Rice osgh3.4 protein and its coding gene in regulating plant growth and development

Abstract

The application discloses rice OsGH3.4 protein and application of a coding gene thereof in regulating plant growth and development. OsGH3.4 The application provides application of the OsGH3.4 protein or the coding gene thereof in regulating plant fertility and / or tiller number and / or plant height. OsGH3.4 The application also provides a method for cultivating a plant with reduced fertility and / or reduced tiller number and / or increased plant height, which comprises the following steps: inhibiting the gene expression in a receptor plant to obtain a plant with reduced fertility and / or reduced tiller number and / or increased plant height relative to the receptor plant. The application provides a new thought and potential target for rice molecular breeding and yield improvement.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to the application of rice OsGH3.4 protein and its encoding gene in regulating plant growth and development. Background Technology

[0002] Rice (Oryza sativa L.) is the primary food source for more than half of the world's population, and increasing its yield is of great significance to global food security. Rice yield is influenced by a variety of factors, including plant architecture and the development of floral organs. Plant architecture is an important agronomic trait in rice, closely related to yield, quality, and stress resistance. Rice tillers are an important indicator of plant architecture; they form in the unelongated basal internodes and grow independently of the mother stem (stem) through their own adventitious roots. Although the morphology and histology of rice tillers, as well as some rice tiller mutants, have been well described, the molecular mechanisms of rice tillering remain to be elucidated. Tillering is the ability of a rice plant to produce new branches from the base of the main stem. These branches can form additional panicles, thereby increasing yield. Tillering not only increases the number of leaves in the rice plant, thus expanding the photosynthetic area, but more leaves also mean more photosynthetic products, which contributes to increased biomass and ultimately, yield. In addition, the development of floral organs directly affects the reproductive efficiency of rice. Normal development of floral organs ensures effective pollination and fertilization, which is crucial for seed formation and yield. Summary of the Invention

[0003] The purpose of this invention is to provide the application of rice OsGH3.4 protein and its encoding gene in regulating plant growth and development.

[0004] This invention provides OsGH3.4 protein or OsGH3.4 Application of genes in regulating plant fertility and / or tillering number and / or plant height.

[0005] For fertility, the regulation is positive.

[0006] Increased OsGH3.4 protein content enhances plant fertility.

[0007] The decrease in OsGH3.4 protein content reduces plant fertility.

[0008] OsGH3.4 Increased gene abundance leads to increased plant fertility.

[0009] OsGH3.4 Decreased gene abundance reduces plant fertility.

[0010] The regulation is positive in terms of tiller quantity.

[0011] Increased OsGH3.4 protein content leads to increased tillering in plants.

[0012] The decrease in OsGH3.4 protein content leads to a decrease in the number of plant tillers.

[0013] OsGH3.4 Increased gene abundance leads to an increase in the number of plant tillers.

[0014] OsGH3.4 Decreased gene abundance leads to a decrease in tillering number.

[0015] For plant height, the regulation described is negative.

[0016] Increased OsGH3.4 protein content reduces plant height.

[0017] Decreased OsGH3.4 protein content leads to increased plant height.

[0018] OsGH3.4 Increased gene abundance reduces plant height.

[0019] OsGH3.4 Decreased gene abundance leads to increased plant height.

[0020] This invention also provides OsGH3.4 protein or OsGH3.4 The application of genes as repressive targets in plant breeding; the goal of the plant breeding is to cultivate plants with reduced fertility and / or reduced tillering number and / or increased plant height. The plant is one possessing... OsGH3.4 Genetically modified plants.

[0021] This invention also provides substances that inhibit OsGH3.4 protein or inhibit [other substances]. OsGH3.4 The application of genetic material in plant breeding; the goal of this plant breeding is to cultivate plants with reduced fertility and / or reduced tillering and / or increased plant height. Inhibition OsGH3.4 Genes can specifically be repressed OsGH3.4 Gene expression. Suppression. OsGH3.4 The substances involved in gene expression can specifically be: OsGH3.4 A gene-editing vector targeting a specific gene. The gene-editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located at... OsGH3.4 In the gene. Specifically, the target of the sgRNA is: GGCGCAGTACATCCCGACAC. The plant has OsGH3.4 Genetically modified plants.

[0022] This invention also provides a method for cultivating plants with reduced fertility and / or reduced tillering number and / or increased plant height, comprising the following steps: using homozygous mutations to introduce mutations into the plant genomic DNA... OsGH3.4The gene segment "ATGGCGCAGTACATCCCGACACTGGAGTTCTACGGC" mutated to "ATGGCGCAGTACATCCCGATCACTGGAGTTCTACGGC". The plant in question possesses... OsGH3.4 Genes in plants. Homozygous mutation, which is when the same mutation occurs on a pair of homologous chromosomes.

[0023] The present invention also provides a method for cultivating plants with reduced fertility and / or reduced tillering number and / or increased plant height, comprising the following steps: [The method involves treating the recipient plant with...] OsGH3.4 Gene editing is performed to obtain gene-edited plants. From these gene-edited plants, plants with reduced fertility and / or reduced tillering number and / or increased plant height relative to the recipient plant are selected. The recipient plant is a plant with… OsGH3.4 The gene editing is performed on a plant. The gene editing is achieved by introducing a gene editing vector. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located at... OsGH3.4 In the gene. Specifically, the target of the sgRNA is: GGCGCAGTACATCCCGACAC.

[0024] The present invention also provides a method for cultivating plants with reduced fertility and / or reduced tillering number and / or increased plant height, comprising the following steps: inhibiting the growth of fertility in the recipient plant. OsGH3.4 Gene expression was inhibited to produce plants with reduced fertility and / or reduced tillering number and / or increased plant height relative to the recipient plant. OsGH3.4 Gene expression can be specifically inhibited by introducing inhibitors into recipient plants. OsGH3.4 The material realization of gene expression. Inhibition. OsGH3.4 The substances involved in gene expression can specifically be: OsGH3.4 A gene-editing vector targeting a specific gene. The gene-editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located at... OsGH3.4 In the gene. Specifically, the target of the sgRNA is: GGCGCAGTACATCCCGACAC. Inhibiting the receptor in plants. OsGH3.4 Gene expression is specifically achieved by introducing a gene-editing vector. This gene-editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located at... OsGH3.4 In the gene. Specifically, the target of the sgRNA is: GGCGCAGTACATCCCGACAC. The recipient plant is a plant with... OsGH3.4 Genetically modified plants.

[0025] This invention also provides a method for cultivating plants with reduced fertility and / or reduced tillering number and / or increased plant height, comprising the following steps: reducing the content of OsGH3.4 protein in the plant to reduce fertility and / or reduce tillering number and / or increase plant height. The plant is a plant with… OsGH3.4 Genetically modified plants.

[0026] Reducing rice fertility has important practical value in specific scenarios, especially in fields such as weed control, prevention of gene drift, optimization of hybrid seed production, and basic scientific research.

[0027] This invention also provides the application of OsGH3.4 protein-related biomaterials in the cultivation of transgenic plants with increased fertility and / or increased tillering number and / or decreased plant height. The plants described are those without the aforementioned... OsGH3.4 Genetically modified plants.

[0028] The present invention also provides a method for cultivating plants with increased fertility and / or increased tillering number and / or decreased plant height, comprising the following steps: introducing into a recipient plant OsGH3.4 The gene is used to obtain a plant with increased fertility and / or increased tillering number and / or decreased plant height relative to the recipient plant. The plant is one that does not possess the gene. OsGH3.4 Genetically modified plants.

[0029] The OsGH3.4 protein mentioned above is either (a1), (a2), (a3), or (a4) as follows: (a1) The protein shown in SEQ ID NO: 1; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) Proteins obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1) that are related to plant fertility and / or tillering number and / or plant height. (a4) is a protein derived from rice that shares more than 98% identity with (a1) and is associated with plant fertility and / or tillering number and / or plant height.

[0030] The specific labels are shown in Table 1.

[0031] Table 1. Sequence of Labels

[0032] Any of the above OsGH3.4 The gene is the gene encoding the OsGH3.4 protein.

[0033] The OsGH3.4 The genes are either (b1) or (b2) or (b3) or (b4) or (b5): (b1) A DNA molecule with a coding region as shown in SEQ ID NO: 2; (b2) The DNA molecule shown at positions 254-2233 of SEQ ID NO: 3; (b3) The DNA molecule shown in SEQ ID NO: 3; (b4) A DNA molecule derived from rice that has more than 95% identity with (b1) or (b2) or (b3) and that encodes the protein thereon; (b5) A DNA molecule that hybridizes under stringent conditions to the nucleotide sequence defined by (b1) or (b2) or (b3) and encodes the protein therein.

[0034] The above stringent conditions can be achieved by hybridization at 65°C and washing the membrane in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS during DNA or RNA hybridization experiments.

[0035] The OsGH3.4 protein-related biomaterial is any one of the following (c1) to (c4): (c1) The nucleic acid molecule encoding the OsGH3.4 protein; (c2) An expression cassette containing the nucleic acid molecule described in (c1); (c3) A recombinant vector containing the nucleic acid molecule described in (c1) or a recombinant vector containing the expression cassette described in (c2); (c4) A recombinant microorganism containing the nucleic acid molecule described in (c1) or a recombinant microorganism containing the expression cassette described in (c2) or a recombinant microorganism containing the recombinant vector described in (c3).

[0036] The nucleic acid molecule encoding the OsGH3.4 protein may specifically be as described above. OsGH3.4 Gene.

[0037] The recombinant vector may specifically be a recombinant expression vector.

[0038] Specifically, any of the recombinant expression vectors described above can be a vector containing double-stranded DNA as shown in SEQ ID NO: 4 inserted into the multiple cloning site of the pCAMBIA2300 vector (e.g., ...). Kpn I and Xba The recombinant plasmid obtained by (I restriction site)

[0039] The fertility described above is reflected in the seed setting rate.

[0040] The reduced fertility described above is manifested as a decrease in the fruit set rate.

[0041] The increased fertility mentioned above is reflected in an increased fruit set rate.

[0042] Any of the plants mentioned above may be monocotyledonous or dicotyledonous.

[0043] Any of the plants mentioned above can be plants of the Poaceae family.

[0044] Any of the plants mentioned above may be plants of the genus *Rice*.

[0045] Specifically, any of the plants mentioned above can be rice.

[0046] Specifically, any of the plants mentioned above can be rice variety Zhonghua 11.

[0047] The inventors of this invention discovered that OsGH3.4 not only participates in stamen development but may also have a wide-ranging impact on the overall growth and development of rice, particularly its role in the formation of tillers at elongation nodes. This suggests that OsGH3.4 may influence the growth and development of lateral buds by regulating auxin signaling. This discovery provides new ideas and potential targets for molecular breeding and yield improvement in rice. Attached Figure Description

[0048] Figure 1 This is a schematic diagram of the components of the pCBSG032 carrier.

[0049] Figure 2 for osgh3.4 Sequencing results of the mutant strain.

[0050] Figure 3 This is a schematic diagram of the components of the pCAMBIA2300 carrier.

[0051] Figure 4 This is a diagram of the floral organs and their anatomy in Example 4.

[0052] Figure 5 This is a scanning electron microscope image of the stamens in Example 4.

[0053] Figure 6 This is a photograph of pollen stained with I2-KI solution in Example 4.

[0054] Figure 7 As in Example 4 OsGH3.4 Results of relative gene expression levels.

[0055] Figure 8 The images show the plant, spikelets, and tillering nodes during the heading stage in Example 5.

[0056] Figure 9 The results are for the seed setting rate, plant height, number of tillers, and number of grains per ear in Example 5. Detailed Implementation

[0057] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0058] Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. Unless otherwise specified, the quantitative experiments in the following embodiments are all performed in triplicate, and the results are averaged. Seed setting rate = number of filled seeds ÷ (number of filled seeds + number of empty seeds) × 100%.

[0059] pCBSG032 carrier (see component schematic diagram) Figure 1 ): Weimi Biotechnology Co., Ltd. The pCBSG032 vector is described in the following literature: Tian Y, Zhong D, Li X, Shen R, Han H, Dai Y, Yao Q, Zhang X, Deng Q, Cao X, Zhu JK, Lu Y. High-throughput genome editing in rice with avirus-based surrogate system. J Integr Plant Biol. 2022 Oct 11. doi: 10.1111 / jipb.13381. Epub ahead of print. PMID: 36218268.

[0060] Zhonghua 11 was developed in 1979 by the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, through flowering cultivation using Jingfeng 5 / Tetepu / Fujin varieties. Zhonghua 11 is documented in the following literature: Ni Pichong. A New Flowering Rice Variety—Zhonghua 11. Crop Variety Resources, 1989, Issue 4. The Zhonghua 11 rice plant is also known as a wild-type plant, denoted by WT.

[0061] The formulation of N6 basic culture medium is shown in Table 2.

[0062] Table 2

[0063] Callus induction medium (pH 5.8): Based on N6 basic medium, inositol (concentration of 100 mg / L), 2,4-D (concentration of 2 mg / L), proline (concentration of 2.878 g / L), enzymatically hydrolyzed casein (concentration of 300 mg / L), sucrose (concentration of 30 g / L), and plant gel (concentration of 2.6 g / L) were added.

[0064] Co-culture medium (pH 5.2): Based on N6 basic medium, add acetylsuccinone (to a concentration of 100 µM), glucose (to a concentration of 10 g / L), and plant gel (to a concentration of 2.6 g / L).

[0065] Screening medium (pH 5.8): Based on N6 basic medium, hydrolyzed casein (concentration in the medium is 500 mg / L), 2,4-D (concentration in the medium is 2 mg / L), proline (concentration in the medium is 2.8 g / L), sucrose (concentration in the medium is 30 g / L), G418 (concentration in the medium is 150 mg / L), cephalosporin (concentration in the medium is 500 mg / L), and plant gel (concentration in the medium is 2.6 g / L).

[0066] Differentiation medium (pH 5.8): Based on N6 basic medium, add kinetin (concentration of 2 mg / L), NAA (concentration of 0.02 mg / L), sucrose (concentration of 30 g / L), sorbitol (concentration of 30 g / L), acid-hydrolyzed casein (concentration of 2 g / L), and plant gel (concentration of 2.6 g / L).

[0067] Rooting medium (pH 5.8): contains 1 / 4 MS inorganic salts, 1× MS vitamins, 0.5 mg / L NAA, 1 mg / L paclobutrazol, 2.6 g / L plant gel, and the remainder is water.

[0068] The formulation of AAM inoculation solution (pH 5.2) is shown in Table 3.

[0069] Table 3

[0070] Example 1: Discovery of Proteins and Genes Previous experiments have shown that the OsGH3.4 protein is specifically highly expressed in rice stamens, suggesting its potential role in floral organ development.

[0071] Sequencing confirmed that the genomic DNA of rice Zhonghua 11 contains the DNA segment shown in SEQ ID NO: 3, and the cDNA of rice Zhonghua 11 contains the DNA segment shown in SEQ ID NO: 2, which encodes the OsGH3.4 protein shown in SEQ ID NO: 1.

[0072] Example 2: Preparation of mutant plants In this embodiment, the Zhonghua 11 rice plant was used as the starting plant to prepare CRISPR / Cas9-mediated... OsGH3.4 Plants with targeted gene editing using genes as target genes.

[0073] I. Preparation of recombinant plasmids The selected target sequence is: GGCGCAGTACATCCCGACAC.

[0074] 1. Prepare single-stranded DNA molecules F and R, and then anneal them to obtain double-stranded DNA molecules with sticky ends.

[0075] F: ggcaGGCGCAGTACATCCCGACAC; R:aaacGTGTCGGGATGTACTGCGCC.

[0076] 2. Take the pCBSG032 vector and use restriction endonuclease... Bsa I was subjected to enzyme digestion to recover the vector backbone (i.e., a large linear fragment of about 1.6 kb).

[0077] 3. The double-stranded DNA molecule with sticky ends obtained in step 1 is ligated to the vector backbone obtained in step 2 to obtain a recombinant plasmid, which is the gene editing vector. The gene editing vector has been sequenced and verified.

[0078] II. Preparation of mutant plants using CRSPR / Cas9 technology 1. Callus induction and subculture Mature seeds of rice variety Zhonghua 11 were taken, the glumes were removed, and the seeds were disinfected with 75% ethanol solution for 1 minute, then rinsed with sterile water, then disinfected with 30% sodium hypochlorite solution for 20 minutes, then washed with sterile water, and the moisture on the seed surface was absorbed with sterile filter paper. The seeds were then transferred to callus induction medium for culture to obtain callus tissue for Agrobacterium infection.

[0079] 2. Preparation of Agrobacterium suspension The gene-editing vector prepared in step one was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium. The recombinant Agrobacterium was cultured and the bacterial cells were collected, suspended in AAM infection solution, and OD was obtained. 600nm The value is 0.3-0.5 for Agrobacterium suspension.

[0080] 3. Agrobacterium infection Take the callus tissue obtained in step 1, immerse it in the Agrobacterium suspension prepared in step 2, infect it at room temperature for 20 minutes (shaking it occasionally during the process), then take out the callus tissue, absorb the excess bacterial solution with sterile filter paper, and then transfer it to a co-culture medium covered with a layer of sterile filter paper, and incubate it in the dark at 26°C for 3 days.

[0081] 4. Screening and Cultivation After completing step 3, take the callus tissue, rinse it twice with sterile water, then rinse it once with carbenicillin solution, remove excess water with a pipette, transfer it to sterile filter paper, air dry the surface moisture on a laminar flow hood, and then transfer it to a selection medium containing hygromycin. Incubate in the dark at 28-30℃ for 3-4 weeks. At this time, you can observe the growth of positive callus with a bright yellow color and a diameter of 1-2 mm.

[0082] 5. Differentiation and regeneration Take the positive callus obtained in step 4, transfer it to differentiation medium, and culture it at 28-30℃ with alternating light and dark conditions (16h light / 8h darkness). After about 10 days of culture, green spots can be observed emerging from the callus, and seedlings will differentiate after another 10 days of culture. The differentiated seedlings will grow to a height of 2-3cm.

[0083] 6. Rooting Take the seedlings obtained in step 5 and transfer them to a rooting medium. Incubate them at 28-30℃ with alternating light and dark conditions (16h light / 8h darkness). The rooted seedlings are the T0 generation plants.

[0084] III. Identification of Mutation Types The T0 generation plants obtained in step two are self-pollinated and their seeds are harvested. The seeds are then cultivated into plants, which are the T1 generation plants.

[0085] Leaves from T1 generation plants were collected, and genomic DNA was extracted. PCR amplification was performed using primer pairs consisting of GP4137-3347-F and GP4137-3347-R. The amplified products were then recovered and sequenced. Mutant strains were screened based on the sequencing results.

[0086] GP4137-3347-F: GGGAGGAACTCGAAGTAGCAC; GP4137-3347-R:CATGTACGCGCAGCTCATC.

[0087] One homozygous mutant was screened from the T1 generation plants and named [name missing]. osgh3.4 Mutant strain.

[0088] Compared to the genomic DNA of wild-type plants, osgh3.4 The genomic DNA of the mutant strain OsGH3.4 A nucleotide T was inserted into the coding region of the gene (i.e., a mutation occurred in both homologous chromosomes: from "ATGGCGCAGTACATCCCGACACTGGAGTTCTACGGC" to "ATGGCGCAGTACATCCCGATCACTGGAGTTCTACGGC"), causing a frameshift and preventing the translation of the normal protein. Sequencing results are shown below. Figure 2 .

[0089] Example 3: Preparation of replanted plants I. Preparation of recombinant plasmids The double-stranded DNA shown in SEQ ID NO: 4 was inserted into the pCAMBIA2300 vector (see schematic diagram of the pCAMBIA2300 vector). Figure 3 )of Kpn I and Xba The recombinant plasmid was obtained between the I restriction sites. The recombinant plasmid has been sequenced and verified.

[0090] II. Preparation of Replenished Plants Obtained using Example 2 osgh3.4 The mature seeds obtained by self-pollination of the mutant strain were used instead of the mature seeds of rice Zhonghua 11. The recombinant plasmid prepared in step one was used instead of the gene editing vector. The selection medium containing kanamycin was used instead of the selection medium containing hygromycin. The rest was the same as step two of Example 2.

[0091] III. Screening for homozygous transgenic plants The T0 generation plants obtained in step two are self-pollinated and their seeds are harvested. The seeds are then cultivated into plants, which are the T1 generation plants.

[0092] Transgenic plants are selected from T1 generation plants and are called T1 generation transgenic plants.

[0093] The T1 generation transgenic plants were self-pollinated and the seeds were harvested. The seeds were then cultivated into plants, which are the T2 generation plants.

[0094] For a given T1 generation transgenic plant, if all T2 generation plants obtained through self-pollination are transgenic plants, then the T1 generation transgenic plant is a homozygous transgenic plant, and all its self-pollinated offspring are homozygous transgenic plants.

[0095] Methods for screening or identifying transgenic plants: Take leaves from the plant, extract genomic DNA, and perform PCR amplification using a primer pair consisting of GP2300KanF and GP2300KanR (the primers target the kanamycin resistance gene on the vector, with a target fragment of 328bp). If the amplified product of the expected size is obtained, the plant is a transgenic plant.

[0096] GP2300KanF: TGTCATACCACTTGTCCGCC; GP2300KanR: ATCGAGCTGTATGCGGAGTG.

[0097] Example 4, Wild-type plants and osgh3.4 Comparison of traits of offspring plants of mutant strains Seeds used for testing: seeds of wild-type plants, and seeds obtained in Example 2. osgh3.4 Seeds obtained by self-pollination of mutant strains.

[0098] The tested seeds were sown and cultured until germination, and then transferred to a field in the suburbs of Beijing for normal cultivation and management.

[0099] During the flowering period, floral organs were dissected, and the stamens were observed using a scanning electron microscope. Floral organs and anatomical diagrams are shown below. Figure 4 Scanning electron micrograph of the stamens can be found in [image missing]. Figure 5 . Figure 4 and Figure 5 In this context, WT represents the wild-type plant. osgh3.4 represent osgh3.4 Progeny plants of the mutant strain. osgh3.4 In the offspring of the mutant strain, some floral organs developed abnormally, with 34% of the florets developing an extra lemma-like organ in addition to the palea and lemma. osgh3.4 The offspring of the mutant strain exhibited abnormal stamen development, particularly with significant collapse of the adaxial anther chambers.

[0100] During the flowering period, pollen-bearing florets were collected, and the anthers were dissected under a stereomicroscope. I2-KI solution (I2-KI staining solution: dissolve 0.5g KI in 1.25mL deionized water, add 0.25g iodine tablets, then dilute to 75mL, and store in the dark) was added, and the anthers were quickly crushed to release pollen. The pollen was observed and photographed under a microscope. See photos below. Figure 6 (WT represents wild-type plants,) osgh3.4 represent osgh3.4 (Progeny plants of the mutant strain). Wild-type plants have normal pollen fertility. osgh3.4 The offspring of the mutant strain have only a small amount of fertile pollen.

[0101] During the culture process, different parts were taken for testing. OsGH3.4 Relative gene expression levels. Results are shown in [link to results]. Figure 7(Orange represents wild-type plants, and blue represents offspring of mutant plants). Figure 7 In the diagram: R7 represents the young root 7 days after germination; L8 represents the 8th leaf (reproductive leaf); L3 represents the 3rd leaf (vegetative leaf); S represents the stem; P1-2 represents the 1-2cm spikelet; P3-4 represents the 3-4cm spikelet; and P5-6 represents the 5-6cm spikelet. osgh3.4 The leaves and spikelets of the offspring plants of the mutant strain OsGH3.4 Gene expression was severely suppressed.

[0102] Example 5, Wild-type plants and osgh3.4 Comparison of traits between the offspring plants of the mutant strain and the replacement plants Seeds used for testing: seeds of wild-type plants, and seeds obtained in Example 2. osgh3.4 Seeds obtained by self-pollination of mutant strains and seeds obtained by self-pollination of T1 generation homozygous transgenic plants obtained in Example 3.

[0103] The tested seeds were sown and cultured until germination, and then transferred to a field in the suburbs of Beijing for normal cultivation and management.

[0104] See phenotypic photos of plants at the heading stage. Figure 8 The left image shows the spikelet phenotypic photograph. Figure 8 The image is in the middle. A phenotypic photograph of the tillering nodes can be found in [the image]. Figure 8 The image on the right. Figure 8 In this context, WT indicates a wild-type plant. osgh3.4 express osgh3.4 Progeny plants of mutant strains OsGH3.4oE / osgh3.4 This indicates the offspring of the T1 generation homozygous transgenic plant.

[0105] At maturity, the seed setting rate, plant height, number of tillers, and number of grains per ear were measured and statistically analyzed. Results are shown below. Figure 9 (Sample size N=10). Figure 9 In this context, WT indicates a wild-type plant. osgh3.4 express osgh3.4 Progeny plants of mutant strains OsGH3.4oE This refers to the offspring plants of the T1 generation homozygous transgenic plants (the offspring plants of the complement plants).

[0106] During the seedling stage, there were no significant differences in morphology among the plants. During the jointing stage... osgh3.4 The offspring of the mutant strain grew significantly faster than the wild-type plants. At maturity, compared to the wild-type plants, osgh3.4 The offspring of the mutant strain showed a 25.4% increase in plant height. At maturity, the wild-type plant produced almost no tillers at elongated nodes, while... osgh3.4 The offspring of the mutant will continue to produce new tillers at each elongation node. Figure 8 (Indicated by the red arrow in the image). Compared to wild-type plants, osgh3.4 The offspring of the mutant produced fewer tillers, with the number of tillers reduced by 35% compared to the wild-type plant. Compared to the wild-type plant, osgh3.4 The seed setting rate of the mutant progeny was significantly reduced, reaching only 22.51%. The progeny of the reintroduced plants showed no significant differences in the above phenotypes compared to the wild-type plants. This indicates that the phenotypic differences between the mutant and wild-type plants are due to... OsGH3.4 Caused by gene inactivation.

[0107] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. OsGH3.4 protein or OsGH3.4 Application of genes in regulating plant fertility and / or tillering number and / or plant height; The OsGH3.4 protein is as follows (a1) or (a2): (a1) The protein shown in SEQ ID NO: 1; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); The OsGH3.4 The gene is the gene encoding the OsGH3.4 protein; Regarding fertility, the regulation is positive; a decrease in the content of the OsGH3.4 protein reduces plant fertility, or the... OsGH3.4 Decreased gene abundance reduces plant fertility; Regarding the number of tillers, the regulation is positive; a decrease in the content of the OsGH3.4 protein reduces the number of plant tillers, or the... OsGH3.4 Decreased gene abundance leads to a decrease in the number of plant tillers; Regarding plant height, the regulation is negative; a decrease in the content of the OsGH3.4 protein increases plant height, or the... OsGH3.4 Decreased gene abundance leads to increased plant height; The plant in question is rice.

2. The application as described in claim 1, characterized in that: The OsGH3.4 The genes are either (b1) or (b2) or (b3) or (b4) or (b5): (b1) A DNA molecule with a coding region as shown in SEQ ID NO: 2; (b2) The DNA molecule shown at positions 254-2233 of SEQ ID NO: 3; (b3) The DNA molecule shown in SEQ ID NO: 3; (b4) A DNA molecule derived from rice that has more than 95% identity with (b1) or (b2) or (b3) and that encodes the protein thereon; (b5) A DNA molecule that hybridizes under stringent conditions to the nucleotide sequence defined by (b1) or (b2) or (b3) and encodes the protein therein.

3. OsGH3.4 protein or OsGH3.4 The application of genes as repressive targets in plant breeding; the goal of the plant breeding is to cultivate plants with reduced fertility and / or reduced tillering number and / or increased plant height; the OsGH3.4 protein is the OsGH3.4 protein as described in claim 1; OsGH3.4 The gene is as described in claim 1 or 2 OsGH3.4 Genes; the plant in question is rice.

4. Substances that inhibit OsGH3.4 protein or inhibit... OsGH3.4 The application of genetic material in plant breeding; the goal of the plant breeding is to cultivate plants with reduced fertility and / or reduced tillering and / or increased plant height; The substance is... OsGH3.4 A gene editing vector targeting a gene, wherein the vector expresses Cas9 protein and sgRNA; The OsGH3.4 protein is the OsGH3.4 protein as described in claim 1; OsGH3.4 The gene is as described in claim 1 or 2 OsGH3.4 Genes; the plant in question is rice.

5. A method for cultivating plants with reduced fertility and / or reduced tillering number and / or increased plant height, comprising the following steps: using homozygous mutations to introduce a homozygous mutation into the plant's genomic DNA... OsGH3.4 The gene segment "ATGGCGCAGTACATCCCGACACTGGAGTTCTACGGC" mutates to "ATGGCGCAGTACATCCCGATCACTGGAGTTCTACGGC"; OsGH3.4 The gene is as described in claim 1 or 2 OsGH3.4 Genes; the plant in question is rice.

6. A method for cultivating plants with reduced fertility and / or reduced tillering number and / or increased plant height, comprising the following steps: inhibiting the growth of certain plants in the recipient plant. OsGH3.4 Gene expression yields plants with reduced fertility and / or reduced tillering number and / or increased plant height relative to the recipient plant; OsGH3.4 The gene is as described in claim 1 or 2 OsGH3.4 Genes; the plant in question is rice.

7. A method for cultivating plants with reduced fertility and / or reduced tillering number and / or increased plant height, comprising the following steps: reducing the content of OsGH3.4 protein in the plant to reduce the fertility and / or reduce the tillering number and / or increase the plant height; wherein the OsGH3.4 protein is the OsGH3.4 protein as described in claim 1; and wherein the plant is rice.

8. Application of OsGH3.4 protein-related biomaterials in the cultivation of transgenic plants with increased fertility and / or increased tillering number and / or decreased plant height; The OsGH3.4 protein-related biomaterial is any one of the following (c1) to (c4): (c1) The nucleic acid molecule encoding the OsGH3.4 protein; (c2) An expression cassette containing the nucleic acid molecule described in (c1); (c3) A recombinant vector containing the nucleic acid molecule described in (c1) or a recombinant vector containing the expression cassette described in (c2); (c4) A recombinant microorganism containing the nucleic acid molecule described in (c1), or a recombinant microorganism containing the expression cassette described in (c2), or a recombinant microorganism containing the recombinant vector described in (c3); The OsGH3.4 protein is the OsGH3.4 protein described in claim 1; The plant does not possess the aforementioned characteristics. OsGH3.4 Genetically modified rice.

9. A method for cultivating plants with increased fertility and / or increased tillering number and / or decreased plant height, comprising the steps of: introducing [the following] into a recipient plant. OsGH3.4 The gene, resulting in plants with increased fertility and / or increased tillering number and / or decreased plant height relative to the recipient plant; OsGH3.4 The gene is as described in claim 1 or 2 OsGH3.4 Gene; The plant does not possess the aforementioned characteristics. OsGH3.4 Genetically modified rice.

Images