL / min; 2. Sample loading: Pass the crude solution containing the plasmid through the hydrophobic chromatography column at a flow rate of 10 mL / min; 3. Eluting: Eluting the column with 95% (v / v) solution A + 5% (v / v) solution B until all parameters are stable at a flow rate of 10 mL / min; 4. Elution: Eluting with 76% (v / v) solution A + 24% (v / v) solution B at a flow rate of 10 mL / min to obtain the hydrophobic chromatographic product. The hydrophobic chromatography column is 26 mm x 10 mm with a column bed volume of 50 mL, and the packing material is a mercaptopyridine column.

[0157] (4) The hydrophobic chromatographic product was diluted with water at a 1:1 ratio. The diluted hydrophobic chromatographic product was loaded onto a strong anion exchange column, and purified plasmid DNA was obtained through ion exchange chromatography. The ion exchange chromatography procedure was as follows: 1. Column equilibration: Equilibrate two column volumes with solution B at a flow rate of 10 mL / min; 2. Sample loading: Mix the hydrophobic chromatographic product with solution B at a volume ratio of 1:1 and pass it through the strong anion exchange column at a flow rate of 10 mL / min; 3. Eluting: Elute three column volumes with 40 vol% solution C + 60 vol% solution B until all parameters are stable; 4. Elution: Elute with 90 vol% solution C + 10 vol% solution B at a flow rate of 10 mL / min and collect the elution product in 0.9 M sodium chloride solution to obtain purified plasmid DNA. The strong anion exchange column was 16 mm x 10 mm with a column bed volume of 20 mL and packed with quaternary ammonium ligands.

[0158] Solution A consists of 2.1M ammonium sulfate + 10mM ethylenediaminetetraacetic acid + 100mM tris(hydroxymethyl)aminomethane hydrochloride, with a pH of 7.5.

[0159] Solution B is 10 mM ethylenediaminetetraacetic acid + 100 mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5;

[0160] Solution C is 1M sodium chloride + 10mM ethylenediaminetetraacetic acid + 100mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5.

[0161] It should be noted that this application does not specifically limit the exogenous plasmid or the purification method of the exogenous plasmid. The aforementioned exogenous plasmid and purification method are merely specific examples. In other words, as long as the excipient provided by this invention can achieve the delivery effect of this invention when delivering the exogenous plasmid or the purified exogenous plasmid, the delivery effect is sufficient. This delivery effect is to increase the transfection range of the plasmid DNA. Increase the protein expression level of the target gene .

[0162] 3. The preparation of the purified pVAX-Ova plasmid DNA encoding the ovalbumin gene sequence involved in the examples or application examples is as follows:

[0163] The plasmid pVAX-Ova was constructed as follows: The DNA sequence of ovalbumin (NCBI Accession: NP990483.2) was obtained from NCBI. The sequence was optimized using the GenSmart online codon optimization tool, with mice as the target host, avoiding potentially existing functional elements (GGTAGG and AATAAA). The optimized sequence was synthesized into a whole genome and constructed in the pVAX-CAG vector using XhoI+PmeI. The primers were: ova-F: GAATTGTTTAGTGAACCGTCAGACTCGAGGCCACCATGGGCAGCATCGGCGCCGCTAGC (Sequence No. 5); ova-R: CTCCTCGACGTCACCGCATGTTAGCAGACTTCCTCTGCCCTCAGGGCTCACGCACCTTCCGAAGAAC (Sequence No. 6).

[0164] The purification method for plasmid pVAX-Ova is the same as the purification method for pVAX-luci-tdT plasmid DNA described above.

[0165] It should be noted that this application does not specifically limit the exogenous plasmid or the purification method of the exogenous plasmid. The aforementioned exogenous plasmid and purification method are merely specific examples. In other words, as long as the excipient provided by this invention can achieve the delivery effect of this invention when delivering the exogenous plasmid or the purified exogenous plasmid, the delivery effect is sufficient. This delivery effect is to increase the transfection range of the plasmid DNA. Increase the protein expression level of the target gene.

[0166] 4. The protein immunoblotting (Western Blot) detection method, in vitro luciferase activity detection method, immunofluorescence detection method, enzyme-linked immunosorbent assay (ELISA) method, and enzyme-linked immunospot assay (ELISPOT) method involved in the examples or application examples are as follows:

[0167] 4.1 Western Blot Detection Method:

[0168] (1) Separation of the tibialis anterior muscle: Experimental animals (in this application, the experimental animals are mice, rats, or rabbits) injected with purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) were euthanized using carbon dioxide. The skin on the outer side of the tibialis anterior muscle of the experimental animals was wiped clean with 75% ethanol, and the epidermis was torn off with forceps. Dissecting forceps were inserted from the tendon below the tibialis anterior muscle and slid up and down to separate the tibialis anterior muscle from the surrounding bones and muscles. Subsequently, the superior and inferior tendons were severed with ophthalmic scissors to separate the tibialis anterior muscle.

[0169] (2) Preparation of homogenate: The tibialis anterior muscle obtained in step (1) was added to 400 μL of lysis buffer and immersed in a 1.5 mL centrifuge tube with a buckle. Five 5 mm zirconia fragments were added to the tube. The centrifuge tube was then placed in a homogenizer and homogenized for 2 min at a power of 8 W to obtain a homogenate. The homogenate was then placed on ice for later use.

[0170] (3) Preparation of pyrolysis products: After centrifuging the homogenate at 12000×g and 4℃ for 5 min, take 250μL of supernatant into a new centrifuge tube, and then centrifuge at 12000×g and 4℃ for 5 min to obtain the supernatant, which is the pyrolysis product.

[0171] (4) Protein sample preparation: Take 80 μL of the lysis product obtained in step (3), add 20 μL of 5x protein loading buffer, mix well, and boil at 98℃ for 5 min to obtain the protein sample. Take another 5 μL of the lysis product into a 96-well plate, add 250 μL of Bradford reaction solution per well, and incubate at room temperature for 5 min. Within 1 h, read the absorbance at 595 nm using a multi-functional microplate reader and convert it to protein concentration using a standard curve.

[0172] (5) Vertical electrophoresis and transfer: Take 10 μL of the protein sample and perform vertical electrophoresis using a 10% SDS-PAGE gel. Then cut a 5 cm × 8 cm PVDF membrane and stack it in the following order using a transfer clamp: sponge-filter paper-PVDF membrane-polyacrylamide gel-filter paper-sponge. Transfer the membrane in ice-free rapid transfer buffer at a constant current of 0.4 A for 30 minutes to transfer the protein from the vertical electrophoresis gel to the membrane, thus obtaining the transferred PVDF membrane.

[0173] (6) Sealing: The PVDF film transferred above was cleaned once with TBST and sealed in a 5% (w / v) skim milk powder solution for 30 min, and then cleaned three times with TBST. The 5% (w / v) skim milk powder solution was prepared by mixing skim milk powder and TBST.

[0174] (7) Primary antibody incubation: The Anti-Firefly Luciferase antibody was diluted at a volume ratio of 1:2000 to obtain an Anti-Firefly Luciferase antibody solution. The HRP-conjugated GAPDH Monoclonal antibody was also diluted at a volume ratio of 1:2000 to obtain an HRP-conjugated GAPDH Monoclonal antibody solution. The Anti-Firefly Luciferase antibody solution and the HRP-conjugated GAPDH Monoclonal antibody solution were then mixed to obtain a mixture, and the PVDF membrane obtained in step (3) was incubated overnight at 4°C in the mixture.

[0175] (8) Rinsing: After incubating overnight, the PVDF membrane is rinsed three times with TBST buffer for at least 5 minutes each time.

[0176] (9) Secondary antibody incubation: Goat anti-rabbit IgG H&L (HRP) was diluted with a 5% (w / v) skim milk powder solution at a volume ratio of 1:20000 to obtain a secondary antibody solution. Then, the rinsed PVDF membrane was incubated in the secondary antibody solution at room temperature for 1 hour.

[0177] (10) Rinsing: After incubation for 1 hour, the PVDF membrane is rinsed 3 times with TBST buffer for at least 5 minutes each time.

[0178] (11) Chemiluminescence detection: using SuperSignal TM West Pico PLUS chemiluminescent substrate was prepared. The chemiluminescent substrate was then applied to a PVDF membrane and incubated at room temperature for 3 minutes. The incubated PVDF membrane was then imaged using a mini chemiluminescence imager to obtain an immunoblot.

[0179] (12) Image processing: ImageJ software was used to scan the gray values ​​of the corresponding bands in the immunoblot image. The obtained values ​​were normalized using the concentration measured by BCA to obtain the relative expression level of luciferase.

[0180] 4.2 In vitro luciferase activity detection method:

[0181] (1) Separation of the tibialis anterior muscle: Experimental animals (in this application, mice) injected with pVAX-luci-tdT plasmid DNA solution encoding the luciferase / red fluorescent protein gene sequence were euthanized using carbon dioxide. The skin on the outer side of the tibialis anterior muscle of the experimental animals was wiped clean with 75% ethanol, and the epidermis was torn off with forceps. Dissecting forceps were inserted from the tendon below the tibialis anterior muscle and slid up and down to separate the tibialis anterior muscle from the surrounding bones and muscles. Subsequently, the superior and inferior tendons were severed with ophthalmic scissors to separate the tibialis anterior muscle.

[0182] (2) Preparation of homogenate: The tibialis anterior muscle obtained in step (1) was added to 400 μL of lysis buffer and immersed in a 1.5 mL centrifuge tube with a buckle. Five 5 mm zirconia fragments were added to the tube. The centrifuge tube was then placed in a homogenizer and homogenized for 2 min at a power of 8 W to obtain a homogenate. The homogenate was then placed on ice for later use.

[0183] (3) Preparation of pyrolysis products: After centrifuging the homogenate at 12000×g and 4℃ for 5 min, take 250μL of supernatant into a new centrifuge tube, and then centrifuge at 12000×g and 4℃ for 5 min to obtain the supernatant, which is the pyrolysis product.

[0184] (4) One-Lite luciferaseAssay was added at 100 μL / well to a black 96-well plate, followed by 2 μL of the lysis product obtained in step (4). The plate was incubated at room temperature for 5 min, and bioluminescence in the 400-600 nm band was collected within 1 h using a multifunctional microplate detector with an integration time of 1 s to obtain the in vitro luciferase signal value, which was used to evaluate the activity level of luciferase in experimental animals.

[0185] 4.3 Detection method for immunofluorescence assay:

[0186] (1) When the tissue sample is a tibialis anterior muscle sample: Experimental animals (in this application, the experimental animals are mice, rats, or rabbits) injected with a pVAX-luci-tdT plasmid DNA solution encoding the gene sequence of luciferase / red fluorescent protein were euthanized using carbon dioxide. The skin on the lateral side of the tibialis anterior muscle was then cleaned with 75% ethanol, and the epidermis was removed with forceps. Dissecting forceps were inserted from the tendon below the tibialis anterior muscle and slid up and down to separate the tibialis anterior muscle from the surrounding bone and muscle. The superior and inferior tendons were then severed using ophthalmic scissors to separate the tibialis anterior muscle. The separated tibialis anterior muscle was immersed in general-purpose GD muscle fixative (2 mL for mice, 50 mL for rats, and 50 mL for rabbits) and fixed overnight at 4°C.

[0187] Alternatively, when the tissue sample is a skin sample: Experimental animals (in this application, mice, rats, or rabbits) injected with a pVAX-luci-tdT plasmid DNA solution encoding gene sequences simultaneously encoding luciferase and red fluorescent protein are euthanized using carbon dioxide. The skin at the injection site is then cleaned with 75% ethanol, and the skin is cut off with scissors, laid flat in a 6-well plate, and submerged in 2 mL of general-purpose GD muscle fixative. The plate is then fixed overnight at 4°C.

[0188] (2) Remove the fixative and rinse the tibialis anterior muscle / skin sample obtained in step (1) with 3 mL of PBS for 5 min, rinsing 3 times. Prepare a 10 wt% sucrose solution using PBS (1x). Discard the PBS (1x) in the rinsed tibialis anterior muscle / skin sample and replace it with the 10 wt% sucrose solution, allowing the tibialis anterior muscle / skin sample to settle to the bottom.

[0189] (3) Use absorbent paper to remove moisture from the surface of the tibialis anterior muscle sample / skin sample, place it in a plastic mold of appropriate size, and use OCT to completely immerse the tibialis anterior muscle sample / skin sample for coating. Then place it at -20°C until the OCT is completely solidified.

[0190] (4) Use a cryostat to cut the tibialis anterior muscle / skin sample into 10 μm thick slices.

[0191] Tibialis anterior muscle sections / skin sections were obtained, then attached to glass slides and air-dried at room temperature.

[0192] (5) Briefly rehydrate the dried samples in PBS (1x) and mount them with mounting medium containing DAPI. Immunofluorescence images of tibialis anterior muscle sections / skin sections are acquired using a VS200 slide scanner.

[0193] 4.4 Enzyme-linked immunosorbent assay (ELISA) method:

[0194] (1) Using antigen coating solution, the antigen: ovalbumin (in PBS) with a concentration of 100 mg / mL was diluted to a concentration of 10 μg / mL and added to the ELISA assay plate at a rate of 100 μL / well. The plate was then coated overnight at 4°C.

[0195] (2) The next day, remove the coating solution, rinse 2-3 times with PBST, add 200μL of blocking solution, block at 37℃ for 2h, then rinse 3 times with PBST and drain the residual liquid.

[0196] (3) Starting with a blocking buffer:serum sample ratio of 1:1000, serially dilute the serum sample 3-fold, resulting in 6 dilutions. The final dilution value is 1 / (2.43×10⁻⁶). 5 The diluted serum samples were then transferred to coated ELISA plates, 100 μL per well, and incubated at 37°C for 1 hour. The samples were then discarded and washed 3-5 times with PBST.

[0197] (4) Add secondary antibodies (Goat-anti-moust IgG, IgG1, IgG2a). Dilute the secondary antibodies at a ratio of 1:20000 (secondary antibody: antibody diluent) and add 100 μL to each well of the ELISA plate washed with PBST in step (3). Incubate at 37°C for 1 hour. Discard the secondary antibodies and wash with PBST 3-5 times.

[0198] (5) Add 100 μL of the single component to each well of the ELISA assay plate washed with PBST in step (4) for color development. After the color development reaches a suitable depth, add 50 μL of stop solution to each well to terminate the reaction. Use an enzyme-linked immunosorbent assay (ELISA) reader to read the OD450 absorbance. The critical value is twice the OD of the blank immunization group. The highest dilution above the critical value is considered as the antibody titer, which refers to the concentration of the antibody in the serum. It is used to indicate the strength of the antibody's ability to bind to the antigen. The higher the titer, the greater the antibody concentration and the stronger the ability to bind to the antigen.

[0199] 4.5 Enzyme-linked immunospot (ELISPOT) detection method:

[0200] (1) Add 1.5 mL / well of lymphocyte separation medium containing 1% P / S at 0℃ to a 24-well plate and place it on an ice plate. Transfer the spleen sample into the plate. Use a 5 / 10 mL syringe plunger to grind the spleen until the grinding solution is dark red and turbid, obtaining a grinding suspension. Filter the grinding suspension through a flow cytometer; transfer the filtered grinding suspension to 2 mL centrifuge tubes, add 0.3 mL of RPMI-1640 to each tube, and centrifuge at 800 g and 4℃ for 30 min to obtain the lymphocyte layer.

[0201] (2) Aspirate the lymphocyte layer and transfer it to a new 15mL centrifuge tube. Add 10mL of RPMI 1640 Medium containing 1% P / S to each tube. Centrifuge at 200g and 4℃ for 10min, discard the supernatant, and obtain the cell pellet.

[0202] (3) Resuspend the cell pellet in 0.6 mL of serum-free lymphocyte culture medium. Dilute 100-fold and place 0.1 mL in each well of a 96-well plate. Add an equal volume of 0.4% trypan blue staining solution. Count the cells using a BioRad automated cell counter to calculate the cell concentration. Dilute the cells to 5 × 10⁶ / mL with serum-free lymphocyte culture medium according to the cell concentration, and place 200 μL in each well of a 96-well plate for later use. Seed the cells in a multi-channel pipette at a rate of 50 μL per well (250,000 cells).

[0203] (4) Take 200 μL of culture medium with a peptide library stimulant concentration of 0.2 mg / mL and store it in a 96-well plate. Experimental wells (+): Add 50 μL of the cells obtained in step (3) to each well containing the culture medium using a pipette and incubate at 37°C for 20 hours.

[0204] (5) Pour out the cells and culture medium from the wells, add 200 μL of 0℃ deionized water per well, and incubate at 4℃ for 10 min to lyse the cells; perform color development using the colorimetric reagent in the ELISA kit, specifically, use 250 μL of 1x Washing Buffer working solution per well, let stand for 1 min and then discard the liquid in the well, repeat 3-6 times; add 100 μL of 1x Biotinylated Antibody working solution to each experimental well. Incubate at 37℃ for 1 hour; use 250 μL of 1x Washing Buffer working solution per well, let stand for 1 min and then discard the liquid in the well, then use 250 μL of 1x Washing Buffer working solution per well, let stand for 1 min and then discard the liquid in the well, repeat 3-6 times; add 100 μL of 1x Streptavidin-HRP working solution to each experimental well. Incubate at 37℃ for 1 hour; add 100 μL of AEC chromogenic solution to each well, incubate at room temperature in the dark for 30 minutes, and select the termination time based on spot formation. If the room temperature is below 20℃, it is recommended to perform chromogenic incubation at 37℃, checking every 5-10 minutes. Use an ELISPOT plate reader to read the spots.

[0205] Example 1: Final concentrations of plasmid DNA and amino acids in a solution for screening amino acid-plasmid DNA (intramuscular injection into mice).

[0206] (1) Preparation of L-glutamate-plasmid DNA solutions at different concentrations: Purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) was mixed with PBS (1x) to obtain a mixed solution of L-glutamate-plasmid. The final concentration of plasmid DNA was 0.05 μg / μL, 0.1 μg / μL, or 0.5 μg / μL, and the final concentration of L-glutamate in the solution was 300 mM. 50 μL of the above plasmid DNA was drawn up using an insulin needle and injected intramuscularly into the anterior tibialis muscle of BalB / C mice (purchased from Vital Rivers), with 6 mice in each group. On the third day after injection, D-luciferin potassium salt was injected intraperitoneally into the mice at a dose of 150 mg per kg of mouse. In vivo imaging was then performed using a live imaging system, and the live imaging signal value of luciferase in the mice was collected.

[0207] (2) After collecting the in vivo imaging signal values ​​in step (1), the mice in each group were tested according to the in vitro luciferase activity detection method to obtain the in vitro luciferase signal value, which was used to evaluate the activity level of luciferase in mice.

[0208] (3) After collecting the in vivo imaging signal values ​​in step (1), the mice in each group were tested according to the Western blot method to obtain the relative expression level of luciferase.

[0209] (4) The correlation statistics of the in vivo imaging signal values ​​obtained in step (1), the in vitro luciferase signal values ​​obtained in step (2), and the relative expression levels of luciferase obtained in step (3) are performed, and the results are as follows: Figure 1 As shown.

[0210] like Figure 1 As shown, Figure 1 The correlation statistics of in vivo imaging signal values, in vitro luciferase signal values, and relative luciferase expression levels in mice injected intramuscularly with different concentrations of L-glutamate-plasmid DNA solutions are presented in the graph. The results show a good linear relationship between in vivo imaging signal values, in vitro luciferase signal values, and relative luciferase expression levels. The values ​​obtained by the in vivo imaging method can effectively measure the expression level of total protein, thereby screening for compounds and their working concentrations that enhance the in vivo delivery efficiency of plasmid DNA.

[0211] Example 2: Effect of amino acid solution as excipient on the expression level of exogenous protein (intramuscular injection in mice)

[0212] Preparation of amino acid-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), amino acids, and PBS (1x) were mixed to obtain an amino acid-plasmid mixed solution. The final concentration of amino acids in this solution was 300 mM, and the final concentration of plasmid DNA was 0.05 ug / uL. The specific amino acids were: glycine, γ-aminobutyric acid, L-histidine, L-cysteine, L-glutamine, L-lysine, L-arginine, L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine, or L-isoleucine.

[0213] Preparation of the amino acid derivative-plasmid DNA solution: Purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), amino acid derivatives, and PBS (1x) were mixed to obtain a mixed solution of amino acid derivatives and plasmid. The final concentration of the amino acid derivatives in this solution was 300 mM, and the final concentration of the plasmid DNA was 0.05 μg / μL. The amino acid derivatives were specifically histamine, homoserine, or tetrahydropyrimidine.

[0214] Preparation of polyglutamic acid-plasmid DNA solution: Purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), polyglutamic acid, and PBS (1x) were mixed to obtain a polyglutamic acid-plasmid mixed solution. The final concentration of polyglutamic acid in this solution was 300 mM, and the final concentration of plasmid DNA was 0.05 μg / μL, based on the equivalent monomer concentration of polyglutamic acid. The equivalent monomer concentration was calculated as follows: when preparing a 300 mM polyglutamic acid-plasmid mixed solution, each L of the mixed solution contained 44.139 g of glutamic acid. Therefore, the 300 mM polyglutamic acid-plasmid mixed solution was prepared with 44.139 g of polyglutamic acid per L of the mixed solution.

[0215] Preparation of PBS-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) was dissolved in PBS (1x) to a final concentration of 0.05 ug / uL to obtain the PBS-plasmid DNA solution.

[0216] Preparation of physiological saline-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) was dissolved in physiological saline to a final concentration of 0.05 ug / uL to obtain the physiological saline-plasmid DNA solution.

[0217] (2) Amino acid group: The solution of each amino acid-plasmid DNA obtained in step (1) was drawn using a 31G insulin needle. 50uL of solution was injected intramuscularly into the anterior tibialis muscle of the corresponding BalB / C mice (purchased from Vital Rivers) (3 mice per solution).

[0218] Amino acid derivative group: The difference from the amino acid group is that it involves injecting a solution of amino acid derivatives - plasmid DNA.

[0219] Polyglutamate group: The difference from the amino acid group is that a solution of polyglutamate-plasmid DNA is injected.

[0220] PBS group: The difference from the amino acid group is that PBS-plasmid DNA solution is injected.

[0221] The saline group differed from the amino acid group in that it was injected with a solution of physiological saline-plasmid DNA.

[0222] Electroporation group: In addition to the PBS group, eight electrical stimulations were applied to the injection site. The electric field strength of the electrical stimulation was 100 V / cm, the frequency of the electrical stimulation was 20 ms each time, and the interval was 1 s.

[0223] (3) On the third day after injection, D-luciferin potassium salt was injected intraperitoneally into mice at a dose of 150 mg per kg of mouse. In vivo imaging was then performed using a live imaging system to collect the in vivo imaging signal values ​​of luciferase in the mice. Next, the mice in each group were analyzed using Western blotting to obtain the relative expression level of luciferase. Then, using the PBS group as a baseline, the relative expression levels of luciferase in the amino acid group, polyglutamic acid group, saline group, and electroporation group were calculated relative to the PBS group. The results are as follows: Figure 2 As shown.

[0224] like Figure 2 As shown, Figure 2 The relative expression levels of luciferase in the amino acid group, amino acid derivative group, polyglutamic acid group, saline group, and electroporation group relative to the PBS group are shown. Figure 2 The vertical axis represents the fold increase in expression level relative to the PBS group, which is the fold increase in relative luciferase expression level relative to the PBS group. The results indicate that... Figure 2 The amino acids marked with circles (where the amino acids marked with circles are glycine, γ-aminobutyric acid or L-histidine) and amino acid derivatives: histamine, showed no significant difference compared with the PBS group.

[0225] Figure 2 The amino acids labeled with the triangular dot (where the triangular dot-labeled amino acids are L-cysteine, L-glutamine, L-lysine, or L-arginine) showed significant inhibition.

[0226] Figure 2 The rhomboid-labeled amino acids or amino acid derivatives (where the rhomboid-labeled amino acids are L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine, or L-isoleucine, and the rhomboid-labeled amino acid derivatives are tetrahydropyrimidine or homoserine) or polyglutamic acid significantly promoted total protein expression, which also indicates that the rhomboid-labeled amino acids, amino acid derivatives, or polyglutamic acid in the figure significantly promoted the effectiveness of vector transfection.

[0227] Example 3: Effect of amino acid solution as excipient on in vivo transfection efficiency of plasmid DNA (intramuscular injection in mice).

[0228] It should be noted that, in addition to the relative expression level of luciferase (total protein expression level) in Example 2, the number of cells successfully transfected in vivo is also an important indicator for assessing whether amino acids or amino acid polymers are suitable as excipients. Therefore, the amino acid group (wherein the amino acid is D-histidine, L-alanine, or L-glutamic acid), the amino acid derivative group (wherein the amino acid derivative is tetrahydropyrimidine or homoserine), and the polyglutamic acid group, which showed significant promotion of luciferase expression (total protein expression) in Example 3, were selected. The number of cells successfully transfected in vivo using the above amino acids or amino acid polymers as excipients was further detected by immunofluorescence detection method, and this was used as an indicator for a second screening.

[0229] In addition, the glycine group in Example 3, which did not significantly promote luciferase expression (total protein expression), was selected, and the number of cells transfected with glycine as an excipient was further detected by immunofluorescence assay.

[0230] The amino acid group (wherein the amino acid is glycine, D-histidine, L-alanine or L-glutamic acid), the amino acid derivative group (wherein the amino acid derivative is tetrahydropyrimidine or homoserine), the polyglutamic acid group, the PBS group, and the electroporation group mice obtained in step (3) of Example 2 were used to collect immunofluorescence images of mouse tibialis anterior muscle sections according to the immunofluorescence detection method. The results are as follows: Figure 3 As shown.

[0231] like Figure 3 As shown, Figure 3 Immunofluorescence images of tibialis anterior muscle sections from mice in the amino acid group (where the amino acids are glycine, D-histidine, L-alanine, or L-glutamate), the amino acid derivative group (where the amino acid derivatives are tetrahydropyrimidine or homoserine), the polyglutamic acid group, the PBS group, and the electroporation group were displayed. The results showed that sporadic positive cells were visible in the tibialis anterior muscle sections from mice in the PBS group. The tibialis anterior muscle sections from mice injected with amino acid-plasmid DNA solutions (where the amino acids are D-histidine, L-alanine, or L-glutamate), amino acid derivative-plasmid DNA solutions (where the amino acid derivatives are tetrahydropyrimidine or homoserine), and polyglutamic acid-plasmid DNA solutions showed a large number of positive cells, indicating a higher number of successfully transfected cells in vivo, without causing significant tissue damage or immune infiltration. The number of positive cells in the tibialis anterior muscle sections from mice injected with glycine-plasmid DNA solutions was similar to that in PBS.

[0232] Example 4: The effect of L-glutamate solution as an excipient on promoting plasmid DNA transfection in vivo, compared with electroporation (intramuscular injection in mice).

[0233] (1) Preparation of L-glutamate-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamate and PBS (1x) were mixed to obtain an L-glutamate-plasmid solution, wherein the final concentration of L-glutamate in the solution was 300mM and the final concentration of plasmid DNA was 0.1ug / uL.

[0234] Preparation of PBS-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) was dissolved in PBS (1x) to a final concentration of 0.1 ug / uL to obtain the PBS-plasmid DNA solution.

[0235] (2) L-glutamate group: The L-glutamate-plasmid DNA solution obtained in step (1) was drawn up using a 31G insulin needle and injected into the anterior tibialis muscle of the corresponding BalB / C mice (the mice were purchased from Vital River) at a dose of 50uL per muscle (6 mice were injected).

[0236] PBS group: The PBS-plasmid DNA solution obtained in step (1) was drawn up using a 31G insulin needle and injected intramuscularly into the anterior tibialis muscle of the corresponding BalB / C mice (the mice were purchased from Vital River) at a dose of 50 μL per muscle (6 mice were injected).

[0237] Electroporation group: In addition to the PBS group, eight electrical stimulations were applied to the injection site. The electric field strength of the electrical stimulation was 100 V / cm, the frequency of the electrical stimulation was 20 ms each time, and the interval was 1 s.

[0238] (3) On days 1, 3, 7, 11, 15, and 30 post-injection, mice in each group were injected intraperitoneally with D-luciferin potassium salt at a dose of 150 mg per kg of mouse. In vivo imaging was then performed using a live imaging system, and the live imaging signal values ​​of luciferase in the mice were collected. The results are as follows: Figure 4 As shown.

[0239] (4) All mouse anterior tibialis muscle samples (n=6) obtained in step (3) on day 30 post-injection were fixed overnight in fixative. They were then rinsed three times in PBS. After rinsing, the tissues were used to acquire red fluorescence signals using a stereofluorescence microscope for stereofluorescence imaging, resulting in stereofluorescence images. The results are shown below. Figure 5 As shown.

[0240] (5) After collecting the in vivo imaging signal values ​​obtained in step (3), immunofluorescence images of the tibialis anterior muscle slices of all mice were collected according to the immunofluorescence detection method. The number of myofilaments of the tibialis anterior muscle was counted based on the immunofluorescence images. The results are as follows: Figure 6 As shown. The average fluorescence intensity of mouse tibialis anterior muscle sections was also statistically analyzed, and the results are as follows. Figure 7 As shown.

[0241] (6) The immunoblotting method obtained in step (3) was used to detect all mice on day 30 after injection, and the immunoblotting images were obtained. The results are as follows: Figure 8 As shown.

[0242] like Figure 4 As shown, Figure 4 The values ​​represent the in vivo imaging signal values ​​of luciferase in mice on days 1, 3, 7, 11, 15, and 30 post-injection. The results showed that the L-glutamate group exhibited several times the protein expression level of the PBS group over a period of up to 30 days.

[0243] like Figure 5 As shown, Figure 5 This is a somatic fluorescence microscopy image of the tibialis anterior muscle in mice on day 30 after injection. The results show that L-glutamate can effectively promote plasmid DNA transfection in vivo, and the number of positive myofilaments increases significantly. Among them, the positive myofilaments represent the successful expression of luciferase in the mouse tibialis anterior muscle.

[0244] like Figure 6 As shown, Figure 6 The figure shows the quantitative results of the number of myofilaments marked on the muscle slices of the tibialis anterior muscle of mice on day 30 after injection. In the figure, PBS represents the PBS group, electroporation represents the electroporation group, and glutamate represents the L-glutamate group. The results show that the L-glutamate group significantly increased the number of positive myofilaments, with an average of 582 myofilaments / slice. Among them, positive myofilaments represent the successful expression of luciferase in the mouse tibialis anterior muscle.

[0245] like Figure 7 As shown, Figure 7 The figure shows the quantitative results of the mean fluorescence intensity of mouse anterior tibialis muscle sections on day 30 after injection. In the figure, PBS represents the PBS group, electroporation represents the electroporation group, and glutamate represents the L-glutamate group. The results show that the L-glutamate group can effectively enhance the fluorescent protein signal, and the intensity is not weaker than that of electroporation.

[0246] like Figure 8 As shown, Figure 8The image shows an immunoblot of mouse tibialis anterior muscle tissue. In the image, PBS represents the PBS group, electroporation represents the electroporation group, and L-glutamate represents the L-glutamate group. The results show that the expression level of luciferase in the L-glutamate group is significantly higher than that in the PBS group. Therefore, L-glutamate as an excipient can stably increase the expression level of exogenous proteins.

[0247] Example 5: Effect of solutions of different concentrations of amino acids or solutions of amino acid mixtures as excipients on the in vivo transfection efficiency of plasmid DNA (intramuscular injection in mice).

[0248] Preparation of 3mM L-glutamate-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamate, and PBS (1x) were mixed to obtain a 3mM L-glutamate-plasmid DNA solution, wherein the final concentration of L-glutamate in the solution was 3mM, and the final concentration of plasmid DNA was 0.1ug / uL.

[0249] Preparation of 30 mM L-glutamate-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamate, and PBS (1x) were mixed to obtain a 30 mM L-glutamate-plasmid DNA solution, wherein the final concentration of L-glutamate in the solution was 30 mM, and the final concentration of plasmid DNA was 0.1 ug / uL.

[0250] Preparation of 300mM L-glutamate-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamate, and PBS (1x) were mixed to obtain a 300mM L-glutamate-plasmid DNA solution, wherein the final concentration of L-glutamate in the solution was 300mM, and the final concentration of plasmid DNA was 0.1ug / uL.

[0251] Preparation of a 150 mM L-glutamate-150 mM tetrahydropyrimidine-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamate, tetrahydropyrimidine, and PBS (1x) were mixed to obtain a 150 mM L-glutamate-150 mM tetrahydropyrimidine-plasmid DNA solution. The final concentrations of L-glutamate, tetrahydropyrimidine, and plasmid DNA in the solution were 150 mM and 0.1 μg / μL, respectively.

[0252] Preparation of a 150 mM L-glutamate-150 mM L-leucine-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamate, L-leucine, and PBS (1x) were mixed to obtain a 150 mM L-glutamate-150 mM L-leucine-plasmid DNA solution. The final concentrations of L-glutamate and L-leucine in the solution were 150 mM, and the final concentration of plasmid DNA was 0.1 μg / μL.

[0253] Preparation of a 150 mM L-glutamate-150 mM glycine-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamate, glycine, and PBS (1x) were mixed to obtain a 150 mM L-glutamate-150 mM glycine-plasmid DNA solution. The final concentrations of L-glutamate and glycine in the solution were 150 mM, and the final concentration of plasmid DNA was 0.1 μg / μL.

[0254] Preparation of PBS-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) was dissolved in PBS (1x) to a final concentration of 0.1 ug / uL to obtain the PBS-plasmid DNA solution.

[0255] (2) 3mM L-glutamate group: The 3mM L-glutamate-plasmid DNA solution obtained in step (1) was drawn up using a 31G insulin needle and injected into the anterior tibialis muscle of the corresponding BalB / C mice (the mice were purchased from Vital River) at a dose of 50uL per muscle (6 mice were injected).

[0256] 30mM L-glutamate group: The difference from the 3mM L-glutamate group is that the 30mM L-glutamate-plasmid DNA solution obtained in step (1) is injected.

[0257] 300mM L-glutamate group: The difference from the 3mM L-glutamate group is that the 300mM L-glutamate-plasmid DNA solution obtained in step (1) is injected.

[0258] 150mM L-glutamate-150mM tetrahydropyrimidine group: The difference from the 3mM L-glutamate group is that the 150mM L-glutamate-150mM tetrahydropyrimidine-plasmid DNA solution obtained in step (1) is injected.

[0259] 150mM L-glutamic acid-150mM L-leucine group: The difference from the 3mM L-glutamic acid group is that the 150mM L-glutamic acid-150mM L-leucine-plasmid DNA solution obtained in step (1) is injected.

[0260] 150mM L-glutamic acid-150mM glycine group: The difference from the 3mM L-glutamic acid group is that the 150mM L-glutamic acid-150mM glycine-plasmid DNA solution obtained in step (1) was injected.

[0261] PBS group: The difference from the 3mM L-glutamate group is that the PBS-plasmid DNA solution obtained in step (1) is injected.

[0262] Electroporation group: In addition to the PBS group, eight electrical stimulations were applied to the injection site. The electric field strength of the electrical stimulation was 100 V / cm, the frequency of the electrical stimulation was 20 ms each time, and the interval was 1 s.

[0263] (3) On the third day after injection, D-luciferin potassium salt was injected intraperitoneally into the mice at a dose of 150 mg per kg of mice. In vivo imaging was then performed using a live imaging system, and the live imaging signal values ​​of luciferase in the mice were collected. The results are as follows: Figure 9 As shown.

[0264] like Figure 9 As shown, Figure 9 The image shows the detection results of in vivo imaging signal values. In this image, PBS represents the PBS group, electroporation represents the electroporation group, 3mM glutamate represents the 3mM L-glutamate group, 30mM glutamate represents the 30mM L-glutamate group, 300mM glutamate represents the 300mM L-glutamate group, glutamate / tetrahydropyrimidine represents the 150mM L-glutamate-150mM tetrahydropyrimidine group, glutamate / leucine represents the 150mM L-glutamate-150mM L-leucine group, and glutamate / glycine represents the 150mM L-glutamate-150mM glycine group.

[0265] It is evident that the in vivo imaging signal value of the L-glutamate-plasmid DNA solution increases with the final concentration of L-glutamate, indicating that the transfection effect of plasmid DNA in vivo is enhanced compared to the PBS group. Furthermore, the mixture of L-glutamate and tetrahydropyrimidine, and the mixture of L-glutamate and L-leucine, have a beneficial effect as excipients.

[0266] Example 6: Effect of amino acid solution as excipient on the expression level of exogenous protein (dermal injection in mice)

[0267] (1) Preparation of amino acid-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), amino acids, and PBS (1x) are mixed to obtain an amino acid-plasmid mixed solution. The final concentration of amino acids in this solution is 300 mM, and the final concentration of plasmid DNA is 0.1 μg / μL. The specific amino acids are: L-proline, L-valine, L-lysine, glycine, L-serine, D-histidine, L-leucine, L-glutamic acid, L-glutamine, L-threonine, or L-arginine. Preparation of amino acid derivative-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), amino acid derivatives, and PBS (1x) are mixed to obtain an amino acid derivative-plasmid mixed solution. The final concentration of the amino acid derivative in the solution is 300 mM, and the final concentration of the plasmid DNA is 0.1 ug / uL; the amino acid derivative is specifically homoserine or tetrahydropyrimidine.

[0268] Preparation of the polyglutamic acid-plasmid DNA solution: Purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), polyglutamic acid, and PBS (1x) were mixed to obtain a polyglutamic acid-plasmid mixed solution. The final concentration of polyglutamic acid in this solution was 300 mM, and the final concentration of plasmid DNA was 0.1 μg / μL, based on the equivalent monomer concentration of polyglutamic acid.

[0269] Preparation of PBS-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) was dissolved in PBS (1x) to a final concentration of 0.1 ug / uL to obtain the PBS-plasmid DNA solution.

[0270] (2) Amino acid group: The solution of each amino acid-plasmid DNA obtained in step (1) was drawn using a 31G insulin needle. 20 μL was injected intradermally into BalB / C mice (the mice were purchased from Vital Rivers), with 3 mice in each group and 2 injection sites per mouse.

[0271] Amino acid derivative group: The difference from the amino acid group is that it involves injecting a solution of amino acid derivatives - plasmid DNA.

[0272] Polyglutamate group: The difference from the amino acid group is that a solution of polyglutamate-plasmid DNA is injected.

[0273] PBS group: The difference from the amino acid group is that PBS-plasmid DNA solution is injected.

[0274] (3) On the third day after injection, D-luciferin potassium salt was injected intraperitoneally into mice at a dose of 150 mg per kg of mice. In vivo imaging was then performed using a live imaging system to collect the in vivo imaging signal values ​​of luciferase in the mice. The mice in each group were then analyzed using Western blotting to obtain the relative expression level of luciferase. The relative expression levels of luciferase in the amino acid group, amino acid derivative group, polyglutamic acid group, and other groups were calculated relative to the PBS group, using the PBS group as a baseline. The results are as follows: Figure 10 As shown.

[0275] like Figure 10 As shown, Figure 10 The relative expression levels of luciferase in the amino acid group, amino acid derivative group, and polyglutamate group relative to the PBS group are shown as folds. Figure 10 The vertical axis represents the fold increase in expression level relative to the PBS group, indicating the relative fold increase in luciferase expression level compared to the PBS group. Results showed that L-proline, L-valine, L-lysine, homoserine, L-serine, and glycine showed no significant difference compared to the PBS group and did not promote total protein expression. L-threonine and L-arginine exhibited significant inhibitory effects, while D-histidine, L-leucine, polyglutamic acid, L-glutamic acid, tetrahydropyrimidine, and L-glutamine showed significant differences compared to the PBS group and promoted total protein expression.

[0276] Example 7: Effect of amino acid solution as excipient on in vivo transfection efficiency of plasmid DNA (dermal injection in mice).

[0277] The mice in the amino acid group (wherein the amino acid is glycine, L-glutamic acid, or L-glutamine), the amino acid derivative group (wherein the amino acid derivative is tetrahydropyrimidine), the polyglutamic acid group, and the PBS group, after obtaining the in vivo imaging signal values ​​obtained in step (3) of Example 6, had their skin sections immunofluorescence images collected according to the immunofluorescence detection method. The results are as follows: Figure 11 As shown.

[0278] like Figure 11 As shown, Figure 11 Immunofluorescence images of skin sections from mice in the amino acid group (where the amino acid is glycine, tetrahydropyrimidine, L-glutamate, or L-glutamine), the amino acid derivative group (where the amino acid derivative is tetrahydropyrimidine), the polyglutamate group, and the PBS group. The results showed that, compared with the PBS control group, the L-glutamate group, L-glutamine group, tetrahydropyrimidine group, and polyglutamate group could transfect more cells via skin injection.

[0279] Example 8: Effect of L-glutamic acid solution as an excipient on the in vivo transfection efficiency of plasmid DNA (intramuscular injection in rats).

[0280] (1) Preparation of L-glutamate-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamate and PBS (1x) are mixed to obtain a mixed solution of L-glutamate-plasmid, wherein the final concentration of L-glutamate in the solution is 300mM and the final concentration of plasmid DNA is 0.1ug / uL.

[0281] Preparation of PBS-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) was dissolved in PBS (1x) to a final concentration of 0.1 ug / uL to obtain the PBS-plasmid DNA solution.

[0282] (2) L-glutamate group: The L-glutamate-plasmid DNA solution obtained in step (1) was drawn up using a 31G insulin needle and injected into the anterior tibialis muscle of the corresponding rats (the rats were purchased from Vital River) at a dose of 200uL per muscle (6 rats were injected).

[0283] PBS group: The difference from the amino acid group is that PBS-plasmid DNA solution is injected.

[0284] Electroporation group: In addition to the PBS group, eight electrical stimulations were applied to the injection site. The electric field strength of the electrical stimulation was 100 V / cm, the frequency of the electrical stimulation was 20 ms each time, and the interval was 1 s.

[0285] (3) On the 3rd day after injection, D-luciferin potassium salt was injected intraperitoneally into the rats at a dose of 150 mg per kg of rat. In vivo imaging was then performed using a live imaging system, and the live imaging signal values ​​of luciferase in the mice were collected. The results are as follows: Figure 12 As shown.

[0286] (4) After collecting the in vivo imaging signal values ​​obtained in step (3), the L-glutamate group, PBS group, and electroporation group rats were subjected to immunofluorescence detection, and immunofluorescence images of the tibialis anterior muscle sections were collected according to the immunofluorescence detection method. The results are as follows: Figure 13 As shown.

[0287] like Figure 12 and 13 As shown, Figure 12 The graph shows the detection results of in vivo imaging signal values ​​of rats in the L-glutamate group, PBS group, and electroporation group. In the graph, glutamate is represented as L-glutamate. Figure 13 Immunofluorescence images of tibialis anterior muscle sections from rats in the L-glutamate, PBS, and electroporation groups are shown. In the images, glutamate is represented as L-glutamate. The results indicate that L-glutamate significantly increases the muscle transfection extent in rats.

[0288] Example 9: Effect of L-glutamate solution or tetrahydropyrimidine solution as excipients on the in vivo transfection efficiency of plasmid DNA (intramuscular injection in rabbits).

[0289] (1) Preparation of L-glutamate-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamate and PBS (1x) are mixed to obtain a mixed solution of L-glutamate-plasmid, wherein the final concentration of L-glutamate in the solution is 300mM and the final concentration of plasmid DNA is 0.1ug / uL.

[0290] Preparation of tetrahydropyrimidine-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), tetrahydropyrimidine, and PBS (1x) were mixed to obtain a tetrahydropyrimidine-plasmid mixed solution, wherein the final concentration of tetrahydropyrimidine in the solution was 300 mM and the final concentration of plasmid DNA was 0.1 ug / uL.

[0291] Preparation of PBS-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) was dissolved in PBS (1x) to a final concentration of 0.1 ug / uL to obtain the PBS-plasmid DNA solution.

[0292] (2) L-glutamate group: The L-glutamate-plasmid DNA solution obtained in step (1) was drawn up using a 31G insulin needle and injected into the anterior tibialis muscle of the corresponding rabbit (the rabbit was purchased from Vital River) at a dose of 1 mL per muscle (3 rabbits were injected).

[0293] Tetrahydropyrimidine group: The difference from the L-glutamate group is that a solution of tetrahydropyrimidine-plasmid DNA is injected.

[0294] PBS group: The difference from the amino acid group is that PBS-plasmid DNA solution is injected.

[0295] (3) The rabbits in the L-glutamate group, tetrahydropyrimidine group, and PBS group obtained in step (2) were subjected to immunofluorescence imaging of tibialis anterior muscle sections according to the immunofluorescence detection method. The results are as follows: Figure 14 As shown.

[0296] like Figure 14 As shown, Figure 14 Immunofluorescence images of rabbit anterior tibialis muscle sections from the L-glutamate, tetrahydropyrimidine, and PBS groups are shown. In the images, glutamate is represented as L-glutamate. The results indicate that L-glutamate and tetrahydropyrimidine significantly increased the transfection range of rabbit muscle.

[0297] Application Example 1: The effect of amino acid solutions as excipients on the in vivo immunogenicity of ovalbumin DNA vaccines (intramuscular injection in mice).

[0298] like Figure 15 As shown, Figure 15 The upper part of the image shows a flowchart of the immune sequence sample collection process. Figure 15 The lower part of the figure is a schematic diagram of the construction of the pVax-Ova plasmid encoding the immunogen gene sequence (ovalbumin gene sequence), which is a schematic diagram of the ovalbumin DNA vaccine structure.

[0299] (1) pVAX-Ova immunization:

[0300] (1.1) Preparation of amino acid-pVAX-Ova plasmid DNA solution: The purified pVAX-Ova plasmid DNA encoding the immunogenic gene sequence (ovalbumin gene sequence), amino acids and PBS (1x) were mixed to obtain an amino acid-plasmid mixed solution, wherein the final concentration of amino acids in the solution was 300mM and the final concentration of plasmid DNA was 0.1ug / uL, wherein the amino acids were L-glutamic acid, L-leucine or D-histidine.

[0301] Preparation of amino acid derivative-pVAX-Ova plasmid DNA solution: The purified pVAX-Ova plasmid DNA encoding the immunogenic gene sequence (ovalbumin gene sequence), amino acids, and PBS (1x) were mixed to obtain a mixed solution of amino acid derivative-plasmid, wherein the final concentration of the amino acid derivative in the solution was 300 mM and the final concentration of the plasmid DNA was 0.1 ug / uL, wherein the amino acid derivative was tetrahydropyrimidine.

[0302] Preparation of PBS-pVAX-OvaDNA solution: The purified pVAX-Ova plasmid DNA encoding the immunogenic gene sequence (ovalbumin gene sequence) was dissolved in PBS (1x) to a final concentration of 0.1 ug / ul to obtain the PBS-plamid DNA solution.

[0303] (1.2) Amino acid group: Mice were immunized for the first, second and third time at weeks 0, 2 and 4 respectively. The specific immunization method was as follows: the amino acid-pVAX-Ova plasmid DNA solution obtained in step (1) was drawn into a 31G insulin needle and injected into the tibialis anterior muscle of mice at a dose of 50uL per muscle.

[0304] Amino acid derivative group: The difference from the amino acid group is that a solution of amino acid derivative plasmid pVAX-OvaDNA is injected.

[0305] PBS group: The difference from the amino acid group is that a solution of PBS-pVAX-Ov aDNA is injected.

[0306] Electroporation group: In addition to the PBS group, eight electrical stimulations were applied to the injection site. The electric field strength of the electrical stimulation was 100 V / cm, the frequency of the electrical stimulation was 20 ms each time, and the interval was 1 s.

[0307] Control group: PBS was injected only.

[0308] (2) Blank immunization: The difference from step (1) is that the purified pVAX-Ova plasmid DNA encoding the immunogen gene sequence (ovalbumin gene sequence) is replaced with pVAX-Ova plasmid DNA that does not encode the immunogen gene sequence, and the corresponding amino acid group, amino acid derivative group, PBS group, and electroporation group after blank immunization are obtained.

[0309] (3) All mice immunized with pVAX-Ova and those immunized without treatment were sacrificed by cervical dislocation at week 6. Spleen samples were then collected by dissection and rinsed several times in PBS containing 2% P / S. The samples were then temporarily stored in 24-well plates containing 2% P / S in PBS at 0°C on ice. The spleen samples were subsequently analyzed by enzyme-linked immunospot assay (ELISPOT) to determine the number of IFN-γ-positive splenocytes responding to the spike protein. The results are as follows: Figure 16 As shown, the statistical results are as follows: Figure 17 As shown.

[0310] (4) Blood samples were collected from the orbital veins of mice immunized with pVAX-Ova and mice immunized with blank at weeks 2, 4, and 6 (i.e., peripheral blood collection). After standing at room temperature for 30 minutes, the blood samples were centrifuged at 1000g for 30 minutes, and the supernatant was collected as serum samples. The serum samples were then subjected to enzyme-linked immunosorbent assay (ELISA) to determine the titer of OVA-specific antibodies. The results are as follows: Figure 18 As shown.

[0311] like Figure 16 , 17 and Figure 18 As shown, Figure 16 This image shows the number of IFN-γ-positive spleen cells in response to spike protein after intramuscular injection in mice immunized with pVAX-Ova, including the amino acid group (where the amino acid is L-glutamic acid, tetrahydropyrimidine, L-leucine, or D-histidine), the amino acid derivative group (where the amino acid derivative is tetrahydropyrimidine), the PBS group, the electroporation group, the control group, and the blank immunized mice. Figure 16 In this context, ovalbumin antigen stimulation is represented as pVAX-Ova immunization, and the unstimulated control is represented as blank immunization. Figure 17 The number of IFN-γ positive spleen cells in response to spike protein after intramuscular injection in mice immunized with pVAX-Ova (where the amino acid is L-glutamic acid, L-leucine or D-histidine), amino acid derivative group (where the amino acid derivative is tetrahydropyrimidine), PBS group and electroporation group. Figure 18The table shows the titers of OVA-specific antibodies administered intramuscularly to mice in the following groups after pVAX-Ova immunization: amino acid group (where the amino acid is L-glutamic acid, L-leucine, or D-histidine), amino acid derivative group (where the amino acid derivative is tetrahydropyrimidine), PBS group, and electroporation group. Figure 18 In this study, the first dose refers to the first immunization, the second dose to the second immunization, and the third dose to the third immunization. The results showed that the amino acid group exhibited better indicators of cellular and humoral immune responses.

[0312] Application Example 2: The effect of L-glutamic acid solution as an excipient on the in vivo immunogenicity of ovalbumin DNA vaccine (dermal injection in mice).

[0313] (1) Preparation of L-glutamic acid-pVAX-Ova plasmid DNA solution: The purified pVAX-Ova plasmid DNA encoding the immunogen OVA protein (ovalbumin), L-glutamic acid and PBS (1x) were mixed to obtain a mixed solution of L-glutamic acid-plasmid, wherein the final concentration of L-glutamic acid in the solution was 300mM and the final concentration of plasmid DNA was 0.1ug / uL.

[0314] Preparation of PBS-pVAX-Ova plasmid DNA solution: The purified pVAX-Ova plasmid DNA encoding the immunogen OVA protein gene sequence (ovalbumin gene sequence) was dissolved in PBS (1x) to a final concentration of 0.1 ug / ul to obtain the PBS-pVA plasmid DNA solution.

[0315] (2) L-glutamate group: At weeks 0, 2, and 4, solutions of each amino acid-plasmid DNA obtained in step (1) were aspirated using a 31G insulin needle. 20 μL of the solution was injected intradermally into BalB / C mice (purchased from Vital Rivers), with 3 mice per group and 2 injection sites per mouse.

[0316] PBS group: The difference from the amino acid group is that a solution of PBS-pVAX-Ov aDNA is injected.

[0317] (2) Blood samples were collected from mice in the pVAX-Ova immunization group and the blank immunization group at weeks 2, 4, and 6 via the orbital vein. After standing at room temperature for 30 minutes, the blood samples were centrifuged at 1000g for 30 minutes, and the supernatant was collected as serum samples. The serum samples were then analyzed by enzyme-linked immunosorbent assay (ELISA) to determine the titer of OVA-specific antibodies, starting from 1:1000 and serially diluted 2-fold, with the absorbance measured at each dilution. The results are as follows: Figure 19 As shown.

[0318] like Figure 19As shown, Figure 19 The graph shows the titers of OVA-specific antibodies after skin injection in mice in the L-glutamate and PBS groups. The vertical axis represents the absorbance at 450 nm, and the horizontal axis represents the dilution factor of the OVA-specific antibody. The results indicate that skin injection of L-glutamate can elicit a better humoral immune response.

[0319] Application Example 3: The effect of L-glutamic acid solution or tetrahydropyrimidine solution as excipients on the in vivo immunogenicity of ovalbumin DNA vaccine (dermal or intramuscular injection in rats).

[0320] (1) Preparation of L-glutamic acid-pVAX-Ova plasmid DNA solution: The purified pVAX-Ova plasmid DNA encoding the immunogenic gene sequence (ovalbumin gene sequence), L-glutamic acid and PBS (1x) were mixed to obtain a mixed solution of L-glutamic acid-plasmid, wherein the final concentration of L-glutamic acid in the solution was 300mM and the final concentration of plasmid DNA was 0.1ug / uL.

[0321] Preparation of tetrahydropyrimidine-pVAX-Ova plasmid DNA solution: The purified pVAX-Ova plasmid DNA encoding the immunogenic gene sequence, i.e., the ovalbumin gene sequence, was mixed with tetrahydropyrimidine and PBS (1x) to obtain a tetrahydropyrimidine-plasmid mixed solution, wherein the final concentration of tetrahydropyrimidine in the solution was 300 mM and the final concentration of plasmid DNA was 0.1 ug / uL.

[0322] Preparation of PBS-pVAX-Ova plasmid DNA solution: The purified pVAX-Ova plasmid DNA encoding the immunogenic gene sequence, i.e., the ovalbumin gene sequence, was dissolved in PBS (1x) to a final concentration of 0.1 ug / ul to obtain the PBS-pVAX-Ova plasmid DNA solution.

[0323] (2) The skin injection methods for the L-glutamate group, tetrahydropyrimidine group, and PBS group are as follows:

[0324] L-glutamate group: At weeks 0, 2, and 4, the L-glutamate-pVAX-Ova plasmid DNA solution obtained in step (1) was drawn up using a 31G insulin needle and injected intradermally into rats at a dose of 100ug per injection site. There were 3 rats in each group and 2 injection sites per rat.

[0325] Tetrahydropyrimidine group: The difference from the amino acid group is that a solution of tetrahydropyrimidine-pVAX-Ova plasmid DNA is injected.

[0326] PBS group: The difference from the amino acid group is that a solution of PBS-pVAX-Ov aDNA is injected.

[0327] (3) The intramuscular injection methods for the L-glutamate group, PBS group, and electroporation group are as follows:

[0328] L-glutamate group: At weeks 0, 2, and 4, the solution of L-glutamate-pVAX-Ova plasmid DNA obtained in step (1) was drawn up using a 31G insulin needle and injected into the tibialis anterior muscle of rats at a dose of 50ug per muscle.

[0329] PBS group: The difference from the amino acid group is that a solution of PBS-pVAX-Ov aDNA is injected.

[0330] Electroporation group: In addition to the PBS group, eight electrical stimulations were applied to the injection site. The electric field strength of the electrical stimulation was 100 V / cm, the frequency of the electrical stimulation was 20 ms each time, and the interval was 1 s.

[0331] (4) Peripheral blood was collected from all rats obtained in step (2) at week 5 to separate serum. The titer of OVA-specific antibodies was then determined by enzyme-linked immunosorbent assay (ELISA). The results are as follows: Figure 20 As shown; peripheral blood serum was collected from all rats obtained in step (3) at week 5, and the titer of OVA-specific antibodies was then determined by enzyme-linked immunosorbent assay (ELISA), starting from 1:1000, with 2-fold serial dilutions, and the absorbance of each dilution was measured. The results are as follows. Figure 21 As shown.

[0332] like Figure 20 As shown, Figure 20 The graph shows the titers of OVA-specific antibodies after skin injection in rats in the L-glutamate, tetrahydropyrimidine, and PBS groups. The vertical axis represents the absorbance at 450 nm, and the horizontal axis represents the dilution factor of the OVA-specific antibody. Figure 21 As shown, Figure 21 The graph shows the titers of OVA-specific antibodies in rats after intramuscular injection in the L-glutamate, electroporation, and PBS groups. The vertical axis represents the absorbance at 450 nm, and the horizontal axis represents the dilution factor of the OVA-specific antibody. The results indicate that the use of amino acids can promote antibody levels in rats.

[0333] Application Example 4: The effect of amino acid solutions or mixtures of amino acid solutions as excipients on the in vivo immunogenicity of ovalbumin DNA vaccines (intramuscular injection in mice).

[0334] like Figure 22 As shown, Figure 22 A flowchart of experimental procedures and sample collection for tumor immunoprophylaxis.

[0335] (1) pVAX-Ova immunization:

[0336] (1.1) Preparation of amino acid-pVAX-Ova plasmid DNA solution: The purified pVAX-Ova plasmid DNA encoding the immunogenic gene sequence, i.e., the ovalbumin gene sequence, was mixed with amino acids and PBS (1x) to obtain an amino acid-plasmid mixed solution. The final concentration of amino acids in this solution was 300 mM, and the final concentration of plasmid DNA was 0.1 μg / μL. The amino acids were L-glutamic acid, L-leucine, or a combination of both. When combined, the final concentrations of L-glutamic acid and L-leucine were 150 mM, respectively.

[0337] Preparation of PBS-pVAX-OvaDNA solution: The purified pVAX-Ova plasmid DNA encoding the immunogenic gene sequence, i.e., the ovalbumin gene sequence, was dissolved in PBS (1x) to a final concentration of 0.1 ug / uL, thus obtaining the PBS-pVAX-OvaDNA solution.

[0338] (1.2) Amino acid group: At weeks 0, 2 and 4, the amino acid-pVAX-Ova plasmid DNA solution obtained in step (1) was drawn up with a 31G insulin needle and injected into the tibialis anterior muscle of mice at a dose of 50uL per muscle.

[0339] PBS group: The difference from the amino acid group is that a solution of PBS-pVAX-Ov aDNA is injected.

[0340] Electroporation group: In addition to the PBS group, eight electrical stimulations were applied to the injection site. The electric field strength of the electrical stimulation was 100 V / cm, the frequency of the electrical stimulation was 20 ms each time, and the interval was 1 s.

[0341] (2) Blank immunization: The difference from pVAX-Ova immunization is that the pVAX-Ova plasmid DNA encoding the immunogen gene sequence, i.e. the ovalbumin gene sequence, is replaced by the injection of pVAX-luci-tdT plasmid DNA that does not encode the immunogen gene sequence, resulting in the corresponding amino acid group, PBS group, and electroporation group after blank immunization.

[0342] (3) All mice obtained in steps (1) and (1) were subcutaneously implanted with 100,000 B16-OVA tumor cells at week 7, and the survival rate of the mice was counted over the following 90 days. The results are as follows: Figure 23 As shown.

[0343] like Figure 23 As shown, Figure 23The study compared the survival rates of mice immunized with different amino acid groups (L-glutamic acid, L-leucine, or a combination of L-glutamic acid and L-leucine), PBS groups, and blank immunizations over 90 days. The results showed that tumor vaccines using different amino acid groups significantly prolonged mouse survival, with varying effects from different excipients, exhibiting an additive effect.

Claims

1. An intramuscular or subdermal injection formulation for delivering exogenous plasmid DNA, characterized in that, The product comprises an excipient and exogenous plasmid DNA. The excipient is a liquid mixture or a lyophilized form of a liquid mixture. The liquid mixture consists of an amino acid compound and a buffer solution. The amino acid compound is used for delivery of the exogenous plasmid DNA via intramuscular or subcutaneous injection. The effective delivery concentration of the amino acid compound is 100-300 mmol / L. When delivering exogenous plasmid DNA via intramuscular or dermal injection, the effective delivery concentration of the exogenous plasmid DNA in the intramuscular or dermal injection formulation for delivering the exogenous plasmid DNA is 0.05 ug / uL or higher. When delivering exogenous plasmid DNA via intramuscular injection, the amino acid substance is selected from one or more substances in the group consisting of L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine, L-isoleucine, tetrahydropyrimidine, and homoserine. Or, when delivering exogenous plasmid DNA via skin injection, the amino acid substance is selected from one or more substances in the group consisting of D-histidine, L-leucine, L-glutamic acid, L-glutamine, and tetrahydropyrimidine.

2. The formulation according to claim 1, characterized in that, When delivered via intramuscular injection, the amino acid is selected from one or more substances in the group consisting of L-leucine, D-histidine, L-alanine, L-glutamic acid, tetrahydropyrimidine, and homoserine.

3. The formulation according to claim 2, characterized in that, When delivered via intramuscular injection, the amino acid is selected from two substances in the group consisting of L-leucine, D-histidine, L-alanine, L-glutamic acid, tetrahydropyrimidine, and homoserine.

4. The formulation according to claim 3, characterized in that, When the delivery method is intramuscular injection, the ratio of the effective delivery concentrations of the two substances constituting the amino acid is 1-5:1-5, based on the effective delivery concentration of the amino acid.

5. The formulation according to claim 4, characterized in that, When the delivery method is intramuscular injection, the ratio of the effective delivery concentrations of the two substances constituting the amino acid is 1-2:1-2, based on the effective delivery concentration of the amino acid.

6. The formulation according to claim 3, characterized in that, When delivered via intramuscular injection, the amino acid is a combination of L-glutamic acid and tetrahydropyrimidine. And / or the amino acid is a combination of L-glutamic acid and L-leucine.

7. The formulation according to claim 1, characterized in that, When delivered via skin injection, the amino acid substance is selected from two substances in the group consisting of D-histidine, L-leucine, L-glutamic acid, L-glutamine, and tetrahydropyrimidine.

8. The formulation according to claim 7, characterized in that, When the delivery method is skin injection, the ratio of the effective delivery concentrations of the two substances constituting the amino acid is 1-5:1-5, based on the effective delivery concentration of the amino acid.

9. The formulation according to claim 8, characterized in that, When the delivery method is skin injection, the ratio of the effective delivery concentrations of the two substances constituting the amino acid is 1-2:1-2, based on the effective delivery concentration of the amino acid.

10. The formulation according to any one of claims 1-9, characterized in that, When exogenous plasmid DNA is delivered via intramuscular or subcutaneous injection, the excipient has the function of expanding the transfection range of the exogenous plasmid DNA encoding the target gene in the organism and increasing the expression level of the target gene.

11. The formulation according to any one of claims 1-9, characterized in that, The buffer solution is an isotonic buffer solution.

12. The formulation according to claim 11, characterized in that, The isotonic buffer is PBS or physiological saline.

13. The formulation according to any one of claims 1-9, characterized in that, When delivering exogenous plasmid DNA via intramuscular or subcutaneous injection, the effective delivery concentration of the exogenous plasmid DNA is 0.05-5 ug / uL.

14. The formulation according to claim 13, characterized in that, When delivering exogenous plasmid DNA via intramuscular or subcutaneous injection, the effective delivery concentration of the exogenous plasmid DNA is 0.05-1 ug / uL.

15. The formulation according to any one of claims 1-9, characterized in that, The exogenous plasmid DNA is an exogenous plasmid DNA encoding the target gene sequence.

16. The formulation according to claim 15, characterized in that, The target gene is the gene sequence of a functional protein.

17. The formulation according to claim 16, characterized in that, The functional protein includes one or more substances selected from the group consisting of ovalbumin, fluorescent protein, luciferase, cytokines, nanobodies, monoclonal antibodies, and recombinant antibodies.

18. The formulation according to any one of claims 1-9, characterized in that, The exogenous DNA is either pVAX-luci-tdT plasmid DNA or pVAX-Ova plasmid DNA.

19. The formulation according to any one of claims 1-9, characterized in that, The exogenous DNA is: purified pVAX-luci-tdT plasmid DNA, and / or purified pVAX-Ova plasmid DNA.

20. A method for preparing the formulation according to any one of claims 1-19, characterized in that, The process includes the following steps: mixing a substance containing an excipient and exogenous plasmid DNA to obtain an intramuscular or subcutaneous injection formulation for delivering exogenous plasmid DNA, wherein the excipient is a liquid mixture or a lyophilized form of a liquid mixture, and the liquid mixture consists of amino acid compounds and a buffer solution. When delivering exogenous plasmid DNA via intramuscular injection, the amino acid substance is selected from one or more substances in the group consisting of L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine, L-isoleucine, tetrahydropyrimidine, and homoserine. Or, when delivering exogenous plasmid DNA via subdermal injection, the amino acid substance is selected from one or more substances in the group consisting of D-histidine, L-leucine, L-glutamic acid, L-glutamine, and tetrahydropyrimidine. The amino acid substance is used to deliver exogenous plasmid DNA. When delivering exogenous plasmid DNA, the effective delivery concentration of the amino acid substance is 100-300 mmol / L, and the effective delivery concentration of exogenous plasmid DNA is above 0.05 ug / uL.

21. The formulation according to any one of claims 1-19 or the formulation prepared by the preparation method according to claim 20, and its use in the preparation of intramuscular or dermal injection vaccine products or in the preparation of intramuscular or dermal injection non-vaccine pharmaceutical products.

22. A vaccine product, characterized in that, The vaccine product comprises the formulation according to any one of claims 1-19 or the formulation prepared by the preparation method according to claim 20, wherein the vaccine product is an intramuscular injection vaccine product or a skin injection vaccine product.

23. A non-vaccine pharmaceutical product, characterized in that, The formulation comprising any one of claims 1-19 or the formulation prepared by the preparation method of claim 20, wherein the non-vaccine pharmaceutical product is an intramuscular injection type non-vaccine product or a skin injection type non-vaccine product.

Images