Application of OsCNGC10 gene in regulating salt tolerance of rice

By knocking out the OsCNGC10 gene in rice and constructing gene-edited mutants using CRISPR/Cas9 technology, the problem of limited salt tolerance in rice was solved, salt tolerance was improved, and germplasm resources for new salt-tolerant rice varieties were provided.

CN119932091BActive Publication Date: 2026-06-23HUBEI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510176129.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-18
Publication Date
2026-06-23
Estimated Expiration
2045-02-18

AI Technical Summary

Technical Problem

Salt tolerance in rice is controlled by multiple genes. The number of major salt-tolerant genes in existing technologies is limited, making it difficult to effectively increase rice yield and planting range in saline-alkali land.

Method used

By knocking out the rice OsCNGC10 gene, gene-edited mutants were constructed using CRISPR/Cas9 technology to enhance rice's tolerance to salt stress and provide new genetic resources.

Benefits of technology

The OsCNGC10 knockout mutant material with stronger salt tolerance was obtained, which enhanced the growth performance of rice under salt stress and provided a theoretical basis and germplasm resources for breeding new salt-tolerant rice varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005275558260000071
    Figure BDA0005275558260000071
  • Figure BDA0005275558260000081
    Figure BDA0005275558260000081
  • Figure BDA0005275558260000082
    Figure BDA0005275558260000082
Patent Text Reader

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to a cyclic nucleotide-gated ion channel OsCNGC10 gene for regulating salt tolerance of rice and application thereof. The application discloses application of the OsCNGC10 gene in salt stress tolerance of rice, wherein the nucleotide sequence of the OsCNGC10 gene is shown as SEQ ID NO. 1, and the OsCNGC10 gene negatively regulates salt tolerance of rice. Specifically, rice with overexpression of the OsCNGC10 gene is more sensitive to salt stress, and knockout of the OsCNGC10 gene improves the salt stress tolerance of rice. The application enriches the function of the cyclic nucleotide-gated ion channel protein OsCNGC10 in rice stress, and provides a new gene resource for breeding of salt-resistant rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically involving the application of the OsCNGC10 gene in regulating salt tolerance in rice. Technical Background

[0002] Rice (Oryza sativa L.) is one of the world's three major staple crops. In my country, over 65% of the population relies on rice as their staple food. With population growth and decreasing usable land, the contradiction between food supply and demand is becoming increasingly prominent. In rice production, salt stress is one of the most severe adverse conditions affecting yield. Excessive concentration of soluble salts in the soil leads to poor crop growth and development, reduced dry matter accumulation, and consequently, decreased crop yield. Statistics show that the global area of ​​saline-alkali land exceeds 800 million hectares, of which over 100 million hectares of agricultural land in China are affected by salinization to varying degrees, seriously jeopardizing food security. Salt tolerance in rice is a quantitative trait controlled by multiple genes, involving many complex physiological processes (Hamam, AM, Coskun, D., Britto, DT, Plett, D. and Kronzucker, HJ (2019) Plasma-membrane electrical responses to salt and osmotic gradients contradict radiotracer kinetics, and reveal Na+-transport dynamics in rice (Oryza sativa L.). Planta 249, 1037-1051.). Currently, the main problem in the identification and gene utilization of salt-tolerant rice germplasm resources is the limited number of major salt-tolerant genes. How to accurately discover new salt-tolerant genes is an important issue facing current rice germplasm resource research. Therefore, using molecular breeding technology to cultivate salt-tolerant rice varieties is of great significance for improving the utilization rate of saline-alkali soils, expanding the rice planting area, and ensuring food security.

[0003] OsCNGC10 belongs to the cyclic nucleotide-gated channel (CNGC) gene family. Cyclic nucleotide-gated ion channels are ligand-gated cation channels, mainly distributed on the plasma membrane, and exist in animals and plants. They are an important component of the eukaryotic signal cascade. The discovery of cyclic adenosine monophosphate (cAMP) stemmed from studies on the effects of epinephrine and glucagon on glycogen phosphorylase activity in canine liver (Rall TW, Sutherland EW, Berthet J. THE RELATIONSHIPOF EPINEPHRINE AND GLUCAGON TOLIVER PHOSPHORYLASE[J]. Journal of Biological Chemistry, 1957, 224(1):463-475). CNGCs are a group of ion transport proteins found in many plants, including Arabidopsis thaliana, barley, rice, and tobacco. They are only active when bound to cyclic nucleotides, making them potential targets for second messenger cyclic nucleotides.

[0004] In recent years, researchers have successively verified the function of CNGCs by overexpression or mutation in plants. Kaplan et al. identified and analyzed the CNGC family of the model plant Arabidopsis thaliana and found that there are 20 members in the Arabidopsis CNGC family, which are distributed in various tissues and organs of Arabidopsis thaliana and participate in the growth and development of Arabidopsis thaliana and perform certain functions in response to external environmental stimuli (Arazi T, Kaplan B, Fromm HA high-affinity calmodulin-bindingsitein a tobacco plasma-membrane channel protein coincides with a characteristicelement of cyclic nucleotide-binding domains[J].Plant Molecular Biology,2000,42(4):591-601,Arazi T,Sunkar R,Kaplan B,et al.A tobacco plasmamembranecalmodulin-binding transporter confers Ni2+tolerance and Pb2+hypersensitivityin transgenic plants[J].The Plant Journal,1999,20(2):171-182). Finka et al. found that mutating GNGCb, which is homologous to the Arabidopsis gene AtCNGC2, in *Phyllostachys nigra* resulted in a phenotype similar to the AtCNGC2 deletion mutant. The loss of function of GNGCb led to a significant increase in Ca2+ influx and intracellular calcium ion concentration under high temperature stress, thereby producing a hyperthermia response (Finka A, Cuendet AFH, Maathuis FJM, et al. Plasma membrane cyclic nucleotide gated calcium channels control land plant thermal sensing and acquired thermotolerance[J].The Plant Cell,2012,24(8):3333-3348).Zhou et al. believed that MdCNGC2 in apple callus is a negative regulator of powdery mildew resistance in apple callus (Zhou H, Bai S, Wang N, et al. CRISPR / Cas9-mediated mutation of MdCNGC2 in apple callus and VIGS-mediated silencing of MdCNGC2 in fruits improve resistance to Botryosphaeria dothidea[J]. Frontiers in plant science, 2020:11). Wang et al. found that OsCNGC9 mediates PAMP-induced Ca2+. 2+ Influx, and this event plays a key role in PAMP-triggered ROS bursts and the induction of PTI-related defense gene expression (Gao QF, Gu LL, Wang HQ, et al. Cyclic nucleotide-gated channel 18 is an essential Ca2+ channel in pollen tube tips for pollentube guidance to ovules in Arabidopsis[J]. ProcNatl Acad Sci USA, 2016, 113(11):3096-3101).

[0005] In summary, the CNGC gene family plays diverse roles in plant responses to biotic and abiotic stresses. However, the function of the CNGC family in regulating salt tolerance in rice remains unclear. Researching its function is of great significance for increasing rice yield, expanding the rice planting area, and ensuring grain production in saline-alkali land rice-producing areas. Summary of the Invention

[0006] The purpose of this invention is to provide a cyclic nucleotide-gated ion channel protein, OsCNGC10, that regulates salt tolerance in rice. The application involves knocking out the OsCNGC10 gene to enhance rice's tolerance to salt stress, providing a new genetic resource for rice salt-tolerant breeding.

[0007] To achieve the above technical objectives, this application adopts the following technical solution:

[0008] (1) Cloning of the OsCNGC10 gene

[0009] RNA was extracted from leaves of the japonica rice variety Nipponbare and synthesized into cDNA using reverse transcriptase Superscript III (purchased from Invitrogen, USA). Reaction conditions: 65℃ for 5 min, 50℃ for 60 min, and 70℃ for 10 min. Using rice genome information, amplification primers OsCNGC10-full-F (5'ATGTTTGGGGCGGGGAAG 3') and OsCNGC10-full-R (5'TTACTCACAGGGTTCAGC 3') were synthesized to amplify the full-length cDNA of the OsCNGC10 gene (2079 bp). PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 2 min 30 sec, 32 cycles; extension at 72℃ for 10 min. The PCR product obtained by amplification was ligated into the pGEM-T vector (purchased from Promega, USA), positive clones were screened and sequenced to obtain the required gene ORF, the sequence of which is the nucleotide sequence shown in SEQ ID NO:1, encoding a 692 amino acid sequence (the sequence shown in SEQ ID NO:2).

[0010] (2) Overexpression of OsCNGC10 gene and construction of CRISPR / Cas9 knockout lines

[0011] This invention constructed the overexpression vector pU1301-OsCNGC10-Flag for this gene (see...). Figure 1 A) and CRISPR / Cas9-OsCNGC10 gene knockout vector ( Figure 1 B) The applicant used Agrobacterium-mediated transformation to transform the two vectors into the japonica rice variety Nipponbare, obtaining positive lines for gene overexpression and CRISPR / Cas9 positive lines. Two homozygous T2 generation overexpression lines (numbered OE-OsCNGC10-11 and OE-OsCNGC10-25) and two CRISPR / Cas9 transformed lines (numbered ko-oscngc10-5 and ko-oscngc-10-16) were selected. Detection primers were designed upstream and downstream of the target site, the corresponding fragments were amplified and sequenced, and materials showing gene editing at the target site, resulting in large fragment deletions or premature translation termination, were screened for subsequent experiments.

[0012] (3) Functional identification of OsCNGC10 gene under salt stress

[0013] This invention evaluated the OsCNGC10 transgenic materials (overexpression lines and CRISPR / Cas9 mutant lines) under 250 mM NaCl salt stress. The results showed that, compared to the control materials, the OsCNGC10 overexpression materials were more sensitive to salt stress on day 12, and the OsCNGC10 mutants exhibited enhanced salt tolerance. Figure 2 The results of the seedling salt stress experiment showed that under 250 mM NaCl stress, the accumulation rate of Pro in OsCNGC10 gene-deficient plants was accelerated, while the accumulation of Pro in overexpression lines was significantly reduced. Figure 3 The malondialdehyde (MDA) content was detected in the wild-type material at 62.90 nmol / g, while the MDA contents of the two overexpression lines were 92.56 and 87.31 nmol / g, respectively. Among these, OE-OsCNGC10-10-11 showed a significantly increased MDA content compared to the wild-type. Figure 4 The analysis of photosynthetic pigment content in rice leaves under salt stress revealed no significant differences in chlorophyll a and chlorophyll b content among different materials. However, the total chlorophyll content of the overexpression materials was significantly lower than that of the wild-type materials, with the two overexpression lines having total chlorophyll contents 0.61 and 0.81 mg / g lower than the wild-type materials, respectively. The total chlorophyll content of the knockout line ko-oscngc10-5 was significantly higher than that of the wild-type material. Figure 5 Preliminary findings indicate that OsCNGC10 negatively regulates salt tolerance in rice seedlings.

[0014] The results of this study indicate that rice OsCNGC10 may have potential functions in salt tolerance, providing a theoretical basis and new germplasm resources for breeding new salt-tolerant rice varieties.

[0015] Advantages of the present invention

[0016] This invention utilizes CRISPR / Cas9 technology to design specific sgRNAs targeting the OsCNGC10 gene, constructing a CRISPR / Cas9 gene-editing mutant that knocks out the OsCNGC10 gene in rice. Genome editing of the stress response factor OsCNGC10 yields new rice germplasm with enhanced stress resistance. This invention also produces OsCNGC10 knockout mutant materials with stronger salt tolerance, which can be directly applied to agricultural production. Therefore, this invention has promising prospects for widespread application, both theoretically and in the creation of new germplasm. Attached Figure Description

[0017] Figure 1 A shows the plasmid map of the constructed OsCNGC10 overexpression vector, and B shows the plasmid map of the constructed OsCNGC10 gene knockout vector.

[0018] Figure 2This is a schematic diagram of plant phenotypes on day 12 under 250 mM NaCl stress. Overexpression lines showed significant wilting, while gene knockout lines exhibited stronger tolerance to salt stress.

[0019] Figure 3 The proline content of wild-type materials, overexpressed materials, and gene knockout materials under salt stress.

[0020] Figure 4 The malondialdehyde (MDA) content of wild-type materials, overexpressed materials, and gene knockout materials under salt stress.

[0021] Figure 5 The chlorophyll content of wild-type materials, overexpression materials, and gene knockout materials under salt stress. Detailed Implementation

[0022] Explanation of the sequence list

[0023] SEQ ID NO: 1 is the nucleotide sequence of the OsCNGC10 gene cloned in this invention.

[0024] SEQ ID NO: 2 is the protein sequence encoded by the OsCNGC10 gene.

[0025] The following embodiments define the present invention and describe the methods for isolating and cloning cDNA segments containing the complete coding region of the OsCNGC10 gene, and for verifying the function of the OsCNGC10 gene. Based on the following description and these embodiments, those skilled in the art can determine the essential features of the present invention, and various changes and modifications can be made to the invention to suit different uses and conditions without departing from the spirit and scope thereof.

[0026] Example 1: Isolation and Cloning of the OsCNGC10 Gene

[0027] (1) Rice RNA extraction and reverse transcription

[0028] Total RNA was extracted from fresh leaves of the wild-type japonica rice variety Nipponbare. The total RNA was extracted using the MiniBEST Plant RNA Extraction Kit, following the instructions of the TaKaRa PrimeScript™ RTreagent Kit with gDNA Eraser. The obtained RNA samples were first subjected to a genomic DNA removal reaction. The DNA removal reaction solution consisted of: 2.0 μL 5×gDNA Eraser Buffer, 1.0 μL gDNA Eraser, 1.0 μg RNA, and 6.0 μL RNase-free ddH2O. After mixing, the mixture was incubated in a dry bath at 42°C for 2 min. The digested mixture was then used for reverse transcription. The reaction solution consisted of: 1.0 μL PrimeScript RT EnzymeMix I, 4.0 μL RT Primer Mix, 4.0 μL 5×PrimeScript Buffer 2, 1.0 μL RNase-Free ddH2O, and 10.0 μL of the digested mixture. Reverse transcription reaction conditions: 37℃, 15 min; 85℃, 5 sec, 4℃ storage.

[0029] (2) Obtaining the OsCNGC10 gene sequence

[0030] The full-length sequence of OsCNGC10 was cloned using cDNA from the japonica rice variety 'Nipponbare' as a template, with forward primer CNGC10-Full-F:(5'ATGTTTGGGGCGGGGAAGGTGGACG 3') and reverse primer CNGC10-Full-R:(5'TTACTCACAGGGTTCAGCTGAAAAAT 3'). PCR reaction conditions were: 94℃ pre-denaturation for 3 min; 28 cycles of 94℃ for 30 sec, 59℃ for 30 sec, and 72℃ for 50 sec; extension at 72℃ for 7 min. The amplified PCR product was ligated into the pGEM-T vector (purchased from Promega, USA), positive clones were screened and sequenced, and positive strains were stored at -80℃. The open reading frame (ORF) of the desired OsCNGC10 gene was obtained, and its nucleotide sequence is shown in SEQ ID NO: 1. The open reading frame (ORF) of the OsCNGC10 gene was determined using Blast X (http: / / www.ncbi.nlm.nih.gov), which contains 692 amino acids. Based on this, the protein sequence encoded by the OsCNGC10 gene is inferred as shown in the sequence listing SEQ ID NO: 2.

[0031] Example 2: Construction of OsCNGC10 gene overexpression and dual-target knockout vector

[0032] (1) Construction of OsCNGC10 gene overexpression vector

[0033] The relevant sequence of the OsCNGC10 gene was downloaded from the Rice Genome Database (RGAP). Primers for PCR amplification (OsCNGC10-R: 5'ATGTTTGGGGCGGGGAAGGTGGACG 3' / OsCNGC10-F: 5'TTACTCACAGGGTTCAGCTGAAAAAT 3') were designed using Primer Premier 5 software. The amplified fragments of the correct size were ligated into the PGEM-Teasy vector. The ligation product was transformed into *E. coli* DH5α, positive clones were selected, plasmids were extracted, and sequencing was performed. Primers for the OsCNGC10 gene with the final vector adapter (OsCNGC10-Flag-R: 5'GAACGATAGCCGGTACCATGTTTGGGGCGGGGAAGG T) were designed using Primer Premier 5 software. 3' / OsCNGC10-Flag-F: 5'CTTTGTAATCGGATCCCTCACAGGGTTCAGCTGAAA3'), using the plasmid obtained in the previous step as a template, was amplified by PCR to obtain the OsCNGC10 gene with the final vector adapter. The pU1301-3×Flag vector was double-digested with restriction endonucleases (KpnI, BamHI), and in-fusion ligation was performed using homologous recombinase to obtain the recombinant final vector pU1301-CNGC10-Flag. The ligation product was transformed into *E. coli*, single colonies were picked and cultured, and after agarose gel electrophoresis to confirm the correct bands, the bacterial culture was sequenced. The plasmid with correct sequencing results was transformed into *Agrobacterium*, single colonies were picked and cultured, and colony PCR was performed. Bacterial cultures with correct band sizes in the colony PCR results were stored at -80℃.

[0034] (2) Construction of OsCNGC10 gene knockout vector

[0035] The method for constructing the target knockout vector used in this invention is based on the tRNA tandem method pioneered by Professor Xie Kabin's research team at Huazhong Agricultural University, with modifications (http: / / crispr.hzau.edu.cn / CRISPR / ). Based on the OsCNGC10 DNA sequence and gene structure, two gRNA synthesis adapter primers (CNGC10-gRNA1-U3F, CNGC10-gRNA1-U3R, CNGC10-gRNA2-U3F, CNGC10-gRNA2-U3R) and adapter primers S5AD5-F, S5AD5-R and L5AD5-F, L5AD5-R required for gRNA ligation into the expression vector pRGEB32 were designed. Using the pGTR plasmid as a template, primers L5AD5-F / CNGC10-gRNA1-U3R, CNGC10-gRNA1-U3F / CNGC10-gRNA2-U3R, and CNGC10-gRNA2-U3R were used. PCR amplification was performed using three primer pairs: 2-U3F / L5AD5-R and gRNA2-U3F / L5AD5-R. The three RCR products were diluted 20-50 times and mixed in equal volumes. 1 μL of this mixture was used as a template for amplification using primer pairs S5AD5-F / S5AD5-R. The resulting products were purified and their concentrations determined. The CRISPR / Cas9 expression vector pRGEB32 was digested with (KpnI, BamHI), and the digested products were purified and recovered to obtain the linearized pRGEB32 vector. The purified PCR product was ligated into the linearized pRGEB32 vector using infusion recombination. The above reaction products were heat-shocked and transformed into *E. coli* DH5α. Single clones were selected for positive detection and sequencing. Positive strains and plasmids were preserved, and the positive plasmids were transformed into *Agrobacterium tumefaciens* EHA105 competent cells.

[0036] Example 3: Genetic transformation of rice

[0037] (1) Induction of callus: Select plump, uniform wild-type Nipponbare seeds and peel off the glumes by hand to ensure the integrity of the seeds. Place the seeds in a sterile conical flask, soak the rice seeds in 75% ethanol for 1 minute, then pour off the ethanol. Then soak them in 0.15% HgCl2 solution for 15-20 minutes. Pour the HgCl2 solution into a mercuric chloride recovery bottle. Finally, wash the seeds 7-8 times with sterile ddH2O. After absorbing the moisture on filter paper, evenly inoculate the seeds onto the surface of the induction medium that has been sterilized and placed for 3 days. Place the medium in a dark incubator at 28℃ and incubate for 45-50 days.

[0038] (2) Subculture: Prepare the subculture medium 2-3 days in advance. The subculture medium formula uses fresh callus induction medium. Sterilize the medium according to the conventional method to make the medium moderately dry (the medium with too much moisture is not conducive to the growth of callus). From the induced callus, select callus that is light yellow in appearance, granular, dry and vigorous, and transfer it into the subculture medium. Incubate in the dark at 28℃ for 20 days.

[0039] (3) Pre-culture: Dispense sterile pre-culture medium into 500mL Erlenmeyer flasks in advance. Before the experiment, add 300μL of 100Mm acetylsalicylic acid and 5mL of 40% glucose to each 250mL medium. Mix well and fill 8-10 plates of medium into each flask. From the subcultured callus, pick out callus that is light yellow, granular, dry and viable, and transfer it into the culture plates of pre-culture medium. Inoculate about 60-80 pieces of callus the size of mung beans into each plate. If the callus is too large, it can be crushed with sterile forceps. Incubate in the dark at 8℃ for 3 days.

[0040] (4) Infection and Co-culture: Two days before the experiment, Agrobacterium strains containing the target gene (e.g., OsCNGC10) were streaked onto Petri dishes containing antibiotics (30 mg / L rifampin and 50 mg / L kanamycin) to activate the bacteria. Suspension medium (100 mL / strain), co-culture medium (250 mL / strain), large Petri dishes, small Petri dishes (lined with absorbent paper and filter paper, sterilized and dried before use), and several 250 mL sterile Erlenmeyer flasks were prepared. The streaked Agrobacterium was scraped into 1 / 2 N6 suspension medium (N6 medium is a commonly used plant tissue culture medium, containing 100 μL LAS + 2 mL 50% glucose), and incubated at 28℃ and 200 rpm for 30 min. Simultaneously, the pre-cultured callus was collected into 250 mL sterile Erlenmeyer flasks while shaking the bacteria. The Agrobacterium culture was poured into the callus and soaked for 30 min. Discard the bacterial suspension. First, invert the Erlenmeyer flask containing the callus tissue onto a sterile dish to absorb the bacterial suspension. Then, spread the callus tissue onto filter paper in a sterile dish, cover it with another sheet of filter paper, and gently press the callus tissue with sterile forceps to absorb the surface bacterial suspension. Allow it to air dry for 3-4 hours. Use a sterile spoon to evenly spread the fully dried callus tissue onto the co-culture medium (it's best not to move it after spreading to reduce contact between the medium and the callus surface and prevent excessive growth of Agrobacterium). Incubate in the dark at 19°C for 3 days.

[0041] (5) Washing and First Screening (S1): Prepare sterile water, large and small dishes (containing absorbent paper and filter paper), several 250mL Erlenmeyer flasks, and prepare the screening medium. Transfer the co-cultured callus to a washing cup, pour in sterile distilled water until the callus is completely submerged, cover and shake for 20-30 seconds, then discard the sterile distilled water. Repeat this process 2-3 times. Add sterile distilled water until the callus is completely submerged, cover and shake to mix, shake for 20-30 seconds, let stand for 5 minutes, then discard the sterile distilled water. Add sterile distilled water until the callus is completely submerged, cover and shake to mix, shake for 20-30 seconds, let stand for 10 minutes. Finally, discard the sterile distilled water, add sterile distilled water containing 500mg / L carbenicillin, and shake at 200rpm for 30 minutes. Discard the distilled water and allow the callus to air dry. The treated callus tissue was transferred to screening medium and cultured in the dark at 28°C for 20 days.

[0042] (6) Second screening (S2): Prepare screening medium. Add 300 μL carbenicillin, 250 μL hygromycin, and 5 mL 50% glucose to each 250 mL medium. After pouring, open the lid on a clean bench and blow with sterile air for 1.5-2 hours. The surface of the screening medium should not be too wet, otherwise it will not be conducive to the inhibition of Agrobacterium and the growth of resistant callus during screening. Select dry callus that is not contaminated with Agrobacterium from the S1 screening medium and place it on the S2 medium (inoculate 25 to 30 callus pieces per plate). Incubate in the dark at 28°C for 20 days.

[0043] (7) Differentiation of callus: Prepare differentiation medium 3-4 days in advance. Select small pieces of pale yellow, dense, and dry resistant callus, inoculate them into differentiation medium, and culture them at 28℃ under light (light intensity 3000 Lux) for 40 days. Seedlings will differentiate in the later stage of culture.

[0044] (8) Rooting culture: Prepare the rooting culture medium 2-3 days in advance. Prepare 4-5 sterile empty dishes; remove the differentiated seedlings from the differentiation culture medium, take only one seedling from each piece of callus, cut off the excessively long leaves and roots with scissors, and put them into rooting tubes, with 1-2 seedlings in each tube; culture in a light culture room (light intensity 3000 Lux) for 15-20 days, and after the roots have grown fully, harden the seedlings for 4-7 days, and then transplant them to the greenhouse.

[0045] Mother liquor formula:

[0046] 1. MSmax stock solution (10X)

[0047]

[0048]

[0049] Dissolve the contents gradually, then add distilled water to bring the volume to 1000 mL.

[0050] 2. MSmin stock solution (100X)

[0051]

[0052] Note: Na2MoO4 must be dissolved separately before mixing with other components, and then diluted with distilled water to a final volume of 1000 mL. Store at room temperature.

[0053] 3. N6max stock solution (10X)

[0054]

[0055] Dissolve the contents gradually, then add distilled water to bring the volume to 1000 mL.

[0056] 4. N6min stock solution (100X)

[0057]

[0058] Dilute to 1000 mL with distilled water and store at room temperature.

[0059] 5. Fe2+-EDTA stock solution (100X)

[0060] Add 300 mL of distilled water and 2.78 g of FeSO4·7H2O to a reagent bottle;

[0061] Add 300 mL of distilled water to another reagent bottle and heat to 70 °C. Then add 3.73 g of Na2EDTA·2H2O and dissolve it. Mix the solutions from the two reagent bottles and keep them at 70 °C for 2 hours. Then add distilled water to make up to 1000 mL and store at 4 °C protected from light.

[0062] 6. Vitamin stock solution (100X)

[0063]

[0064] Add distilled water to a final volume of 1000 mL and store at 4°C.

[0065] 7. AAmax stock solution (10X)

[0066]

[0067] Add distilled water to a final volume of 1000 mL and store at room temperature away from light.

[0068] 8. AAmin stock solution (100X)

[0069]

[0070] Dissolve Na2MoO4 separately, then mix it with other components and add distilled water to bring the volume to 1000 mL. Store at room temperature away from light.

[0071] 9.6-BA stock solution (1 mg / mL)

[0072] Add 100 mg of 6-BA to 1.0 mL of 1 M KOH and shake until the 6-BA dissolves. Then add distilled water to bring the volume to 100 mL and store at room temperature.

[0073] 10. KT stock solution (1 mg / mL)

[0074] Add 100 mg of KT to 1.0 ml of 1 M KOH and shake until KT dissolves. Then add distilled water to bring the volume to 100 mL and store at room temperature.

[0075] 11.2,4-D stock solution (1 mg / mL)

[0076] Add 100 mg of 2,4-D to 1.0 mL of 1 M KOH and shake for 5 min. Then add 10 mL of distilled water and shake until the 2,4-D dissolves. Make up to 100 mL with distilled water and store at room temperature.

[0077] 12.100μM AS stock solution

[0078] AS 0.196g;

[0079] 10 mL of DMSO;

[0080] Aliquot into 1.5mL centrifuge tubes and store at 4°C.

[0081] 13. IAA stock solution (1 mg / mL)

[0082] Add 100mg of IAA to 1.0ml of 1N KOH and shake until the IAA dissolves. Then, bring the volume to 100ml with dH2O and store at room temperature away from light.

[0083] 14. NAA stock solution (1 mg / mL)

[0084] Add 100 mg of NAA to 1.0 mL of 1 M KOH and shake until the NAA dissolves. Then, bring the volume to 100 mL with distilled water and store at room temperature away from light.

[0085] Culture medium formulation:

[0086] 1. Induction medium

[0087]

[0088] Add distilled water to bring the volume to 1000 mL.

[0089] 2. Subculture medium

[0090]

[0091]

[0092] Add distilled water to bring the volume to 1000 mL.

[0093] 3. Pre-culture medium

[0094]

[0095] Add distilled water to a final volume of 250 mL.

[0096] 4. Co-culture medium

[0097]

[0098] Add distilled water to a final volume of 250 mL.

[0099] 5. Suspension culture medium

[0100]

[0101] Add distilled water to bring the volume to 100 mL.

[0102] 6. Screening culture medium

[0103]

[0104] Add distilled water to a final volume of 250 ml. 7. Differentiation culture medium

[0105]

[0106]

[0107] Add distilled water to bring the volume to 1000 mL.

[0108] 8. Rooting medium

[0109]

[0110] Add distilled water to bring the volume to 1000 mL.

[0111] Example 4: Salt tolerance assessment of transgenic materials

[0112] The transgenic materials obtained in Example 3 were cultured to the homozygous T2 generation. Two homozygous T2 generation overexpression lines with consistent growth (numbered OE-OsCNGC10-11 and OE-OsCNGC10-25), two CRISPR / Cas9 transformed lines (numbered ko-oscngc10-5 and ko-oscngc-10-16), and ten wild-type lines were selected for salt stress experiments. Salt stress was assessed using 250 mM NaCl. Phenotypic differences between the overexpression lines, knockout lines, and wild-type lines were observed after 12 days of treatment. Figure 2 ).

[0113] The levels of proline (Pro) and malondialdehyde (MDA) were determined using Solarbio's Proline (Pro) and Malondialdehyde (MDA) assay kits (catalog numbers BC0290 and BC0020) according to the instructions. Figure 3 , Figure 4 ).

[0114] Leaves from the same leaf position were taken, the midrib was removed, and 0.1000g samples were cut with scissors and soaked in 10mL of acetone-anhydrous ethanol. The samples were then incubated in the dark at 26℃ for 24 hours. The absorbance values ​​of chlorophyll A (maximum absorption peak 665nm) and chlorophyll B (maximum absorption peak 649nm) were measured using a spectrophotometer. Following Arnon's (1949) method, the chlorophyll content in each rice variety was calculated, with three replicates for each treatment. Simultaneously, the plant height, root length, and fresh weight of each rice variety were measured. The results are shown below. Figure 5 As shown.

[0115] The results showed that after 12 days of salt treatment, the two OsCNGC10 overexpression lines exhibited significantly higher levels of leaf wilting, curling, and yellowing compared to the wild-type rice Nipponbare. The gene knockout lines showed stronger tolerance to salt stress. This indicates that the OsCNGC10 gene-edited mutant rice exhibits greater salt tolerance.

[0116] In summary, knocking out the OsCNGC10 gene in rice increases the rice's salt tolerance to salt stress.

Claims

1. The application of OsCNGC10 gene knockout in improving rice salt stress tolerance, characterized by: The nucleotide sequence of the rice OsCNGC10 gene is shown in SEQ ID NO:1.

Citation Information

Patent Citations

  • Cyclic nucleotide gated ion channel OsCNCG10 gene for synergistically regulating drought resistance and lodging resistance of rice and application of cyclic nucleotide gated ion channel OsCNCG10 gene

    CN118910119A