Targeting B7H3 antigen-binding protein and its applications

CN119954953BActive Publication Date: 2026-08-14CHONGQING T-MAXIMUM LIFE & HEALTH TECHNOLOGY CO LTD
View PDF 8 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-11-08
Publication Date
2026-08-14

AI Technical Summary

Technical Problem

虽然B7H3 mRNA在正常组织中广泛表达,但是B7H3蛋白表达水平在正常组织中极低或缺失,表明B7H3的蛋白表达受到严格的转录后调控

Benefits of technology

[0067] Other aspects and advantages of this application will readily be apparent to those skilled in the art from the detailed description below. Only exemplary embodiments of this application are shown and described in the following detailed description. As will be appreciated by those skilled in the art, the content of this application enables them to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application pertains. Accordingly, the descriptions in the accompanying drawings and specification of this application are merely exemplary and not restrictive.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004540268410000181
    Figure BDA0004540268410000181
  • Figure BDA0004540268410000182
    Figure BDA0004540268410000182
  • Figure BDA0004540268410000401
    Figure BDA0004540268410000401
Patent Text Reader

Abstract

This application relates to an isolated antigen-binding protein capable of specifically binding to B7H3. This application also provides a method for preparing the isolated antigen-binding protein and its uses.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of biomedicine, specifically to an antigen-binding protein that targets B7H3. Background Technology

[0002] B7H3, also known as CD276, belongs to the B7 family of immunomodulatory proteins and is a type I membrane protein. Its extracellular domain sequence is similar to other members of the B7 family. The B7H3 gene is located on human chromosome 15 and consists of ten exons, with exons 4 to 7 encoding the extracellular IgV-IgC domain. Although B7H3 mRNA is widely expressed in normal tissues, B7H3 protein expression is extremely low or absent in normal tissues, indicating that B7H3 protein expression is strictly regulated post-transcriptionally. In contrast, B7H3 protein is overexpressed in various malignant tumors and is associated with poor prognosis, higher tumor grade and metastasis, drug resistance, and low overall survival.

[0003] In recent years, an increasing number of studies have found that B7H3 molecules are abnormally expressed in various tumor tissues, such as ovarian cancer, breast cancer, lung cancer, kidney cancer, colorectal cancer, and prostate cancer. Retrospective clinical case analyses have revealed a correlation between B7H3 expression and clinicopathological characteristics. Survival analysis has shown that cases with high B7H3 expression have poor prognosis and high mortality rates. Furthermore, high levels of soluble B7H3 (sB7H3) have been found in the peripheral blood of cancer patients. In addition, studies have found that B7H3 is associated with transplant rejection and autoimmune pathology; grafts transfected with the B7H3 gene can suppress the activity of host T cells, thereby prolonging graft survival. These findings suggest that B7H3 is an important negative co-stimulatory molecule with significant research and application value.

[0004] There is an urgent need in this field to develop new and effective specific antibodies against B7H3. Summary of the Invention

[0005] This application provides an isolated antigen-binding protein targeting B7H3, which has one or more of the following properties: 1) specific binding to B7H3; 2) strong affinity for B7H3; 3) ability to detect the expression level of B7H3; 4) ability to diagnose B7H3-related diseases; and 5) ability to prevent and / or treat diseases and / or symptoms. This application also provides polypeptide molecules comprising the isolated antigen-binding protein, chimeric antigen receptors, immunoconjugates, nucleic acid molecules encoding the isolated antigen-binding protein, expression vectors, host cells, immunoconjugates comprising the antigen-binding protein, pharmaceutical compositions, methods for preparing the isolated antigen-binding protein, and uses of the isolated antigen-binding protein of this application.

[0006] On the one hand, this application provides an isolated antigen-binding protein that specifically binds to B7H3, comprising HCDR1, HCDR2, and HCDR3 selected from any of the following groups:

[0007] a) HCDR1 contains the amino acid sequence shown in SEQ ID NO:1, HCDR2 contains the amino acid sequence shown in SEQ ID NO:2, and HCDR3 contains the amino acid sequence shown in SEQ ID NO:3;

[0008] b) HCDR1 contains the amino acid sequence shown in SEQ ID NO:7, HCDR2 contains the amino acid sequence shown in SEQ ID NO:8, and HCDR3 contains the amino acid sequence shown in SEQ ID NO:9;

[0009] c) HCDR1 contains the amino acid sequence shown in SEQ ID NO:12, HCDR2 contains the amino acid sequence shown in SEQ ID NO:13, and HCDR3 contains the amino acid sequence shown in SEQ ID NO:3; or

[0010] d) HCDR1 contains the amino acid sequence shown in SEQ ID NO:14, HCDR2 contains the amino acid sequence shown in SEQ ID NO:15, and HCDR3 contains the amino acid sequence shown in SEQ ID NO:16.

[0011] In some embodiments, it includes LCDR1, LCDR2 and LCDR3 selected from any of the following groups:

[0012] a) The LCDR1 contains the amino acid sequence shown in SEQ ID NO:4, the LCDR2 contains the amino acid sequence shown in SEQ ID NO:5, and the LCDR3 contains the amino acid sequence shown in SEQ ID NO:6;

[0013] b) The LCDR1 contains the amino acid sequence shown in SEQ ID NO:10, the LCDR2 contains the amino acid sequence shown in SEQ ID NO:11, and the LCDR3 contains the amino acid sequence shown in SEQ ID NO:6; or

[0014] c) The LCDR1 contains the amino acid sequence shown in SEQ ID NO:17, the LCDR2 contains the amino acid sequence shown in SEQ ID NO:18, and the LCDR3 contains the amino acid sequence shown in SEQ ID NO:19.

[0015] In some embodiments, it includes a heavy chain variable region (VH) containing the amino acid sequence shown in SEQ ID NO:20.

[0016] In some embodiments, it includes a light chain variable region (VL) containing the amino acid sequence shown in SEQ ID NO:21.

[0017] In some embodiments, it comprises a heavy chain variable region of the amino acid sequence shown in SEQ ID NO: 20 and a light chain variable region of the amino acid sequence shown in SEQ ID NO: 21.

[0018] In some implementations, it includes a heavy chain constant region, which may be derived from human or rabbit antibody heavy chain constant regions.

[0019] In some implementations, it includes a heavy chain constant region, which may be derived from the IgG heavy chain constant region.

[0020] In some embodiments, its heavy chain constant region may contain the amino acid sequence shown in SEQ ID NO: 22.

[0021] In some implementations, it includes a light chain constant region, which may be derived from humans or rabbits.

[0022] In some implementations, it includes a light chain constant region, which may be derived from the κ or λ chain of a human or rabbit.

[0023] In some embodiments, its light chain constant region may contain the amino acid sequence shown in SEQ ID NO: 23.

[0024] In some embodiments, it comprises an antibody heavy chain HC, said HC comprising a heavy chain of the amino acid sequence shown in SEQ ID NO: 24.

[0025] In some embodiments, it comprises an antibody light chain LC, the LC comprising a light chain containing the amino acid sequence shown in SEQ ID NO: 25.

[0026] In some embodiments, it includes an antibody or an antigen-binding fragment thereof.

[0027] In some embodiments, the antigen-binding fragment includes Fab, Fab', Fv fragments, F(ab')2, F(ab)2, scFv, di-scFv, and / or dAb.

[0028] In some embodiments, when the antigen-binding protein is scFv, a linker peptide may be present between the variable regions of its heavy and light chains.

[0029] In some embodiments, the antibody is selected from one or more of the following groups: monoclonal antibody, rabbit antibody, chimeric antibody, humanized antibody, recombinant antibody, single-chain antibody, bifunctional antibody, trifunctional antibody, and tetrafunctional antibody.

[0030] In some embodiments, the chimeric antibody includes human, goat, monkey, dog, mouse, and rabbit chimeric antibodies.

[0031] In some embodiments, the antigen-binding protein is an IgG antibody.

[0032] In some embodiments, the antigen-binding protein is labeled.

[0033] In some embodiments, the labeling includes fluorescent labeling, enzyme labeling, biotin labeling, or radioactive labeling.

[0034] On the other hand, this application provides a polypeptide molecule comprising the isolated antigen-binding protein described in this application.

[0035] On the other hand, this application provides a chimeric antigen receptor comprising the isolated antigen-binding protein described in this application.

[0036] On the other hand, this application provides an immunoconjugate comprising the isolated antigen-binding protein described in this application.

[0037] On the other hand, this application provides a nucleic acid molecule that encodes the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, or the chimeric antigen receptor described in this application.

[0038] On the other hand, this application provides a carrier containing the nucleic acid molecules described in this application.

[0039] On the other hand, this application provides a cell comprising the isolated antigen-binding protein described in this application, the chimeric antigen receptor described in this application, the nucleic acid molecule described in this application, or the vector described in this application.

[0040] On the other hand, this application provides a pharmaceutical composition comprising the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immunoconjugate described in this application, the nucleic acid molecule described in this application, the carrier described in this application, and / or the cell described in this application, as well as a pharmaceutically acceptable carrier.

[0041] On the other hand, this application provides a reagent comprising the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immunoconjugate described in this application, the nucleic acid molecule described in this application, the carrier described in this application, the cell described in this application, and / or the pharmaceutical composition described in this application.

[0042] On the other hand, this application provides a detection plate comprising the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immunoconjugate described in this application, the nucleic acid molecule described in this application, the carrier described in this application, the cell described in this application, and / or the pharmaceutical composition described in this application.

[0043] On the other hand, this application provides a kit comprising the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immunoconjugate described in this application, the nucleic acid molecule described in this application, the carrier described in this application, the cell described in this application, the pharmaceutical composition described in this application, the reagent described in this application, and / or the detection plate described in this application.

[0044] In some embodiments, it includes negative control reagents and / or materials, and / or positive control reagents and / or materials.

[0045] On the other hand, this application provides a method for preparing the isolated antigen-binding protein described in this application.

[0046] In some implementations, it includes the steps of:

[0047] a) Culturing the cells described in this application; and / or

[0048] b) Isolate the antigen-binding protein from the culture, said antigen-binding protein being the antigen-binding protein described in this application.

[0049] On the other hand, this application provides a method for detecting B7H3 in a sample, which includes using the antigen-binding protein isolated by this application, the polypeptide molecule of this application, the chimeric antigen receptor of this application, the immunoconjugate of this application, the nucleic acid molecule of this application, the vector of this application, the cell of this application, the pharmaceutical composition of this application, the reagent of this application, the detection plate of this application, and / or the kit of this application.

[0050] On the other hand, this application provides the use of the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immune conjugate described in this application, the nucleic acid molecule described in this application, the carrier described in this application, the cell described in this application, and / or the pharmaceutical composition described in this application in the preparation of a medicament for the prevention and / or treatment of diseases and / or conditions.

[0051] In some embodiments, the disease and / or symptom includes diseases and / or symptoms related to B7H3.

[0052] In some embodiments, the disease and / or symptom includes a tumor.

[0053] In some embodiments, the diseases and / or conditions include adrenocortical carcinoma, bladder cancer, breast cancer, bile duct cancer, colorectal cancer, lymphoma, esophageal cancer, glioma, neuroblastoma, head and neck squamous cell carcinoma, kidney cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, sarcoma, melanoma, gastric cancer, thymic cancer, endometrial cancer, and / or cervical cancer.

[0054] On the other hand, this application provides the use of the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immunoconjugate described in this application, the nucleic acid molecule described in this application, the carrier described in this application, the cell described in this application, and / or the pharmaceutical composition described in this application in the preparation of a detection reagent.

[0055] In some embodiments, the detection reagent is used for:

[0056] a) Detect B7H3 in the sample;

[0057] b) Detect endogenous B7H3 protein in tumor cells;

[0058] c) Detect tumor cells expressing B7H3;

[0059] d) Detect the expression level of B7H3 in patient biosamples to predict or determine the prognosis and / or progression of the disease and / or condition;

[0060] e) Detect the expression level of B7H3 in patient biosamples to determine the patient population to be treated with B7H3-targeted therapy, wherein patients are treated with B7H3-targeted therapy when the expression level of B7H3 is moderate or high;

[0061] f) Detecting the expression level of B7H3 in patient biosamples to predict or determine the efficacy of B7H3-targeted therapy in said patients, wherein a moderate or high expression level of B7H3 indicates therapeutic efficacy with B7H3-targeted therapy; and / or

[0062] g) Detect the expression level of B7H3 in the patient's biological sample to modify the patient's treatment regimen, wherein when the expression level of B7H3 is moderate or high, the treatment regimen is modified to include B7H3-targeted therapy.

[0063] In some embodiments, the detection includes immunohistochemical detection, immunofluorescence detection, flow cytometry detection, enzyme-linked immunosorbent assay (ELISA), protein / peptide microarray detection, Western blotting detection, microbead immunoassay, and / or microfluidic immunoassay.

[0064] In some implementations, the patient is a tumor or cancer patient.

[0065] In some implementations, the patient is a patient with a B7H3-related tumor or cancer.

[0066] In some embodiments, the cancer or tumor includes: bladder cancer, breast cancer, bile duct cancer, colorectal cancer, lymphoma, esophageal cancer, glioma, neuroblastoma, head and neck squamous cell carcinoma, kidney cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, sarcoma, melanoma, gastric cancer, thymic cancer, endometrial cancer and / or cervical cancer.

[0067] Other aspects and advantages of this application will readily be apparent to those skilled in the art from the detailed description below. Only exemplary embodiments of this application are shown and described in the following detailed description. As will be appreciated by those skilled in the art, the content of this application enables them to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application pertains. Accordingly, the descriptions in the accompanying drawings and specification of this application are merely exemplary and not restrictive. Attached Figure Description

[0068] The specific features of the invention involved in this application are shown in the appended claims. The features and advantages of the invention can be better understood by referring to the exemplary embodiments and drawings described in detail below. A brief description of the drawings is as follows:

[0069] Figure 1 The image shows the immunohistochemical results of antibodies obtained through screening of B7H3 positive and negative cell lines, which can be used for B7H3 immunohistochemical detection.

[0070] Figure 2The image shown is an SDS-PAGE image of the purified B7H3 antibody from this application. The antibody was stained with Coomassie Brilliant Blue, and 3 μg was loaded into each well.

[0071] Figure 3 The display shows the affinity of the B7H3 antibody of this application for the B7H3 antigen detected by ELISA and the calculation of EC50.

[0072] Figure 4A The data shown is the immunohistochemical (IHC) effective concentration (cell line data) of the B7H3 antibody in this application.

[0073] Figure 4B The displayed value is the effective concentration of the B7H3 antibody by immunohistochemistry (IHC) (clinical tissue data).

[0074] Figure 4C The figure shows the optimal concentration for immunohistochemistry (IHC) of B7H3 antibody.

[0075] Figure 5 The results shown are from testing the sensitivity of the B7H3 antibody in this application using glioma as an example.

[0076] Figure 6 This demonstrates that the B7H3 antibody of this application has the specificity to detect the B7H3 protein.

[0077] Figure 7 The results show a comparison of the immunohistochemical staining performance of the B7H3 antibody of this application and the commercial B7H3 antibody in B7H3-positive and negative cell lines.

[0078] Figure 8 The results show a comparison of the immunohistochemical staining performance of the B7H3 antibody of this application and the commercial B7H3 antibody in clinical samples.

[0079] Figure 9 This demonstrates that the B7H3 antibody of this application has the ability to detect B7H3 protein in a variety of tumors.

[0080] Figure 10A This demonstrates that the B7H3 antibody of this application can accurately detect B7H3 protein expressed at different levels in glioma samples.

[0081] Figure 10B The image shows the staining of the B7H3 antibody and negative control IgG antibody described in this application in negative and positive cell line control slides. Detailed Implementation

[0082] The following specific embodiments illustrate the implementation of the invention. Those skilled in the art can easily understand other advantages and effects of the invention from the content disclosed in this specification.

[0083] Terminology Definition

[0084] In this application, the terms "B7H3" and "B7-H3" are used interchangeably. B7H3, also known as CD276, generally refers to B7H3 and the gene encoding it. B7H3 belongs to the B7 immune co-stimulatory and co-inhibitory family and is a type I transmembrane protein. Human B7H3 has two isoforms, 2Ig-B7-H3 and 4Ig-B7H3, and mouse B7H3 has one isoform, 2Ig-B7-H3. Human 2Ig-B7-H3 and mouse 2Ig-B7-H3 share 88% amino acid identity. B7-H3 has immunosuppressive functions, reducing the release of type I interferon (IFN) from T cells and decreasing the cytotoxicity of NK cells. "B7H3" includes the complete B7H3 and its fragments, as well as functional variants, isoforms, species homologs, derivatives, and analogs of B7H3. In this application, the B7H3 may include human B7H3. For example, the login number of person B7H3 in Uniprot could be Q5ZPR3.

[0085] In this application, the term "isolated" generally refers to something obtained artificially from its natural state. If a substance or component is found in nature as an "isolated" substance, it may be due to an alteration of its natural environment, the isolation of the substance from its natural environment, or both. For example, a certain unisolated polynucleotide or polypeptide may naturally exist in the body of a living animal, and a high-purity identical polynucleotide or polypeptide isolated from this natural state is called isolated. The term "isolated" does not exclude the presence of artificial or synthetic substances, nor does it exclude the presence of other impurities that do not affect the activity of the substance.

[0086] In this application, the term "isolated antigen-binding protein" generally refers to a protein that has antigen-binding ability after being removed from its native state. This "isolated antigen-binding protein" may include a portion that binds to an antigen and, optionally, allow the antigen-binding portion to employ a framework or scaffold portion that promotes the antigen-binding portion's conformation for binding to the antigen. The antigen-binding protein may include, for example, an antibody-derived protein framework region (FR) or an alternative protein framework region or artificial framework region having a transplanted CDR or CDR derivative. Such frameworks include, but are not limited to, antibody-derived framework regions containing mutations introduced, for example, to stabilize the three-dimensional structure of the antigen-binding protein, and fully synthetic framework regions containing, for example, biocompatible polymers. See, for example, Korndorfer et al., 2003, Proteins: Structure, Function, and Bioinformatics, 53(1):121-129 (2003); Roque et al., Biotechnol. Prog. 20:639-654 (2004). The antigen-binding protein may include an antibody. Examples of antigen-binding proteins include, but are not limited to: rabbit antibodies, human antibodies, humanized antibodies; chimeric antibodies; recombinant antibodies; single-chain antibodies; bifunctional antibodies; trifunctional antibodies; tetrafunctional antibodies; Fab, Fab', Fv fragments, F(ab')2, F(ab)2, scFv, di-scFv, dAb, IgD antibodies; IgE antibodies; IgM antibodies; IgG1 antibodies; IgG2 antibodies; IgG3 antibodies; or IgG4 antibodies and fragments thereof.

[0087] In this application, the term "CDR," also known as "complementarity-determining region," generally refers to a region within the variable structural domain of an antibody whose sequence is highly variable and / or forms a structurally defining loop. Typically, an antibody comprises six CDRs: three in the VH (HCDR1, HCDR2, HCDR3) and three in the VL (LCDR1, LCDR2, LCDR3). In some embodiments, naturally occurring camel antibodies consisting only of the heavy chain can function normally and stably even in the absence of the light chain. Antibody CDRs can be determined using various coding systems, such as CCG, Kabat, AbM, Chothia, IMGT, and a combination of Kabat / Chothia, which are known in the art.

[0088] In this application, the terms "variable domain" and "variable region" are used interchangeably, generally referring to a portion of the antibody heavy chain and / or light chain. The variable domains of the heavy and light chains can be respectively referred to as "V..." H " and "V L (or referred to as "VH" and "VL" respectively). These domains are usually the most varied parts of the antibody (relative to other antibodies of the same type) and contain antigen-binding sites.

[0089] In this application, the term "variable" generally refers to the fact that certain segments of the variable domain may differ significantly in sequence between antibodies. The variable domain mediates antigen binding and determines the specificity of a particular antibody for its specific antigen. However, variability is not uniformly distributed across the entire variable domain. It is typically concentrated in three segments within the light and heavy chain variable domains, known as hypervariable regions (CDRs or HVRs). The more conserved portions of the variable domain are called framework regions (FRs). The variable domains of the natural heavy and light chains each contain four FR regions, most of which are β-sheet conformations linked by three CDRs forming a ring link, and in some cases forming part of a β-sheet structure. The CDRs in each chain are held together closely by the FR regions, and CDRs from the other chain together promote the formation of the antigen-binding site of the antibody (see Kabat et al, Sequences of Immunological Interest, Fifth Edition, National Institute of Health, Bethesda, MD. (1991)).

[0090] In this application, the term "antibody" generally refers to an immunoglobulin or a fragment thereof or a derivative thereof, encompassing any polypeptide that includes an antigen-binding site, whether it is produced in vitro or in vivo. This term includes, but is not limited to, polyclonal, monoclonal, single-specific, multi-specific, non-specific, humanized, single-chain, chimeric, synthetic, recombinant, hybrid, mutated, and transplanted antibodies. Unless otherwise modified by the term "complete," such as in "complete antibody," for the purposes of this invention, the term "antibody" also includes antibody fragments such as Fab, F(ab')2, Fv, scFv, Fd, dAb, and other antibody fragments that maintain antigen-binding function (e.g., specific binding to B7H3). Typically, such fragments should include an antigen-binding domain. The basic 4-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light chains (LC) and two identical heavy chains (HC). IgM antibodies consist of five basic heterotetrameric units and a polypeptide chain called the J chain, containing 10 antigen-binding sites. IgA antibodies consist of 2-5 basic tetrameric units that can polymerize with the J chain to form multivalent combinations. For IgG, a tetrameric unit is typically about 150,000 Daltons. Each L chain is linked to an H chain by a covalent disulfide bond, and two H chains are linked to each other by one or more disulfide bonds depending on the H chain isoform. Each H and L chain also has regularly spaced intrachain disulfide bridging bonds. Each H chain has a variable domain (VH) at its N-terminus, followed by three constant domains (CH) for α and γ chains, and four CH domains for μ and ε isoforms. Each L chain has a variable domain (VL) at its N-terminus and a constant domain at its other end. VL corresponds to VH, and CL corresponds to the first constant domain (CH1) of the heavy chain. Specific amino acid residues are thought to form interfaces between the variable domains of the light and heavy chains. VH and VL pair together to form a single antigen-binding site. For the structure and properties of different classes of antibodies, see, for example, Basic and Clinical Immunology, 8th Edition, Daniel P. Sties, Abba I. Terr and Tristram G. Parsolw (eds), Appleton & Lange, Norwalk, Conn., 1994, p. 71 and Chapter 6. L chains from any vertebrate species can be classified into one of two distinct types, called κ and λ, based on the amino acid sequence of their constant domains. Immunoglobulins can be classified into different classes or isotypes based on the amino acid sequence of their heavy chain (CH) constant domains. Currently, there are five classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, with heavy chains named α, δ, ε, γ, and μ, respectively.

[0091] In this application, the term "antigen-binding fragment" generally refers to one or more fragments having the ability to specifically bind to an antigen (e.g., B7H3). In this application, the antigen-binding fragment may include Fab, Fab', F(ab)2, Fv fragments, F(ab')2, scFv, di-scFv, and / or dAb.

[0092] In this application, the term "Fab" generally refers to the antigen-binding fragment of an antibody. As described above, an intact antibody can be digested using papain. After papain digestion, the antibody produces two identical antigen-binding fragments, namely the "Fab" fragment, and a residual "Fc" fragment (i.e., the Fc region, as above). The Fab fragment can consist of a complete L chain with a variable region of a heavy chain and the H chain (V... H The first constant region (C) H 1) Composition.

[0093] In this application, the term "Fab' fragment" generally refers to a monovalent antigen-binding fragment of a human monoclonal antibody, which is slightly larger than the Fab fragment. For example, the Fab' fragment may include all light chains, all heavy chain variable regions, and all or part of the first and second constant regions of the heavy chain. For example, the Fab' fragment may also include part or all of the 220-330 amino acid residues of the heavy chain.

[0094] In this application, the term "F(ab')2" generally refers to an antibody fragment produced by digesting an intact antibody with pepsin. The F(ab')2 fragment contains two Fab fragments held together by disulfide bonds and a partial hinge region. The F(ab')2 fragment has bivalent antigen-binding activity and is capable of cross-linking antigens.

[0095] In this application, the term "Fv fragment" generally refers to a monovalent antigen-binding fragment of a human monoclonal antibody, comprising all or part of the heavy chain variable region and light chain variable region, and lacking the heavy chain constant region and light chain constant region. The heavy chain variable region and light chain variable region include, for example, CDRs. For example, an Fv fragment comprises all or part of the amino-terminal variable region of about 110 amino acids of the heavy and light chains.

[0096] In this application, the term "scFv" generally refers to a fusion protein comprising at least one antibody fragment including a variable region comprising a light chain and at least one antibody fragment including a variable region comprising a heavy chain, wherein the light and heavy chain variable regions are adjacent (e.g., via a synthetic linker, such as a short, flexible peptide linker) and are capable of being expressed as a single-chain polypeptide, and wherein the scFv retains the specificity of the intact antibody from which it is derived. Unless otherwise specified, as used in this application, the scFv may have the VL and VH variable regions in any order (e.g., relative to the N-terminus and C-terminus of the polypeptide), and the scFv may comprise VL-linker-VH or may comprise VH-linker-VL.

[0097] In this application, the term "dAb" generally refers to an antigen-binding fragment having a VH domain, a VL domain, or having either a VH domain or a VL domain, for example, Ward et al. (Nature, 1989 Oct 12; 341(6242): 544-6), Holt et al., Trends Biotechnol., 2003, 21(11): 484-490; and other published patent applications, such as WO 06 / 030220, WO 06 / 003388, and Domantis Ltd. The term "dAb" generally includes sdAb. The term "sdAb" generally refers to a single-domain antibody. A single-domain antibody generally refers to an antibody fragment consisting only of the variable region (VH domain) of the antibody heavy chain or the variable region (VL) of the antibody light chain.

[0098] In this application, the term "VHH" generally refers to the variable antigen-binding domain of heavy chain antibodies derived from camels (camels, dromedaries, llamas, alpacas, etc.) (see Nguyen VK et al., 2000, The EMBO Journal, 19, 921-930; Muyldermans S., 2001, J Biotechnol., 74, 277-302; and review Vanlandschoot P. et al., 2011, Antiviral Research 92, 389-407). VHH may also be referred to as nanobody (Nb).

[0099] In this application, the term "monoclonal antibody" generally refers to an antibody molecule preparation consisting of a single molecule. Monoclonal antibodies typically exhibit high specificity against a single antigenic site. Moreover, unlike conventional polyclonal antibody preparations (which usually contain different antibodies targeting different determinants), each monoclonal antibody targets a single determinant on the antigen. In addition to their specificity, monoclonal antibodies have the advantage that they can be synthesized through hybridoma culture without contamination by other immunoglobulins. The modifier "monoclonal" indicates the characteristic of antibodies obtained from a substantially homogeneous group of antibodies and is not to be interpreted as requiring the production of antibodies through any particular method. For example, the monoclonal antibodies used in this application can be prepared in hybridoma cells or through recombinant DNA methods.

[0100] In this application, the term "chimeric antibody" generally refers to an antibody in which the variable region is derived from one species and the constant region is derived from another species. Typically, the variable region is derived from an antibody from a laboratory animal ("parental antibody") and the constant region is derived from a human antibody, such that the resulting chimeric antibody is less likely to induce an adverse immune response in human individuals compared to parental (e.g., rabbit-derived) antibodies.

[0101] In this application, the term "humanized antibody" generally refers to an antibody in which some or all of the amino acids outside the CDR region of a non-human antibody (e.g., a rabbit antibody) are replaced by corresponding amino acids derived from human immunoglobulins. Small additions, deletions, insertions, substitutions, or modifications of amino acids within the CDR region are also permissible, as long as they retain the antibody's ability to bind to a specific antigen. Humanized antibodies may optionally contain at least a portion of the constant region of human immunoglobulins. "Humanized antibodies" retain antigen specificity similar to the original antibody. The "humanized" form of a non-human (e.g., rabbit) antibody may minimally contain a chimeric antibody with a sequence derived from a non-human immunoglobulin. In some cases, CDR region residues in a human immunoglobulin (receptor antibody) may be replaced with CDR region residues from a non-human species (donor antibody) (such as an alpaca, mouse, rat, rabbit, or non-human primate) having the desired properties, affinity, and / or capabilities. In some cases, FR region residues in a human immunoglobulin may be replaced with corresponding non-human residues. Furthermore, humanized antibodies may contain amino acid modifications not found in receptor antibodies or in donor antibodies. These modifications can be made to further improve antibody performance, such as binding affinity.

[0102] The term "fully human antibody" generally refers to an antibody that contains only the sequence of human immunoglobulin proteins. If it is produced in mice, in mouse cells, or in hybridomas derived from mouse cells, then a fully human antibody may contain mouse sugar chains. Similarly, "mouse antibody" or "rat antibody" refers to an antibody that contains only the sequence of mouse or rat immunoglobulins, respectively. Fully human antibodies can be generated in humans or in transgenic animals with germline sequences of human immunoglobulins by phage display or other molecular biology methods. Exemplary techniques that can be used to manufacture antibodies are described in U.S. Patents: 6,150,584, 6,458,592, and 6,420,140. Other techniques, such as the use of libraries, are known in the art.

[0103] In this application, the term "labeled" is intended to include both direct labeling by conjugating a detectable substance to an antigen-binding protein and indirect labeling by reacting with another directly labeled reagent. Examples of indirect labeling include using a fluorescently labeled secondary antibody to detect a primary antibody, such that it can be detected using a fluorescently labeled streptavidin. Examples of labels include, but are not limited to, the following: radioisotopes or radionuclides (e.g., 3H, 14C, 35S, 90Y, 99Tc, 111In, 125I, 131I, 177Lu, 166Ho, or 153Sm); fluorescent labels (e.g., FITC, rhodamine, lanthanide phosphors); enzyme labels (e.g., horseradish peroxidase, luciferase, alkaline phosphatase); chemiluminescent markers; biotinyl groups; predetermined polypeptide epitopes recognized by secondary reporter genes (e.g., leucine zipper pairs, binding sites of secondary antibodies, metal-binding domains, epitope tags); and magnetizing agents, such as gadolinium chelates.

[0104] In this application, the terms "peptide molecule," "peptide," and "synthetic peptide" are used interchangeably and generally refer to a polymer of amino acid residues. The term "fusion protein" generally refers to a polypeptide having at least two parts covalently linked together. For example, a polypeptide molecule can comprise a fusion protein. Each part can be a polypeptide with different properties. These properties can be biological properties, such as in vitro or in vivo activity. These properties can also be simple chemical or physical properties, such as binding to a target molecule, catalysis of a reaction, etc. The two parts can be directly linked by a single peptide bond or through a peptide linker.

[0105] In this application, the term "Chimeric Antigen Receptor (CAR)" generally refers to a fusion protein comprising an extracellular domain capable of binding antigens and at least one intracellular domain. CARs are a core component of chimeric antigen receptor T cells (CAR-T cells) and may include an antigen-binding domain (e.g., tumor-specific antigens and / or tumor-associated antigens), a transmembrane domain, a co-stimulatory domain, and an intracellular signaling domain. In this application, the CAR may be combined with the T cell receptor-activating intracellular domain based on the antigen specificity of an antibody (e.g., B7H3). Genetically modified T cells expressing CARs can specifically recognize and eliminate malignant cells expressing target antigens.

[0106] In this application, the term "nucleic acid molecule" generally refers to a nucleotide, deoxyribonucleotide, or ribonucleotide of any length in an isolated form, or an analogue isolated from its natural environment or synthesized artificially.

[0107] In this application, the term "vector" generally refers to a nucleic acid delivery vehicle that can insert a polynucleotide encoding a protein into itself and enable the protein to be expressed. Vectors can be used to transform, transduce, or transfect host cells, allowing the genetic material elements they carry to be expressed within the host cells. For example, vectors can include: plasmids; phage particles; Cos plasmids; artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC); bacteriophages such as λ phage or M13 phage; and animal viruses. Animal viruses used as vectors can include retrotranscriptoviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomaviruses (such as SV40). A vector may contain multiple elements controlling expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, vectors may contain a replication initiation site. The carrier may also include components that help it enter the cell, such as viral particles, liposomes, or protein coats, but not only these substances.

[0108] In this application, the term "cell" generally refers to a single cell, cell line, or cell culture that may be or is already a recipient of a subject plasmid or vector, including the nucleic acid molecules or vectors described in this invention. Cells may include the progeny of a single cell. Due to natural, accidental, or intentional mutations, the progeny may not necessarily be identical to the original parent cell (in terms of the morphology of the total DNA complement or in the genome). Cells may include cells transfected in vitro using the vectors described in this application. Cells may be bacterial cells (e.g., *E. coli*), yeast cells, or other eukaryotic cells, such as COS cells, Chinese hamster ovary (CHO) cells, CHO-K1 cells, LNCAP cells, HeLa cells, HEK293 cells, COS-1 cells, and NSO cells.

[0109] In this application, the term "immunoconjugate" generally refers to a conjugate formed by conjugating the other reagent (e.g., chemotherapeutic agents, radioactive elements, cell growth inhibitors, and cytotoxic agents) with the antibody or its antigen-binding fragment (e.g., covalently linked by a linker molecule), which can deliver the other reagent to the target cell (e.g., tumor cell) by specifically binding the antibody or its antigen-binding fragment to the antigen on the target cell.

[0110] In this application, the term "pharmaceutical composition" generally refers to a composition for the prevention / treatment of a disease or condition. The pharmaceutical composition may comprise the isolated antigen-binding protein described in this application, the nucleic acid molecule described in this application, the carrier described in this application, and / or the cell described in this application, and optionally a pharmaceutically acceptable adjuvant. Furthermore, the pharmaceutical composition may also comprise suitable formulations of one or more (pharmaceutically effective) carriers, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers, and / or preservatives. The acceptable components of the composition are preferably non-toxic to the recipient at the dosage and concentration used. The pharmaceutical compositions of the present invention include, but are not limited to, liquid, freeze-dried, and lyophilized compositions.

[0111] In this application, the term "pharmaceutically acceptable carrier" generally includes pharmaceutically acceptable carriers, excipients, or stabilizers that are non-toxic to cells or mammals exposed thereto at the doses and concentrations employed. Physiologically acceptable carriers may include, for example, buffers, antioxidants, low molecular weight (less than about 10 residues) peptides, proteins, hydrophilic polymers, amino acids, monosaccharides, disaccharides and other carbohydrates, chelating agents, sugar alcohols, salt-forming anti-charge ions such as sodium; and / or nonionic surfactants.

[0112] In this application, the term "kit" generally refers to a combination of reagents and other materials. A kit is intended to contain reagents such as buffers, protein stabilizing agents, signal generation systems (e.g., fluorescence signal generation systems), antibodies, control proteins, and test containers (e.g., microtiter plates, etc.). The term "kit" is not intended to be limited to a specific combination of reagents and / or other materials. For example, a kit may also include instructions for using the reagents. Test kits can be packaged in any suitable manner, typically having components in a single container or (if necessary) multiple containers, along with instructions for performing the test. For example, a kit may also include reagents and / or materials for quality control, such as negative and / or positive control samples, and negative and / or positive control reagents. Kits can be prepared using a variety of methods known in the art. For example, positive control samples may include samples known to express the target protein, and negative control samples may include samples known not to express the target antigen.

[0113] In this application, the term "subject" generally refers to a human or non-human animal, including but not limited to cats, dogs, horses, pigs, cows, sheep, rabbits, mice, rats, or monkeys.

[0114] In this application, the term "prevention and / or treatment" includes not only the prevention and / or treatment of a disease, but also generally includes preventing the onset of the disease, slowing or reversing the disease progression, preventing or slowing the onset of one or more symptoms associated with the disease, reducing and / or alleviating one or more symptoms associated with the disease, reducing the severity and / or duration of the disease and / or any symptoms associated with it, and / or preventing further increase in the severity of the disease and / or any symptoms associated with it, and preventing, reducing or reversing any physiological damage caused by the disease and any pharmacological effects that are generally beneficial to the patient being treated.

[0115] In this application, the term "diagnosis" (and its grammatical variations such as "diagnostics" or "diagnostic") generally refers to the identification or classification of a molecular or pathological state, disease, or ailment. For example, a diagnosis may include the identification or classification of cancer, or the identification or classification of a cancer patient who may benefit from a particular treatment regimen. For example, "diagnosis" may refer to the identification of a specific type of cancer. "Diagnosis" may also refer to the classification of a specific cancer subtype, for example, by histopathological criteria or molecular characteristics (e.g., a subtype characterized by the expression of one or a group of biomarkers or a specific gene or a protein encoded by said gene). "Diagnosis" may include the steps of detection and / or the steps of interpreting the test results. In this application, the term "prognosis" generally refers to the relative probability that a certain future outcome may occur in a subject.

[0116] In this application, the terms "disease" or "symptom" are used interchangeably and refer to any change in the state of the body or organs that impairs or disrupts the performance of function, and / or causes symptoms such as discomfort, dysfunction, pain, or even death in a person who is ill or in contact with such a person. Disease or symptom may also be referred to as disorder, ailing, ailment, malady, disorder, sickness, illness, complaint, inderdisposion, or affectation.

[0117] In this application, the term "tumor" generally refers to all neoplasmic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues. The terms "cancer," "cancerous," "cellular proliferative disorder," "proliferative lesion," and "tumor" are not mutually exclusive when used herein. In some embodiments, a tumor may refer to a mass containing a majority of cancer cells, such as a mass of flesh exhibiting the characteristic cells of any cancer described herein. Examples of tumors may include primary tumors of any of the aforementioned types of cancer or metastatic tumors at a second site derived from any of the aforementioned types of cancer.

[0118] In this application, the term "detection" encompasses quantitative or qualitative detection, as well as all other methods used to identify the analyte in general and specifically the analyte. For example, methods that detect only the presence or absence of B7H3 protein in a sample are within the scope of this invention, as are methods that provide data on the amount or concentration of B7H3 protein in a sample. The terms "detection," "determination," "identification," etc., are used synonymously herein and are all within the scope of this invention.

[0119] In this application, the terms "expression level," "level of expression," or simply "level" are used interchangeably and generally refer to the amount of polynucleotides (e.g., messenger RNA (mRNA)) or amino acid products or proteins in a biological sample. "Expression" generally refers to the process by which the information encoded by a gene is converted into structures present and functioning in the cell. Expression levels can be measured / quantified / detected, for example, by relying on proteins or mRNA expressed from that gene.

[0120] In this application, the terms "patient" and "recipient of treatment" are used interchangeably to include human and non-human animal recipients of treatment, as well as individuals suffering from a formally diagnosed disease, individuals suffering from an undiagnosed disease, individuals receiving medical treatment, and individuals at risk of developing a disease. For example, a patient may include a person who needs treatment for cancer, or for precancerous conditions or lesions.

[0121] In this application, the term "biological sample" encompasses a variety of sample types obtained from an organism and that may be used for diagnostic or monitoring assays. The term covers blood and other biologically derived liquid samples, solid tissue samples such as biopsy specimens or tissue cultures or cells and their progeny derived therefrom. The term covers samples that have been manipulated in any way since their acquisition, such as by treatment with reagents, dissolution, or enrichment of certain components. The term covers clinical samples and also includes cells in cell cultures, cell supernatants, cell lysates, serum, plasma, biological fluids, and tissue samples.

[0122] In this application, the term "targeted therapy" generally refers to cancer treatment using drugs or other substances that interfere with specific target molecules typically involved in the growth of cancer cells, while causing little harm to normal cells to achieve an anti-tumor effect. In contrast, conventional cytotoxic chemotherapy drugs target all dividing cells.

[0123] In this application, the terms "specific binding" or "specific" generally refer to measurable and reproducible interactions, such as binding between a target and an antibody, where the presence of the target is determined in the presence of a heterogeneous population of molecules (including biomolecules). For example, an antibody that specifically binds to a target (which may be an epitope) may be an antibody that binds to the target with greater affinity, strength, ease, and / or duration than it binds to other targets. In some embodiments, the antibody specifically binds to an epitope on a protein that is conserved across proteins of different species. In some embodiments, specific binding may include, but is not required to be, exclusive binding.

[0124] In this application, the proteins, peptides and / or amino acid sequences involved should also be understood to include at least the following range: variants or homologs that have the same or similar functions as the said protein or peptide.

[0125] In this application, the variant can be, for example, a protein or polypeptide that has undergone substitution, deletion, or addition of one or more amino acids in the amino acid sequence of the protein and / or the polypeptide (e.g., an antibody that specifically binds to B7H3 or a fragment thereof). For example, the functional variant may comprise a protein or polypeptide that has undergone amino acid alterations through substitution, deletion, and / or insertion of at least one, such as 1-30, 1-20, or 1-10, or even 1, 2, 3, 4, or 5 amino acids. The functional variant may substantially retain the biological properties of the protein or polypeptide prior to the alteration (e.g., substitution, deletion, or addition). For example, the functional variant may retain at least 60%, 70%, 80%, 90%, or 100% of the biological activity (e.g., antigen-binding capacity) of the protein or polypeptide prior to the alteration. For example, the substitution may be a conserved substitution.

[0126] In this application, the homolog may be a protein or polypeptide having at least about 85% (e.g., having at least about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or higher) sequence homology with the amino acid sequence of the protein and / or the polypeptide (e.g., an antibody that specifically binds to an extracellular antigenic epitope of B7H3 or a fragment thereof).

[0127] In this application, homology generally refers to the similarity, resemblance, or association between two or more sequences. The "sequence homology percentage" can be calculated by comparing two sequences to be aligned within a comparison window, determining the number of positions in the two sequences containing the same nucleic acid bases (e.g., A, T, C, G, I) or the same amino acid residues (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys, and Met) to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window (i.e., the window size), and multiplying the result by 100 to produce the sequence homology percentage. Alignments performed to determine the sequence homology percentage can be performed in various ways known in the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine suitable parameters for aligning sequences, including any algorithm required to achieve maximum alignment across the full-length sequence being compared or within the target sequence region. Homology can also be determined using FASTA and BLAST. A description of the FASTA algorithm can be found in W.R. Pearson and DJ Lipman, “An Improved Tool for Biological Sequence Alignment,” Proceedings of the National Academy of Sciences (Proc. Natl. Acad. Sci.), 85: 2444-2448, 1988; and DJ Lipman and W.R. Pearson, “A Fast and Sensitive Search for Protein Similarity,” Science, 227: 1435-1441, 1989. A description of the BLAST algorithm can be found in S. Altschul, W. Gish, W. Miller, E.W. Myers, and D. Lipman, “A Basic Tool for Local Alignment Search,” Journal of Molecular Biology, 215: 403-410, 1990.

[0128] In this application, the term "comprising" generally means including, encompassing, containing, or including. In some cases, it also means "to be" or "composed of".

[0129] In this application, the term "about" generally refers to a variation within a range of 0.5% to 10% above or below a specified value, such as a variation within a range of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below a specified value. Invention Details

[0131] Isolated antigen-binding proteins

[0132] The CDR (Complementarity Determinant Region) of an antibody, also known as the complementarity-determining region, is part of the variable region. Amino acid residues in this region can contact antigens or antigenic epitopes. Antibody CDRs can be determined using various coding systems, such as CCG, Kabat, Chothia, IMGT, AbM, and a combination of Kabat / Chothia. These coding systems are known in the art and can be found, for example, at http: / / www.bioinf.org.uk / abs / index.html#kabatnum. Those skilled in the art can determine the CDR region using different coding systems based on the antibody's sequence and structure. The CDR region may differ when using different coding systems. In this application, the term CDR encompasses CDR sequences partitioned according to any CDR partitioning method; it also encompasses variants of the CDR, including amino acid sequences with substitutions, deletions, and / or additions of one or more amino acids. For example, 1-30, 1-20, or 1-10 amino acid substitutions, deletions, and / or insertions, or 1, 2, 3, 4, 5, 6, 7, 8, or 9 amino acid substitutions, deletions, and / or insertions; also covering its homologs, which can be amino acid sequences having at least about 85% (e.g., having at least about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or higher) sequence homology with the amino acid sequence of the CDR.

[0133] On one hand, this application provides an isolated antigen-binding protein that may comprise HCDR1, HCDR2, and HCDR3. In some cases, HCDR1 comprises the amino acid sequence shown in any one of SEQ ID NO: 1, 7, 12, and 14; HCDR2 comprises the amino acid sequence shown in any one of SEQ ID NO: 2, 8, 13, and 15; and HCDR3 comprises the amino acid sequence shown in any one of SEQ ID NO: 3, 9, and 16. In this application, the isolated antigen-binding protein may comprise LCDR1, LCDR2, and LCDR3, wherein LCDR1 may comprise the amino acid sequence shown in any one of SEQ ID NO: 4, 10, and 17; LCDR2 may comprise the amino acid sequence shown in any one of SEQ ID NO: 5, 11, and 18; and LCDR3 may comprise the amino acid sequence shown in any one of SEQ ID NO: 6 and 19.

[0134] In this application, the isolated antigen-binding protein may comprise HCDR1, HCDR2, and HCDR3. HCDR1 may comprise the amino acid sequence shown in SEQ ID NO: 1, HCDR2 may comprise the amino acid sequence shown in SEQ ID NO: 2, and HCDR3 may comprise the amino acid sequence shown in SEQ ID NO: 3. In this application, the isolated antigen-binding protein may comprise LCDR1, LCDR2, and LCDR3. LCDR1 may comprise the amino acid sequence shown in SEQ ID NO: 4, LCDR2 may comprise the amino acid sequence shown in SEQ ID NO: 5, and LCDR3 may comprise the amino acid sequence shown in SEQ ID NO: 6.

[0135] In this application, the isolated antigen-binding protein may comprise HCDR1, HCDR2, and HCDR3. HCDR1 may comprise the amino acid sequence shown in SEQ ID NO: 7, HCDR2 may comprise the amino acid sequence shown in SEQ ID NO: 8, and HCDR3 may comprise the amino acid sequence shown in SEQ ID NO: 9. In this application, the isolated antigen-binding protein may comprise LCDR1, LCDR2, and LCDR3. LCDR1 may comprise the amino acid sequence shown in SEQ ID NO: 10, LCDR2 may comprise the amino acid sequence shown in SEQ ID NO: 11, and LCDR3 may comprise the amino acid sequence shown in SEQ ID NO: 6.

[0136] In this application, the isolated antigen-binding protein may comprise HCDR1, HCDR2, and HCDR3. HCDR1 may comprise the amino acid sequence shown in SEQ ID NO: 12, HCDR2 may comprise the amino acid sequence shown in SEQ ID NO: 13, and HCDR3 may comprise the amino acid sequence shown in SEQ ID NO: 3. In this application, the isolated antigen-binding protein may comprise LCDR1, LCDR2, and LCDR3. LCDR1 may comprise the amino acid sequence shown in SEQ ID NO: 4, LCDR2 may comprise the amino acid sequence shown in SEQ ID NO: 5, and LCDR3 may comprise the amino acid sequence shown in SEQ ID NO: 6.

[0137] In this application, the isolated antigen-binding protein may comprise HCDR1, HCDR2, and HCDR3. HCDR1 may comprise the amino acid sequence shown in SEQ ID NO: 14, HCDR2 may comprise the amino acid sequence shown in SEQ ID NO: 15, and HCDR3 may comprise the amino acid sequence shown in SEQ ID NO: 16. In this application, the isolated antigen-binding protein may comprise LCDR1, LCDR2, and LCDR3. LCDR1 may comprise the amino acid sequence shown in SEQ ID NO: 17, LCDR2 may comprise the amino acid sequence shown in SEQ ID NO: 18, and LCDR3 may comprise the amino acid sequence shown in SEQ ID NO: 19.

[0138] In this application, the isolated antigen-binding protein may contain at least one CDR from the amino acid sequences shown in SEQ ID NO:20 and SEQ ID NO:21. The CDR may include CDRs partitioned in any manner, not limited to those partitioned by the methods listed in the table below. Any CDR partitioned in any manner, if its sequence is identical to SEQ ID NO:20 or 21, falls within the scope of protection of the claims of this application.

[0139] For example, by dividing the amino acid sequence shown in SEQ ID NO:20 using the method in Table 1, the antigen-binding protein isolated in this application may contain the CDR shown in the table below.

[0140] Table 1 shows the CDR sequences obtained by different methods of dividing the amino acid sequence shown in SEQ ID NO:20.

[0141]

[0142] For example, by dividing the amino acid sequence shown in SEQ ID NO:21 using the method in Table 2, the antigen-binding protein isolated in this application may contain the CDR shown in the table below.

[0143] Table 2 shows the CDR sequences obtained by different methods of dividing the amino acid sequence shown in SEQ ID NO:21.

[0144]

[0145] In this application, the isolated antigen-binding protein may contain a heavy chain variable region (VH). In some cases, the VH may contain an amino acid sequence as shown in SEQ ID NO:20.

[0146] In this application, the isolated antigen-binding protein may contain a light chain variable region (VL). In some cases, the VL may contain an amino acid sequence as shown in SEQ ID NO: 21.

[0147] In this application, the isolated antigen-binding protein may include a heavy chain constant region, which may be derived from human or rabbit IgG heavy chain constant regions. For example, the heavy chain constant region may include a rabbit IgG heavy chain constant region. For example, the heavy chain constant region may include the amino acid sequence shown in SEQ ID NO: 22.

[0148] In this application, the isolated antigen-binding protein may include a light chain constant region, which may be derived from the κ or λ chain of a human or rabbit. For example, the light chain constant region may be derived from the κ chain of a rabbit. For example, the light chain constant region may contain the amino acid sequence shown in SEQ ID NO: 23.

[0149] In this application, the isolated antigen-binding protein may comprise an antibody heavy chain HC, which may contain the amino acid sequence shown in SEQ ID NO: 24. In this application, the HC may be encoded by the nucleotide sequence shown in SEQ ID NO: 26.

[0150] In this application, the isolated antigen-binding protein may comprise an antibody light chain (LC), which may contain the amino acid sequence shown in SEQ ID NO: 25. In this application, the LC may be encoded by the nucleotide sequence shown in SEQ ID NO: 27.

[0151] In this application, the isolated antigen-binding protein may contain an antibody or an antigen-binding fragment thereof.

[0152] In some embodiments, the antigen-binding fragment may include Fab, Fab', Fv fragments, F(ab')2, F(ab)2, scFv, di-scFv, and / or dAb. For example, when the antigen-binding protein is scFv, a linker peptide may be present between its heavy and light chain variable regions.

[0153] In some embodiments, the antibody may include monoclonal antibodies, rabbit-derived antibodies, chimeric antibodies, humanized antibodies, recombinant antibodies, single-chain antibodies, bifunctional antibodies, trifunctional antibodies, and tetrafunctional antibodies. For example, the chimeric antibody may include chimeric antibodies of humans, goats, monkeys, dogs, mice, and rabbits.

[0154] In some embodiments, the antigen-binding protein may be an IgG antibody.

[0155] In some embodiments, the antigen-binding protein is labeled. For example, the antigen protein may be directly labeled and / or indirectly labeled. The substance used for labeling can be any substance that can be detected directly or indirectly. For example, the labeling may involve direct labeling by conjugating a detectable substance to the antigen-binding protein. For example, the labeling may involve indirect labeling by reacting with another directly labeled reagent. For example, the labeling may involve indirect labeling by using a secondary antibody labeled with an enzyme, fluorescein, or biotin.

[0156] Furthermore, it should be noted that the isolated antigen-binding protein described in this application may contain heavy chain and / or light chain sequences with one or more conserved sequence modifications. "Conserved sequence modification" refers to amino acid modifications that do not significantly affect or alter antibody binding properties. Such conserved modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced into the isolated antigen-binding protein described in this application using standard techniques known in the art, such as point mutations and PCR-mediated mutations. Conserved amino acid substitution involves replacing an amino acid residue with an amino acid residue having a similar side chain. Groups of amino acid residues with similar side chains are known in the art. These amino acid residue groups include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), nonpolar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), β-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). In some embodiments, one or more amino acid residues in the CDR region of the isolated antigen-binding protein described in this application may be replaced with other amino acid residues from the same side chain group. Those skilled in the art will know that some conserved sequence modifications do not cause the antigen to lose its binding ability. For example, see Brummell et al., (1993) Biochem 32:1180-8; de Wildt et al., (1997) Prot. Eng. 10:835-41; Komissarov et al., (1997) J. Biol. Chem. 272:26864-26870; Hall et al., (1992) J. Immunol. 149:1605-12; Kelley and O'Connell (1993) Biochem. 32:6862-35; Adib-Conquy et al., (1998) Int. Immunol. 10:341-6 and Beers et al., (2000) Clin. Can. Res. 6:2835-43.

[0157] The B7H3 antigen-binding protein described in this application can be identified, screened, or characterized by various assays known in the art.

[0158] For example, the antigen-binding activity of the antigen-binding protein or fusion protein of this application can be tested by known methods such as enzyme-linked immunosorbent assay (ELISA), immunoblotting (e.g., Western blotting), flow cytometry (e.g., FACS), immunohistochemistry, immunofluorescence, etc.

[0159] In this application, the isolated antigen-binding protein specifically binds to B7H3. In some embodiments, the binding of the isolated antigen-binding protein to B7H3 can be detected by an ELISA method. For example, the antigen-binding protein of this application can be detected at an EC50 concentration of less than or equal to about 0.010 μg / mL. 50 The value is associated with B7H3.

[0160] Polypeptide molecules, nucleic acid molecules, carriers, cells, immunoconjugates, and pharmaceutical compositions

[0161] On the other hand, this application provides polypeptide molecules that may contain the isolated antigen-binding protein described in this application.

[0162] In some embodiments, the polypeptide molecule may comprise a fusion protein. In some embodiments, the polypeptide molecule may be a fusion protein.

[0163] In some embodiments, the polypeptide molecule may include two antigen-binding domains and an antibody heavy chain constant region. The first antigen-binding domain may contain the antigen-binding protein isolated as described in any one of the claims of this application, and the second antigen-binding domain may contain the antigen-binding protein isolated as described in any one of the claims of this application.

[0164] On the other hand, this application provides a chimeric antigen receptor that may contain the antigen-binding protein described in this application.

[0165] In some embodiments, the chimeric antigen receptor may include an extracellular domain capable of binding antigens, i.e., an antigen-binding domain, and at least one intracellular domain. For example, the antigen-binding domain of the chimeric antigen receptor may contain the antigen-binding protein described in this application. For example, the antigen-binding domain of the chimeric antigen receptor may contain the amino acid sequence of the antigen-binding protein described in this application. In some embodiments, the chimeric antigen receptor may include an antigen-binding domain, a hinge region, a transmembrane domain, an intracellular co-stimulatory signal transduction domain, and an intracellular signal transduction domain. In some embodiments, the chimeric antigen receptor may also contain a signal peptide.

[0166] On the other hand, this application provides isolated nucleic acid molecules that can encode the isolated antigen-binding protein described in this application. For example, it can be produced or synthesized by: (i) in vitro amplification, for example by polymerase chain reaction (PCR); (ii) by clonal recombination; (iii) purification, for example by enzyme digestion and gel electrophoresis fractionation; or (iv) synthesis, for example by chemical synthesis.

[0167] On the other hand, this application provides a vector that may contain the nucleic acid molecule described in this application. Furthermore, the vector may also contain other genes, such as marker genes that allow selection of the vector in appropriate host cells and under appropriate conditions. Additionally, the vector may contain expression control elements that allow the coding region to be correctly expressed in an appropriate host. Such control elements are well known to those skilled in the art and may include, for example, promoters, ribosome binding sites, enhancers, and other control elements regulating gene transcription or mRNA translation. The vector can be transformed, transduced, or transfected into host cells to express the genetic material elements it carries within the host cells. The vector may include, for example, plasmids, granules, viruses, bacteriophages, or other vectors commonly used in, for example, genetic engineering. For example, the vector is an expression vector. Furthermore, the vector may also include components that facilitate its entry into cells, such as viral particles, liposomes, or protein coats, but not only these substances.

[0168] On the other hand, this application provides a cell that may contain the nucleic acid molecules or vectors described in this application. In some embodiments, each or every host cell may contain one or more of the nucleic acid molecules or vectors described in this application. In some embodiments, each or every host cell may contain multiple (e.g., two or more) or more types (e.g., two or more) of the nucleic acid molecules or vectors described in this application. For example, the vectors described in this application may be introduced into the host cell, such as eukaryotic cells, such as cells from plants, fungi, or yeast cells. In some embodiments, the cell may be a bacterial cell (e.g., *Escherichia coli*), a yeast cell, or other eukaryotic cells, such as COS cells, Chinese hamster ovary (CHO) cells, CHO-K1 cells, LNCAP cells, HeLa cells, 293T cells, COS-1 cells, SP2 / 0 cells, NSO cells, or myeloma cells. The vectors described in this application may be introduced into the host cell by methods known in the art, such as electroporation, lipofectine transfection, lipofectamin transfection, etc.

[0169] In some embodiments, the cells described in this application may comprise cells containing the antigen-binding protein, the nucleic acid molecule, the carrier, and / or the chimeric antigen receptor described in this application. In some embodiments, the cells may comprise immune cells. For example, the immune cells may include plasma cells, T cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and bone marrow-derived phagocytes. For example, the immune cells may be autologous / self-generated or non-autologous. For example, the immune cells may be unmodified or modified.

[0170] On the other hand, this application also provides immune conjugates that may contain the isolated antigen-binding proteins described in this application.

[0171] In some embodiments, the isolated antigen-binding protein or fragment thereof described in this application can be linked to another agent, such as a chemotherapeutic agent, toxin, immunotherapeutic agent, imaging probe, spectroscopic probe, etc. This linking can be via one or more covalent bonds, or non-covalent interactions, and may include chelation. A variety of adapters (which may be known in the art) can be used to form immunoconjugates. Furthermore, immunoconjugates can be provided in the form of fusion proteins, which may be expressed by polynucleotides encoding the immunoconjugate. The immunoconjugates may also comprise, for example, antibody-drug conjugates (ADCs). Suitable drugs may include cytotoxins, alkylating agents, DNA minor groove binding molecules, DNA intercalators, DNA cross-linking agents, histone deacetylase inhibitors, nuclear export inhibitors, proteasome inhibitors, inhibitors of topoisomerase I or II, heat shock protein inhibitors, tyrosine kinase inhibitors, antibiotics, and antimitotic agents. In ADCs, antibodies and therapeutic agents can be cross-linked via cleavable adapters, such as peptide adapters, disulfide adapters, or hydrazone adapters.

[0172] On the other hand, this application also provides pharmaceutical compositions that may comprise the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immunoconjugate described in this application, the nucleic acid molecule described in this application, the carrier described in this application, and / or the cell described in this application, and optionally a pharmaceutically acceptable carrier.

[0173] In some embodiments, the pharmaceutical composition may further comprise suitable formulations of one or more (pharmaceutically effective) adjuvants, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers, and / or preservatives. The acceptable components of the composition are preferably non-toxic to the recipient at the dosage and concentration used. The pharmaceutical compositions of the present invention include, but are not limited to, liquid, freeze-dried, and lyophilized compositions.

[0174] In some embodiments, the pharmaceutical composition may also contain more than one active compound, typically those with complementary activities that do not adversely affect each other. The type and effective amount of such a drug may depend, for example, on the amount and type of antagonist present in the formulation, and on the clinical parameters of the subject.

[0175] In some embodiments, the pharmaceutically acceptable carrier may include any and all solvents, dispersion media, coatings, isotonic agents, and absorption delay agents that are compatible with drug administration and are generally safe and non-toxic.

[0176] In some embodiments, the pharmaceutical composition may be administered parenterally, percutaneously, intracavitarily, intra-arterially, intrathecally, and / or intranasally, or directly injected into tissues. For example, the pharmaceutical composition may be administered to a patient or subject by infusion or injection. In some embodiments, the pharmaceutical composition may be administered in various ways, such as intravenously, intraperitoneally, subcutaneously, intramuscularly, locally, or intradermally. In some embodiments, the pharmaceutical composition may be administered continuously. This continuous (or uninterrupted) administration may be achieved using a small pump system worn by the patient to measure the amount of therapeutic agent flowing into the patient, as described in WO2015 / 036583.

[0177] On the other hand, this application also provides reagents that may comprise the isolated antigen-binding proteins described in this application, the polypeptide molecules described in this application, the chimeric antigen receptors described in this application, the immunoconjugates described in this application, the nucleic acid molecules described in this application, the carriers described in this application, and / or the cells described in this application. The reagents described in this application may comprise any substance used for analyzing biological samples, without being limited by the state of the substance, nor by whether it is a single substance distribution or a combination of other substances.

[0178] On the other hand, this application provides a detection plate, which may contain the isolated antigen-binding protein, the polypeptide molecule, the chimeric antigen receptor, the immunoconjugate, the nucleic acid molecule, the carrier, and / or the cell described in this application. In some embodiments, the detection plate may include a support component or container and a detection reagent, which may contain the isolated antigen-binding protein, the polypeptide molecule, the chimeric antigen receptor, the immunoconjugate, the nucleic acid molecule, the carrier, and / or the cell described in this application. For example, the reagent may be a test strip containing the antigen-binding protein described in this application. For example, the test strip may contain an antigen spotting area.

[0179] On the other hand, this application provides a kit that may contain the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immunoconjugate described in this application, the nucleic acid molecule described in this application, the vector described in this application, and / or the cell described in this application.

[0180] In some embodiments, the kit described in this application may contain the isolated antigen-binding protein described in this application.

[0181] In some embodiments, the kit described in this application may contain the isolated antigen-binding protein described in this application, said isolated antigen-binding protein being specifically capable of binding B7H3 and containing HCDR1, HCDR2, and HCDR3 selected from any of the following groups:

[0182] a) HCDR1 contains the amino acid sequence shown in SEQ ID NO:1, HCDR2 contains the amino acid sequence shown in SEQ ID NO:2, and HCDR3 contains the amino acid sequence shown in SEQ ID NO:3;

[0183] b) HCDR1 contains the amino acid sequence shown in SEQ ID NO:7, HCDR2 contains the amino acid sequence shown in SEQ ID NO:8, and HCDR3 contains the amino acid sequence shown in SEQ ID NO:9;

[0184] c) HCDR1 contains the amino acid sequence shown in SEQ ID NO:12, HCDR2 contains the amino acid sequence shown in SEQ ID NO:13, and HCDR3 contains the amino acid sequence shown in SEQ ID NO:3; or

[0185] d) HCDR1 contains the amino acid sequence shown in SEQ ID NO:14, HCDR2 contains the amino acid sequence shown in SEQ ID NO:15, and HCDR3 contains the amino acid sequence shown in SEQ ID NO:16.

[0186] In some embodiments, the kit described in this application may further include isolated antigen-binding proteins selected from any of the following groups: LCDR1, LCDR2, and LCDR3.

[0187] a) The LCDR1 contains the amino acid sequence shown in SEQ ID NO:4, the LCDR2 contains the amino acid sequence shown in SEQ ID NO:5, and the LCDR3 contains the amino acid sequence shown in SEQ ID NO:6;

[0188] b) The LCDR1 contains the amino acid sequence shown in SEQ ID NO:10, the LCDR2 contains the amino acid sequence shown in SEQ ID NO:11, and the LCDR3 contains the amino acid sequence shown in SEQ ID NO:6; or

[0189] c) The LCDR1 contains the amino acid sequence shown in SEQ ID NO:17, the LCDR2 contains the amino acid sequence shown in SEQ ID NO:18, and the LCDR3 contains the amino acid sequence shown in SEQ ID NO:19.

[0190] In some embodiments, the isolated antigen-binding protein included in the kit of this application may include a heavy chain variable region (VH) containing the amino acid sequence shown in SEQ ID NO:20. In some embodiments, the isolated antigen-binding protein included in the kit of this application may include a light chain variable region (VL) containing the amino acid sequence shown in SEQ ID NO:21. In some embodiments, the isolated antigen-binding protein included in the kit of this application may include both the heavy chain variable region of the amino acid sequence shown in SEQ ID NO:20 and the light chain variable region of the amino acid sequence shown in SEQ ID NO:21.

[0191] In some embodiments, the kit described in this application may contain the isolated antigen-binding protein described in this application, wherein the concentration of the antigen-binding protein is adjusted according to actual use. For example, the concentration of the isolated antigen-binding protein in the kit may be greater than or equal to 0.10 μg / mL. For example, the concentration of the isolated antigen-binding protein may be greater than or equal to 0.10 μg / mL, greater than or equal to 0.15 μg / mL, greater than or equal to 0.20 μg / mL, greater than or equal to 0.25 μg / mL, greater than or equal to 0.30 μg / mL, greater than or equal to 0.35 μg / mL, greater than or equal to 0.40 μg / mL, greater than or equal to 0.45 μg / mL, greater than or equal to 0.50 μg / mL, greater than or equal to 0.60 μg / mL, greater than or equal to 0.70 μg / mL, greater than or equal to 0.80 μg / mL, greater than or equal to 0.90 μg / mL, greater than or equal to 1.0 μg / mL, greater than or equal to... 1.5 μg / mL, greater than or equal to 2.0 μg / mL, greater than or equal to 2.5 μg / mL, greater than or equal to 3.0 μg / mL, greater than or equal to 3.5 μg / mL, greater than or equal to 4.0 μg / mL, greater than or equal to 4.5 μg / mL, greater than or equal to 5.0 μg / mL, greater than or equal to 5.5 μg / mL, greater than or equal to 6.0 μg / mL, greater than or equal to 6.5 μg / mL, greater than or equal to 7.0 μg / mL, greater than or equal to 7.5 μg / mL, greater than or equal to 8.0 μg / mL, greater than or equal to 8.5 μg / mL, greater than or equal to 9.0 μg / mL, greater than or equal to 10.0 μg / mL, or higher. For example, the concentration of antigen-binding protein isolated in the kit may be less than or equal to 10.0 μg / mL.For example, the concentration of the isolated antigen-binding protein may be less than or equal to 9.5 μg / mL, less than or equal to 9.0 μg / mL, less than or equal to 8.5 μg / mL, less than or equal to 8.0 μg / mL, less than or equal to 7.5 μg / mL, less than or equal to 7.0 μg / mL, less than or equal to 6.5 μg / mL, less than or equal to 6.0 μg / mL, less than or equal to 5.5 μg / mL, less than or equal to 5.0 μg / mL, less than or equal to 4.5 μg / mL, less than or equal to 4.0 μg / mL, or less than or equal to 3.5 μg / mL. The concentrations of antigen-binding proteins isolated in the kit can be between 0.1 and 10 μg / mL. For example, the concentrations of the isolated antigen-binding proteins can be 10 μg / mL, 3.5 μg / mL, 1 μg / mL, 0.7 μg / mL, 1.5 μg / mL, 1.0 μg / mL, 0.9 μg / mL, 0.8 μg / mL, 0.7 μg / mL, 0.6 μg / mL, 0.5 μg / mL, 0.4 μg / mL, 0.3 μg / mL, 0.2 μg / mL, 0.1 μg / mL, or lower.

[0192] In some embodiments, the kit can be used in a variety of assays, including but not limited to immunohistochemical assays, enzyme-linked immunosorbent assays, protein / peptide microarray assays, immunoblotting assays, microbead immunoassays, and / or microfluidic immunoassays.

[0193] In some embodiments, the kit may further comprise a second antibody that specifically recognizes the antigen-binding protein of this application. In some embodiments, the second antibody may further comprise a detectable marker. In some embodiments, the second antibody may comprise a rabbit antibody.

[0194] In some embodiments, the kit may also include reagents and / or materials for quality control. For example, the reagents and / or materials for quality control may include negative control samples, negative control materials, positive control samples, and / or positive control materials. For example, the materials for quality control may include cell line sections. For example, the traceability of the cell line sections for quality control is well-defined. For example, the negative control materials may include stably passaged cell lines from humans that do not express B7H3. For example, the positive control materials may include stably passaged cell line sections from humans that moderately / strongly express B7H3. In some embodiments, the kit may also include reagents and / or materials for controls. For example, the reagents and / or materials for controls may include negative control reagents. For example, the negative control reagent may include isotype IgG antibodies.

[0195] The kit of this application may also contain other materials required for the kit. In some embodiments, the kit may include other additives, such as stabilizers, buffers (e.g., blocking buffers or lysis buffers), etc. For example, the reagents in the kit may be provided as dry powders, which are typically lyophilized and include excipients that, upon dissolution, will provide a reagent solution with an appropriate concentration. For example, the other materials may include antibody diluents. For example, the antibody diluents may contain protein stabilizers, antibacterial agents, and preservatives. For example, the antibody diluents may contain phosphate buffer. For example, the antibody diluents may contain, but are not limited to, one or more of the following components: PBS (phosphate buffer), BSA (bovine serum albumin), proclin 300, 0.05% sodium azide, Tris-HCl buffer solution, sucrose, Triton X-100. For example, the antibody diluents may include 0.01M PBS (phosphate buffer) containing 1% BSA (bovine serum albumin) and 0.05% proclin 300.

[0196] In some embodiments, the kit may comprise an immunohistochemical assay kit. For example, the immunohistochemical assay kit may comprise the antigen-binding protein described in this application, as well as other materials for immunohistochemical assays. For example, the immunohistochemical assay kit may comprise reagents for antigen retrieval, reagents for blocking, chromogenic reagents, chromogenic enhancement reagents, and / or signal enhancement reagents. For example, the other materials for immunohistochemical assays are known to those skilled in the art.

[0197] In some embodiments, the reagents for antigen retrieval may include heat-induced antigen retrieval buffers and / or enzyme-catalyzed antigen retrieval reagents. For example, the reagents for antigen retrieval may include, but are not limited to, sodium citrate buffer, EDTA antigen retrieval solution, and / or Tris-EDTA buffer. For example, the sodium citrate buffer may contain 10 mM sodium citrate and 0.05% Tween-20, with a pH of 6.0. For example, the EDTA antigen retrieval solution may contain 1 mM EDTA, with a pH of 8.0. For example, the Tris-EDTA buffer may contain 10 mM Tris, 1 mM EDTA solution, and 0.05% Tween-20, with a pH of 9.0.

[0198] In some embodiments, the blocking reagent may include, but is not limited to, hydrogen peroxide blocking reagent, IHC blocking serum, protein blocking buffer, and / or biotin blocker. For example, the IHC blocking serum may include goat serum. For example, the protein blocking buffer may include skim milk powder.

[0199] In some embodiments, the chromogenic reagent may include a substrate and an enzyme that converts the substrate into a chromogenic product. For example, the chromogenic reagent may include, but is not limited to, 3,3'-diaminobenzidine (DAB), 3-amino-9-ethylcarbazole (AEC), p-nitrophenyl phosphate (p-NPP), horseradish peroxidase (HRP), and alkaline phosphatase (AP).

[0200] In some embodiments, the colorimetric enhancement reagent may include a horseradish peroxidase (HRP) polymer and an alkaline phosphatase (AP) polymer.

[0201] In some embodiments, the signal enhancement agent comprises an enzyme-labeled second antibody that specifically recognizes the isolated antigen-binding protein. For example, the signal enhancement agent may comprise a horseradish peroxidase-labeled second antibody. For example, the second antibody may comprise a rabbit antibody.

[0202] The components of the kit in this application may be pre-attached to a solid support, or may be applied to the surface of the solid support when the kit is used. In some embodiments, the kit may be used with other reagents and / or devices to obtain detection results.

[0203] The reagent kit components described in this application can be packaged together or aliquoted into two or more containers. In some embodiments, the container may be a vial containing a sterile lyophilized formulation suitable for recombination.

[0204] In some embodiments, the kit may also include instructions for use.

[0205] Preparation method

[0206] On the other hand, this application provides a method for preparing the isolated antigen-binding protein. The method may include culturing the cells described in this application under conditions that allow the antigen-binding protein to be expressed. For example, this can be achieved by using appropriate culture media, appropriate temperatures, and culture times, methods known to those skilled in the art.

[0207] Any method suitable for producing monoclonal antibodies can be used to produce the antigen-binding protein of this application. For example, animals can be immunized with B7H3 or fragments thereof, which are either conjugated or naturally occurring. Suitable immunization methods can be used, including adjuvants, immunostimulants, repeated booster immunizations, or one or more pathways. In some embodiments, isolated antigen-binding proteins against B7H3 can be screened and enriched by extracting peripheral blood lymphocytes from immunized rabbits, cloning cellular nucleic acid fragments into a vector, and then using a phage surface display system.

[0208] Any suitable form of B7H3 can be used as an immunogen (antigen) to generate non-human antibodies specific to B7H3 and to screen for the biological activity of said antibodies. For example, the stimulating immunogen can be full-length B7H3, including natural homodimers or peptides containing one or more epitopes. The immunogen can be used alone or in combination with one or more immunogenicity enhancers known in the art.

[0209] The method described in this application may also include the step of isolating the antigen-binding protein. For example, the method may include isolating the antigen-binding protein from a culture.

[0210] Methods and uses

[0211] On the other hand, this application provides a method for detecting B7H3 in a sample, comprising administering the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immunoconjugate described in this application, the nucleic acid molecule described in this application, the carrier described in this application, the cell described in this application, the pharmaceutical composition described in this application, the reagent described in this application, the detection plate described in this application, and / or the kit described in this application.

[0212] On the other hand, this application provides the use of the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immunoconjugate described in this application, the nucleic acid molecule described in this application, the carrier described in this application, the cell described in this application, the pharmaceutical composition described in this application, the reagent described in this application, the detection plate described in this application, and / or the kit described in this application in the preparation of B7H3 detection reagents.

[0213] On the other hand, this application provides the use of the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immunoconjugate described in this application, the nucleic acid molecule described in this application, the carrier described in this application, the cell described in this application, the pharmaceutical composition described in this application, the reagent described in this application, the detection plate described in this application, and / or the kit described in this application for detecting B7H3.

[0214] In some implementations, the method may include:

[0215] (a) Provide samples from the subjects;

[0216] (b) The isolated antigen-binding protein, polypeptide molecule, chimeric antigen receptor, immunoconjugate, nucleic acid molecule, vector, cell, pharmaceutical composition, reagent, detection plate and / or kit described in this application are brought into direct or indirect contact with the sample.

[0217] (c) Determine the B7H3 level in the sample; and / or

[0218] (d) Compare the B7H3 level in the sample with one or more reference values.

[0219] In some embodiments, the sample may comprise biological and / or non-biological samples. For example, the biological sample may comprise a clinical sample. For example, the biological sample may include cells in a cell culture, cell supernatant, cell lysate, serum, plasma, biofluids, and / or tissue samples. For example, the biological sample may be a formalin-soaked paraffin section of tissue. For example, the biological sample may comprise a tissue microarray. In some embodiments, the method may further include a step of processing the sample to make it usable for detection.

[0220] In some embodiments, the detection of B7H3 in the sample may include qualitative and / or quantitative detection of B7H3 in the sample. For example, it may include qualitative and / or quantitative detection of B7H3 protein in the sample. For example, the B7H3 may include endogenous B7H3 protein. For example, the B7H3 protein may include endogenous B7H3 protein in tumor cells.

[0221] In some embodiments, detecting B7H3 in the sample may include detecting the expression level of B7H3 in the sample. In some embodiments, detecting B7H3 in the sample may include qualitative and / or quantitative detection of cells expressing B7H3 in the sample. In some embodiments, detecting B7H3 in the sample may include detecting the distribution of cells expressing B7H3 in the sample. For example, the cells expressing B7H3 may include tumor cells.

[0222] The detection method described in this application may include detecting B7H3 by applying any of the isolated antigen-binding proteins, polypeptide molecules, chimeric antigen receptors, immunoconjugates, nucleic acid molecules, carriers, cells, pharmaceutical compositions, reagents, detection plates, and / or kits described in this application. For example, the method may include, but is not limited to, immunohistochemical detection, enzyme-linked immunosorbent assay (ELISA), protein / peptide microarray detection, Western blotting, microbead immunoassay, and / or microfluidic immunoassay.

[0223] In some embodiments, the method may include detecting B7H3 in the sample by immunohistochemistry. For example, the method may include administering the isolated antigen-binding protein described in this application to detect B7H3 in the sample.

[0224] In some implementations, the method for detecting B7H3 in a sample may include the following steps:

[0225] a) Contact the sample with the labeled, isolated antigen-binding protein of this application; and

[0226] b) For labeled antibodies that bind to B7H3 in the sample, the procedure involves determining the activity by detecting fluorescence, chemiluminescence, or radioactivity, depending on the type of labeling substance that binds to the labeled antibody.

[0227] The B7H3 detection method described in this application has one or more of the following advantages: good detection sensitivity; good detection specificity; it can bind to most commercially available rabbit secondary antibodies and be detected in multiple ways; the presence or absence and intensity of B7H3 can be directly observed visually through immunostaining, and semi-quantitative or qualitative analysis of B7H3 protein expression can be performed; the detection method is simple.

[0228] In some implementations, the reference value may be the level of B7H3 in one or more control samples. For example, one or more control samples may include (i) one or more samples obtained from normal healthy individuals; (ii) one or more samples obtained from patients with non-B7H3-related diseases; (iii) one or more samples obtained from tissues or organs of patients with B7H3-related diseases that are not affected by the B7H3 disease; and / or (iv) combinations thereof.

[0229] In some cases, the method for detecting B7H3 in a sample is not for therapeutic purposes. In some cases, the method for detecting B7H3 in a sample is not a diagnostic method.

[0230] On the other hand, this application provides a method for preventing and / or treating diseases and / or symptoms, the method comprising administering the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immunoconjugate described in this application, the nucleic acid molecule described in this application, the carrier described in this application, the cell described in this application, the pharmaceutical composition described in this application, the reagent described in this application, the detection plate described in this application, and / or the kit described in this application.

[0231] On the other hand, this application provides the use of the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immunoconjugate described in this application, the nucleic acid molecule described in this application, the carrier described in this application, the cell described in this application, the pharmaceutical composition described in this application, the reagent described in this application, the detection plate described in this application, and / or the kit described in this application in the prevention and / or treatment of diseases and / or conditions.

[0232] On the other hand, this application provides the use of the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immunoconjugate described in this application, the nucleic acid molecule described in this application, the carrier described in this application, the cell described in this application, the pharmaceutical composition described in this application, the reagent described in this application, the detection plate described in this application, and / or the kit described in this application in the preparation of a drug for the prevention and / or treatment of diseases and / or conditions.

[0233] In this application, the application can be performed in various ways, such as intravenous, intratumoral, intraperitoneal, subcutaneous, intramuscular, local, or intradermal application.

[0234] On the other hand, this application provides a method for diagnosing diseases and / or symptoms, the method comprising administering the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immunoconjugate described in this application, the nucleic acid molecule described in this application, the carrier described in this application, the cell described in this application, the pharmaceutical composition described in this application, the reagent described in this application, the detection plate described in this application, and / or the kit described in this application.

[0235] The methods for diagnosing diseases and / or symptoms described in this application may include qualitative and / or quantitative detection of B7H3 in a sample using the methods for detecting B7H3 described in this application. In some embodiments, the presence of a disease can be confirmed, the formation or risk of disease can be assessed, the progression and / or prognosis of the disease can be evaluated, and / or the population eligible for treatment can be screened based on the qualitative and / or quantitative results of B7H3 in the sample.

[0236] On the other hand, this application provides the use of the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immunoconjugate described in this application, the nucleic acid molecule described in this application, the carrier described in this application, the cell described in this application, the pharmaceutical composition described in this application, the reagent described in this application, the detection plate described in this application, and / or the kit described in this application in the preparation of detection reagents.

[0237] On the other hand, this application provides the use of the isolated antigen-binding protein described in this application, the polypeptide molecule described in this application, the chimeric antigen receptor described in this application, the immunoconjugate described in this application, the nucleic acid molecule described in this application, the carrier described in this application, the cell described in this application, the pharmaceutical composition described in this application, the reagent described in this application, the detection plate described in this application, and / or the kit described in this application in the diagnosis of diseases and / or conditions.

[0238] In some embodiments, the detection reagent may comprise products for detection and / or diagnosis in any form, regardless of their manner of presentation. For example, the detection reagent may comprise in vitro diagnostic reagents. The diagnostic reagents described in this application may be included in the processes of disease prediction, prevention, diagnosis, treatment monitoring, prognostic observation, and health status evaluation. These reagents, kits, calibrators, quality control products, etc., used for in vitro detection of human samples can be used alone or in combination with instruments, appliances, equipment, or systems.

[0239] In some embodiments, the diagnosis of disease and / or symptom may include, or the detection reagent may be used for:

[0240] a) Detect B7H3 in the sample;

[0241] b) Detect endogenous B7H3 protein in tumor cells;

[0242] c) Detect tumor cells expressing B7H3; or

[0243] d) Detect the expression level of B7H3 in patient biosamples to predict or determine the prognosis and / or progression of the disease and / or condition;

[0244] e) Detect the expression level of B7H3 in patient biosamples to determine the patient population to be treated with B7H3-targeted therapy, wherein patients are treated with B7H3-targeted therapy when the expression level of B7H3 is moderate or high;

[0245] f) Detecting the expression level of B7H3 in patient biosamples to predict or determine the efficacy of B7H3-targeted therapy in said patients, wherein a moderate or high expression level of B7H3 indicates therapeutic efficacy with B7H3-targeted therapy; and / or

[0246] g) Detect the expression level of B7H3 in the patient's biological sample to modify the patient's treatment regimen, wherein when the expression level of B7H3 is moderate or high, the treatment regimen is modified to include B7H3-targeted therapy.

[0247] In this application, detection and / or diagnostic results can be interpreted using various methods and standards known in the art. In some embodiments, the severity of the disease and / or symptom described in this application is positively correlated with the level of B7H3. For example, detection and / or diagnostic results can be interpreted based on diagnostic guidelines agreed upon in the art. For example, when detection is performed by immunohistochemical staining, interpretation can be based on the percentage grading of positive cells, the staining intensity of positive cells, or a combination of the percentage grading of positive cells and the staining intensity of positive cells. For example, staining intensity can be positively correlated with the level of B7H3. For example, the interpretation of immunohistochemical staining results can employ a semi-quantitative scoring method. For example, when using diaminobenzidine (DAB) as the chromogenic reagent, the B7H3 staining intensity grading can be: 0 points, no staining; 1 point, pale yellow or weak staining; 2 points, brownish-yellow or moderate staining; 3 points, brownish-red or strong staining. For example, a B7H3 positive cell density of 0 indicates no cell staining, 1 indicates 1-10% cell staining, 2 indicates 11%-50% cell staining, and 3 indicates >50% cell staining. The final interpretation of the staining result in pathological tissue is the sum of the product of staining intensity and the positive cell density fraction: 0 indicates negative expression, 1 indicates weak positive expression (+), 2-3 indicates moderate positive (++), and greater than 3 indicates strong positive (+++). In addition to the above staining result interpretation indicators, other interpretation indicators can be derived from staining intensity and staining percentage according to actual needs.

[0248] In some embodiments, the expression level of B7H3 is moderate or high relative to one or more reference values. In some embodiments, the reference values ​​may be the level of B7H3 in one or more control samples. For example, one or more control samples may include (i) one or more samples obtained from normal healthy individuals; (ii) one or more samples obtained from patients with non-B7H3-related diseases; (iii) one or more samples obtained from tissues or organs of patients with B7H3-related diseases that are not affected by the B7H3 disease; and / or (iv) combinations thereof.

[0249] In this application, the diseases and / or conditions may include those related to B7H3. For example, the diseases and / or conditions may include those related to B7H3 expression. For example, the diseases and / or conditions may include tumors and / or cancers related to B7H3 expression. For example, the diseases and / or conditions may include those with intermediate or high B7H3 expression levels. For example, the diseases and / or conditions described in this application may include, but are not limited to: bladder cancer, breast cancer, bile duct cancer, colorectal cancer, lymphoma, esophageal cancer, glioma, head and neck squamous cell carcinoma, kidney cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, sarcoma, melanoma, gastric cancer, thymic cancer, endometrial cancer, and / or cervical cancer.

[0250] In this application, the patient is a patient with a disease and / or condition related to B7H3. For example, the patient is a patient with a disease and / or condition related to abnormal expression of B7H3. In some embodiments, the patient may include patients with tumors and / or cancers. For example, the patient may include, but is not limited to, patients with bladder cancer, breast cancer, bile duct cancer, colorectal cancer, lymphoma, esophageal cancer, glioma, head and neck squamous cell carcinoma, kidney cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, sarcoma, melanoma, gastric cancer, thymic cancer, endometrial cancer, and / or cervical cancer.

[0251] The isolated antigen-binding proteins, polypeptide molecules, chimeric antigen receptors, immunoconjugates, nucleic acid molecules, vectors, cells, pharmaceutical compositions, reagents, detection plates, and / or kits described in this application can be used for immunohistochemical detection of tumor tissues, improving the accuracy of immunohistochemical detection of tumor specimens, aiding in the diagnosis of malignant tumors, determining the primary site and pathological classification, and improving the diagnostic accuracy of tumors, especially poorly differentiated or undifferentiated tumors.

[0252] This application includes the following implementation methods:

[0253] 1. An isolated antigen-binding protein that specifically binds to B7H3, comprising HCDR1, HCDR2, and HCDR3 selected from any of the following groups:

[0254] a) HCDR1 contains the amino acid sequence shown in SEQ ID NO:1, HCDR2 contains the amino acid sequence shown in SEQ ID NO:2, and HCDR3 contains the amino acid sequence shown in SEQ ID NO:3;

[0255] b) HCDR1 contains the amino acid sequence shown in SEQ ID NO:7, HCDR2 contains the amino acid sequence shown in SEQ ID NO:8, and HCDR3 contains the amino acid sequence shown in SEQ ID NO:9;

[0256] c) HCDR1 contains the amino acid sequence shown in SEQ ID NO:12, HCDR2 contains the amino acid sequence shown in SEQ ID NO:13, and HCDR3 contains the amino acid sequence shown in SEQ ID NO:3; or

[0257] d) HCDR1 contains the amino acid sequence shown in SEQ ID NO:14, HCDR2 contains the amino acid sequence shown in SEQ ID NO:15, and HCDR3 contains the amino acid sequence shown in SEQ ID NO:16.

[0258] 2. The antigen-binding protein according to Embodiment 1, comprising LCDR1, LCDR2, and LCDR3 selected from any of the following groups:

[0259] a) The LCDR1 contains the amino acid sequence shown in SEQ ID NO:4, the LCDR2 contains the amino acid sequence shown in SEQ ID NO:5, and the LCDR3 contains the amino acid sequence shown in SEQ ID NO:6;

[0260] b) The LCDR1 contains the amino acid sequence shown in SEQ ID NO:10, the LCDR2 contains the amino acid sequence shown in SEQ ID NO:11, and the LCDR3 contains the amino acid sequence shown in SEQ ID NO:6; or

[0261] c) The LCDR1 contains the amino acid sequence shown in SEQ ID NO:17, the LCDR2 contains the amino acid sequence shown in SEQ ID NO:18, and the LCDR3 contains the amino acid sequence shown in SEQ ID NO:19.

[0262] 3. The isolated antigen-binding protein according to any one of embodiments 1-2, comprising a heavy chain variable region (VH) comprising the amino acid sequence shown in SEQ ID NO:20.

[0263] 4. The isolated antigen-binding protein according to any one of embodiments 1-3, comprising a light chain variable region (VL) comprising the amino acid sequence shown in SEQ ID NO:21.

[0264] 5. The isolated antigen-binding protein according to any one of embodiments 1-4, comprising a heavy chain variable region of the amino acid sequence shown in SEQ ID NO: 20 and a light chain variable region of the amino acid sequence shown in SEQ ID NO: 21.

[0265] 6. The isolated antigen-binding protein according to any one of embodiments 1-5, comprising a heavy chain constant region, said heavy chain constant region being derived from the heavy chain constant region of a human or rabbit antibody.

[0266] 7. The isolated antigen-binding protein according to any one of embodiments 1-6, comprising a heavy chain constant region, said heavy chain constant region being derived from the IgG heavy chain constant region.

[0267] 8. The isolated antigen-binding protein according to any one of embodiments 1-7 may have its heavy chain constant region containing the amino acid sequence shown in SEQ ID NO: 22.

[0268] 9. The isolated antigen-binding protein according to any one of embodiments 1-8, comprising a light chain constant region, wherein the light chain constant region may be derived from the light chain constant region of a human or rabbit antibody.

[0269] 10. The isolated antigen-binding protein according to any one of embodiments 1-9, comprising a light chain constant region, wherein the light chain constant region may be derived from the κ or λ chain of a human or rabbit.

[0270] 11. The isolated antigen-binding protein according to any one of embodiments 1-10 may have its light chain constant region containing the amino acid sequence shown in SEQ ID NO: 23.

[0271] 12. The isolated antigen-binding protein according to any one of embodiments 1-11, comprising an antibody heavy chain HC, wherein the HC comprises a heavy chain containing the amino acid sequence shown in SEQ ID NO: 24.

[0272] 13. The isolated antigen-binding protein according to any one of embodiments 1-12, comprising an antibody light chain LC, said LC comprising a light chain of the amino acid sequence shown in SEQ ID NO: 25.

[0273] 14. The isolated antigen-binding protein according to any one of embodiments 1-13, comprising an antibody or an antigen-binding fragment thereof.

[0274] 15. The antigen-binding protein isolated according to Embodiment 14, wherein the antigen-binding fragments include Fab, Fab', Fv fragments, F(ab')2, F(ab)2, scFv, di-scFv and / or dAb.

[0275] 16. The antigen-binding protein isolated according to Embodiment 14, wherein when the antigen-binding protein is scFv, a linker peptide may be present between the variable regions of its heavy chain and light chain.

[0276] 17. The isolated antigen-binding protein according to any one of embodiments 1-16, wherein the antibody is selected from one or more of the group consisting of: monoclonal antibodies, rabbit antibodies, chimeric antibodies, humanized antibodies, recombinant antibodies, single-chain antibodies, bifunctional antibodies, trifunctional antibodies, and tetrafunctional antibodies.

[0277] 18. The isolated antigen-binding protein according to Embodiment 17, wherein the chimeric antibody includes chimeric antibodies of humans, goats, monkeys, dogs, mice, and rabbits.

[0278] 19. An antigen-binding protein isolated according to any one of embodiments 1-18, wherein the antigen-binding protein is an IgG antibody.

[0279] 20. The isolated antigen-binding protein according to any one of embodiments 1-19, wherein the antigen-binding protein is labeled.

[0280] 21. The isolated antigen-binding protein according to embodiment 20, wherein the labeling comprises fluorescent labeling, enzyme labeling, biotin labeling, or radioactive labeling.

[0281] 22. A polypeptide molecule comprising the isolated antigen-binding protein of any one of embodiments 1-21.

[0282] 23. A chimeric antigen receptor comprising the isolated antigen-binding protein of any one of embodiments 1-21.

[0283] 24. An immunoconjugate comprising the isolated antigen-binding protein of any one of embodiments 1-21.

[0284] 25. A nucleic acid molecule encoding the isolated antigen-binding protein of any one of embodiments 1-21, the polypeptide molecule of embodiment 22, or the chimeric antigen receptor of embodiment 23.

[0285] 26. A carrier comprising the nucleic acid molecule described in embodiment 25.

[0286] 27. A cell that expresses any one of the antigen-binding proteins described in Embodiments 1-21, the polypeptide molecule described in Embodiment 22, or the chimeric antigen receptor described in Embodiment 23, or a cell containing the nucleic acid molecule described in Embodiment 25, or the vector described in Embodiment 26.

[0287] 28. A pharmaceutical composition comprising the isolated antigen-binding protein of any one of embodiments 1-21, the polypeptide molecule of embodiment 22, the chimeric antigen receptor of embodiment 23, the immunoconjugate of embodiment 24, the nucleic acid molecule of embodiment 25, the carrier of embodiment 26 and / or the cell of embodiment 27, and a pharmaceutically acceptable carrier.

[0288] 29. A reagent comprising the isolated antigen-binding protein of any one of Embodiments 1-21, the polypeptide molecule of Embodiment 22, the chimeric antigen receptor of Embodiment 23, the immunoconjugate of Embodiment 24, the nucleic acid molecule of Embodiment 25, the carrier of Embodiment 26, the cell of Embodiment 27, and / or the pharmaceutical composition of Embodiment 28.

[0289] 30. A detection plate comprising the isolated antigen-binding protein of any one of Embodiments 1-21, the polypeptide molecule of Embodiment 22, the chimeric antigen receptor of Embodiment 23, the immunoconjugate of Embodiment 24, the nucleic acid molecule of Embodiment 25, the carrier of Embodiment 26, the cell of Embodiment 27, and / or the pharmaceutical composition of Embodiment 28.

[0290] 31. A kit comprising the isolated antigen-binding protein of any one of Embodiments 1-21, the polypeptide molecule of Embodiment 22, the chimeric antigen receptor of Embodiment 23, the immunoconjugate of Embodiment 24, the nucleic acid molecule of Embodiment 25, the carrier of Embodiment 26, the cell of Embodiment 27, the pharmaceutical composition of Embodiment 28, the reagent of Embodiment 29, and / or the detection plate of Embodiment 30.

[0291] 32. The kit according to embodiment 31 comprises a negative control reagent, a negative control material, a quality control reagent and / or a quality control material.

[0292] 33. A method for preparing the isolated antigen-binding protein as described in any one of Embodiments 1-21.

[0293] 34. The method according to embodiment 33 includes the steps of:

[0294] a) Culturing the cells described in Embodiment 27; and / or

[0295] b) Isolate the antigen-binding protein from the culture, wherein the antigen-binding protein is the antigen-binding protein described in any one of Embodiments 1-21.

[0296] 35. A method for detecting B7H3 in a sample, comprising the isolated antigen-binding protein of any one of Embodiments 1-21, the polypeptide molecule of Embodiment 22, the chimeric antigen receptor of Embodiment 23, the immunoconjugate of Embodiment 24, the nucleic acid molecule of Embodiment 25, the carrier of Embodiment 26, the cell of Embodiment 27, the pharmaceutical composition of Embodiment 28, the reagent of Embodiment 29, the detection plate of Embodiment 30, and / or the kit of Embodiment 32.

[0297] 36. Use of the isolated antigen-binding protein of any one of Embodiments 1-21, the polypeptide molecule of Embodiment 22, the chimeric antigen receptor of Embodiment 23, the immunoconjugate of Embodiment 24, the nucleic acid molecule of Embodiment 25, the carrier of Embodiment 26, the cell of Embodiment 27, and / or the pharmaceutical composition of Embodiment 28 in the preparation of a medicament for the prevention and / or treatment of diseases and / or conditions.

[0298] 37. The use according to embodiment 36, wherein the disease and / or symptom includes diseases and / or symptoms related to B7H3.

[0299] 38. The use according to embodiment 37, wherein the disease and / or symptom includes a tumor.

[0300] 39. The use according to any one of embodiments 36-37, wherein the disease and / or condition includes adrenocortical carcinoma, bladder cancer, breast cancer, bile duct cancer, colorectal cancer, lymphoma, esophageal cancer, glioma, neuroblastoma, head and neck squamous cell carcinoma, kidney cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, sarcoma, melanoma, gastric cancer, thymic cancer, endometrial cancer and / or cervical cancer.

[0301] 40. Use of the isolated antigen-binding protein of any one of Embodiments 1-21, the polypeptide molecule of Embodiment 22, the chimeric antigen receptor of Embodiment 23, the immunoconjugate of Embodiment 24, the nucleic acid molecule of Embodiment 25, the carrier of Embodiment 26, the cell of Embodiment 27, and / or the pharmaceutical composition of Embodiment 28 in the preparation of a diagnostic reagent.

[0302] 41. The use according to embodiment 40, wherein the detection reagent is used for:

[0303] a) Detect B7H3 in the sample;

[0304] b) Detect endogenous B7H3 protein in tumor cells;

[0305] c) Detect tumor cells expressing B7H3;

[0306] d) Detect the expression level of B7H3 in patient biosamples to predict or determine the prognosis and / or progression of the disease and / or condition;

[0307] e) Detect the expression level of B7H3 in patient biosamples to determine the patient population to be treated with B7H3-targeted therapy, wherein patients are treated with B7H3-targeted therapy when the expression level of B7H3 is moderate or high;

[0308] f) Detecting the expression level of B7H3 in patient biosamples to predict or determine the efficacy of B7H3-targeted therapy in said patients, wherein a moderate or high expression level of B7H3 indicates therapeutic efficacy with B7H3-targeted therapy; and / or

[0309] g) Detect the expression level of B7H3 in the patient's biological sample to modify the patient's treatment regimen, wherein when the expression level of B7H3 is moderate or high, the treatment regimen is modified to include B7H3-targeted therapy.

[0310] 42. The use according to any one of embodiments 40-41, wherein the detection includes immunohistochemical detection, immunofluorescence detection, flow cytometry detection, enzyme-linked immunosorbent assay (ELISA), protein / peptide microarray detection, Western blotting detection, microbead immunoassay, and / or microfluidic immunoassay.

[0311] 43. The use according to any one of embodiments 40-42, wherein the patient is a tumor or cancer patient.

[0312] 44. The use according to any one of embodiments 40-43, wherein the patient is a patient with a B7H3-related tumor or cancer.

[0313] 45. The use according to any one of embodiments 40-44, wherein the cancer or tumor includes: bladder cancer, breast cancer, bile duct cancer, colorectal cancer, lymphoma, esophageal cancer, glioma, neuroblastoma, head and neck squamous cell carcinoma, kidney cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, sarcoma, melanoma, gastric cancer, thymic cancer, endometrial cancer and / or cervical cancer.

[0314] This application also includes the following implementation methods:

[0315] 1. A kit comprising isolated antigen-binding proteins specifically binding to B7H3, said isolated antigen-binding proteins comprising HCDR1, HCDR2, and HCDR3 selected from any of the following groups:

[0316] a) HCDR1 contains the amino acid sequence shown in SEQ ID NO:1, HCDR2 contains the amino acid sequence shown in SEQ ID NO:2, and HCDR3 contains the amino acid sequence shown in SEQ ID NO:3;

[0317] b) HCDR1 contains the amino acid sequence shown in SEQ ID NO:7, HCDR2 contains the amino acid sequence shown in SEQ ID NO:8, and HCDR3 contains the amino acid sequence shown in SEQ ID NO:9;

[0318] c) HCDR1 contains the amino acid sequence shown in SEQ ID NO:12, HCDR2 contains the amino acid sequence shown in SEQ ID NO:13, and HCDR3 contains the amino acid sequence shown in SEQ ID NO:3; or

[0319] d) HCDR1 contains the amino acid sequence shown in SEQ ID NO:14, HCDR2 contains the amino acid sequence shown in SEQ ID NO:15, and HCDR3 contains the amino acid sequence shown in SEQ ID NO:16.

[0320] 2. According to the kit of embodiment 1, the isolated antigen-binding protein may further comprise LCDR1, LCDR2 and LCDR3 selected from any of the following groups:

[0321] a) The LCDR1 contains the amino acid sequence shown in SEQ ID NO:4, the LCDR2 contains the amino acid sequence shown in SEQ ID NO:5, and the LCDR3 contains the amino acid sequence shown in SEQ ID NO:6;

[0322] b) The LCDR1 contains the amino acid sequence shown in SEQ ID NO:10, the LCDR2 contains the amino acid sequence shown in SEQ ID NO:11, and the LCDR3 contains the amino acid sequence shown in SEQ ID NO:6; or

[0323] c) The LCDR1 contains the amino acid sequence shown in SEQ ID NO:17, the LCDR2 contains the amino acid sequence shown in SEQ ID NO:18, and the LCDR3 contains the amino acid sequence shown in SEQ ID NO:19.

[0324] 3. The kit according to any one of embodiments 1-2, wherein the isolated antigen-binding protein comprises a heavy chain variable region (VH), the VH comprising the amino acid sequence shown in SEQ ID NO:20.

[0325] 4. The kit according to any one of embodiments 1-3, wherein the isolated antigen-binding protein comprises a light chain variable region (VL) comprising the amino acid sequence shown in SEQ ID NO:21.

[0326] 5. The kit according to any one of embodiments 1-4, wherein the isolated antigen-binding protein comprises the heavy chain variable region of the amino acid sequence shown in SEQ ID NO: 20 and the light chain variable region of the amino acid sequence shown in SEQ ID NO: 21.

[0327] 6. The kit according to any one of embodiments 1-5, wherein the concentration of the isolated antigen-binding protein is 0.1-10 μg / mL.

[0328] 7. The kit according to any one of embodiments 1-6, wherein the kit comprises reagents and / or materials for quality control.

[0329] 8. The kit according to any one of embodiments 1-7, wherein the kit comprises a negative control sample and / or a positive control sample.

[0330] 9. The kit according to Embodiment 8, wherein the negative control sample comprises slices of human cell lines that do not express B7H3.

[0331] 10. The kit according to any one of embodiments 8-9, wherein the positive control sample comprises a slice of a human cell line expressing B7H3 at a moderate / strong level.

[0332] 11. The kit according to any one of embodiments 1-10, wherein the kit comprises a kit / or material for a control.

[0333] 12. The kit according to any one of embodiments 1-11, wherein the kit comprises a negative control reagent.

[0334] 13. The kit according to any one of embodiments 1-13, wherein the kit comprises a negative control reagent comprising isotype IgG antibody.

[0335] 14. The kit according to any one of embodiments 1-13, wherein the kit comprises an antibody dilution reagent.

[0336] 15. The kit according to embodiment 14, wherein the antibody dilution reagent comprises a protein stabilizer, an antibacterial agent, and a preservative.

[0337] 16. The kit according to any one of embodiments 14-15, wherein the antibody dilution reagent may contain phosphate buffer.

[0338] 17. According to the kit of embodiment 16, the phosphate buffer may contain 0.01M PBS (phosphate buffer) containing 1% BSA (bovine serum albumin) and 0.05% proclin 300.

[0339] 18. The kit according to any one of embodiments 1-17, wherein the kit is an immunohistochemical detection kit, an enzyme-linked immunosorbent assay kit, a protein / peptide chip detection kit, an immunoblotting detection kit, a microbead immunoassay kit, or a microfluidic immunoassay kit.

[0340] 18. The kit according to any one of embodiments 1-17, wherein the kit is an immunohistochemical detection kit, and the kit further comprises reagents for antigen retrieval, reagents for blocking, chromogenic reagents, chromogenic enhancement reagents and / or signal enhancement reagents.

[0341] 19. The kit according to Embodiment 18, wherein the reagent for antigen retrieval may include heat-induced antigen retrieval buffer and / or enzyme-catalyzed antigen retrieval reagent.

[0342] 20. The kit according to any one of embodiments 18-19, wherein the reagent for antigen retrieval may include sodium citrate buffer, EDTA antigen retrieval solution and / or Tris-EDTA buffer.

[0343] 21. According to the kit described in Embodiment 20, the sodium citrate buffer may contain 10 mM sodium citrate and 0.05% Tween-20, and the pH is 6.0; the EDTA antigen retrieval solution may contain 1 mM EDTA and the pH is 8.0; the Tris-EDTA buffer may contain 10 mM Tris, 1 mM EDTA solution and 0.05% Tween-20, and the pH is 9.0.

[0344] 22. The kit according to any one of embodiments 18-21, wherein the blocking reagents include hydrogen peroxide blocking reagent, IHC blocking serum, protein blocking buffer, and biotin blocking agent.

[0345] 23. According to the kit described in Embodiment 22, the IHC blocking serum may include goat serum.

[0346] 24. According to the kit described in Embodiment 22, the protein blocking buffer may include skim milk powder.

[0347] 25. The kit according to any one of embodiments 18-24, wherein the chromogenic reagent comprises a substrate and an enzyme for converting the substrate into a chromogenic product.

[0348] 26. The kit according to any one of embodiments 18-25, wherein the chromogenic reagent comprises 3,3'-diaminobenzidine (DAB), 3-amino-9-ethylcarbazole (AEC), p-nitrophenyl phosphate (p-NPP), horseradish peroxidase (HRP) and / or alkaline phosphatase (AP).

[0349] 27. The kit according to any one of embodiments 18-26, wherein the colorimetric enhancement reagent comprises horseradish peroxidase (HRP) polymer and / or alkaline phosphatase (AP) polymer.

[0350] 28. The kit according to any one of embodiments 18-27, wherein the signal enhancement reagent comprises an enzyme-labeled second antibody that specifically recognizes the isolated antigen-binding protein.

[0351] 29. The signal enhancement reagent in any one of embodiments 18-28 may comprise a horseradish peroxidase-labeled second antibody.

[0352] 30. The kit according to any one of embodiments 28-29, wherein the second antibody comprises a rabbit antibody.

[0353] 31. A method for detecting B7H3, the method comprising using a kit as described in any one of embodiments 1-29.

[0354] 32. The method according to embodiment 31, the method comprising:

[0355] a) Provide samples from the subjects;

[0356] b) Contact the kit directly or indirectly with the sample;

[0357] c) Determine the B7H3 level in the sample; and / or

[0358] d) Compare the B7H3 level in the sample with one or more reference values.

[0359] 33. Use of the kit according to any one of embodiments 1-29, wherein the kit is used for:

[0360] a) Detect B7H3 in the sample;

[0361] b) Detect endogenous B7H3 protein in tumor cells;

[0362] c) Detect tumor cells expressing B7H3;

[0363] d) Detect the expression level of B7H3 in patient biosamples to predict or determine the prognosis and / or outcome of the disease and / or condition.

[0364] Or progress;

[0365] e) Detect the expression level of B7H3 in patient biosamples to determine the patient population to be treated with B7H3-targeted therapy, wherein patients are treated with B7H3-targeted therapy when the expression level of B7H3 is moderate or high;

[0366] f) Detecting the expression level of B7H3 in patient biosamples to predict or determine the efficacy of B7H3-targeted therapy in said patients, wherein a moderate or high expression level of B7H3 indicates therapeutic efficacy with B7H3-targeted therapy; and / or

[0367] g) Detect the expression level of B7H3 in the patient's biological sample to modify the patient's treatment regimen, wherein when the expression level of B7H3 is moderate or high, the treatment regimen is modified to include B7H3-targeted therapy.

[0368] 34. The use according to embodiment 33, wherein the patient is a tumor or cancer patient.

[0369] 35. The use according to any one of embodiments 33-34, wherein the patient is a patient with a B7H3-related tumor or cancer.

[0370] 36. The use according to any one of embodiments 33-35, wherein the cancer or tumor includes: bladder cancer, breast cancer, bile duct cancer, colorectal cancer, lymphoma, esophageal cancer, glioma, neuroblastoma, head and neck squamous cell carcinoma, kidney cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, sarcoma, melanoma, gastric cancer, thymic cancer, endometrial cancer and / or cervical cancer.

[0371] The embodiments described below are not intended to be limited by any theory, but are merely for illustrating the antigen-binding protein, preparation method and use of this application, and are not intended to limit the scope of the invention.

[0372] Example

[0373] The experimental instruments used in this application embodiment are shown in the following table:

[0374]

[0375]

[0376] The experimental reagents used in the embodiments of this application are shown in the following table:

[0377]

[0378] Reagent preparation:

[0379] 1% BSA: When preparing a 5ml solution, weigh 0.05g of BSA, add 5ml of PBS, shake to mix, and use when there are no bubbles.

[0380] DAB colorimetric reagent: The volume ratio of DAB substrate solution (reagent 2) to concentrated DAB solution (reagent 1) is 1 ml: 50 μl. Calculate the required volume based on the sample volume.

[0381] Immunohistochemical experiments:

[0382] The immunohistochemical experiments used in this patent all follow the immunohistochemical experimental steps described below.

[0383] Dewaxing / Hydration:

[0384] 1) Bake the slices at 60℃ for 60 minutes;

[0385] 2) Immerse in xylene three times, 5 minutes each time;

[0386] 3) Immerse in 100% ethanol twice, 5 minutes each time;

[0387] 4) Immerse in 70% ethanol twice, 5 minutes each time;

[0388] 5) Wash twice with water, 5 minutes each time.

[0389] Antigen retrieval:

[0390] 1) Microwave repair: Immerse in 1X citrate repair solution, microwave heat to boiling, maintain sub-boiling state (95℃-98℃) for 20 minutes, and then cool naturally for 30 minutes.

[0391] dyeing:

[0392] 1) Wash with water 3 times, 5 minutes each time;

[0393] 2) Cover with 3% hydrogen peroxide for 10 minutes;

[0394] 3) Rinse twice with water, 5 minutes each time;

[0395] 4) Wash twice with TBST, 5 minutes each time;

[0396] 5) Add 150 μl of blocking solution and incubate at room temperature for 10 min;

[0397] 6) Remove the blocking solution, add 150 μl of primary antibody (diluted to the recommended concentration), and incubate at 37°C for 1 h;

[0398] 7) Wash twice with TBST, 5 minutes each time;

[0399] 8) Add 150 μl of reaction enhancer (Zhongshan Jinqiao), and incubate at room temperature (25°C) for 20 min in a humidified chamber;

[0400] 9) Wash twice with TBST, 5 minutes each time;

[0401] 10) Add 150 μl of secondary antibody (Zhongshan Jinqiao), and incubate at room temperature (25°C) for 30 min in a humidified chamber;

[0402] 11) Wash twice with TBST, 5 minutes each time;

[0403] 12) Prepare the DAB colorimetric reagent according to the instructions;

[0404] 13) Use 150 μl of DAB colorimetric reagent to develop color for 2 min, then rinse off excess colorimetric reagent with running water.

[0405] 14) Stain with hematoxylin for 5 min, use differentiation solution for 15 s, and wash with water for 3 min;

[0406] 15) Stain with reverse blue solution for 15 seconds, then wash with water for 3 minutes;

[0407] 16) Immerse in 100% ethanol for 5 minutes; then immerse in xylene 2-3 times, 5 minutes each time;

[0408] Mount the slide with neutral resin and examine under a microscope.

[0409] Example 1: Screening and Recombinant Production of B7H3 Antibody

[0410] This embodiment involves immunizing rabbits with B7H3 extracellular peptides, screening for rabbit monoclonal antibodies that specifically recognize the B7H3 protein, and then performing recombinant expression using molecular cloning. A plasmid was constructed from the gene sequence of the rabbit monoclonal antibody specifically recognizing the B7H3 protein, and transfected into cells to obtain a cell line expressing the rabbit monoclonal antibody specifically recognizing the B7H3 protein. The cell line was then expanded, the culture medium was collected, and the antibody was purified to obtain the B7H3 antibody of this application. Specific experiments are as follows:

[0411] 1. Screening of B7H3 rabbit monoclonal antibodies

[0412] We purchased recombinant human B7-H3 protein antigen with fusion mouse C-terminal Fc and 6×His tag from Wuhan Dima Biotechnology Co., Ltd. The reference sequence is the B7H3 protein sequence with Swiss-Prot data number Q5ZPR3-2. The B7H3 immunogen covers amino acid sequences 29-245 of the extracellular region of the B7H3 protein. Rabbits were immunized three times using the B7H3 protein antigen. Serum from the immunized rabbits was collected, and the titer of B7H3 antibody in the serum after three immunizations was verified by indirect ELISA. Rabbits with an OD value greater than 2.7 after a 1:256000 serum dilution were selected. Blood from the rabbits was collected, and B7H3 antibody-positive B cells were enriched by flow cytometry. Single B cell cultures were then performed, and the cells were initially screened using the non-target protein mFc-His tag protein. The supernatant of the B cell culture after the initial screening was then rescreened by ELISA with the antigen B7H3-mFc-His. Flow cytometry analysis was performed on the supernatant obtained after the above screening using 293 cells overexpressing B7H3 protein to screen out candidate positive clones (Table 1).

[0413] Table 1

[0414]

[0415] Plasmids were constructed from the above positive clones and transfected into the 293 cell line. B7H3 antibody was expressed on a small scale. The antibody was purified with Protein A. Immunohistochemical experiments were performed using FFPE sections of the B7H3 positive cell line to screen for positive antibody clones. Finally, a rabbit monoclonal antibody 36H7 suitable for immunohistochemistry was selected. Figure 1 ).

[0416] 2. Production of B7H3 rabbit monoclonal antibody

[0417] (1) Synthesis of B7H3 antibody gene DNA sequence

[0418] The heavy and light chain DNA sequences of B7H3 (clone number 36H7) antibody were synthesized, and the synthesized sequences were amplified using specific primers to obtain sufficient amounts of 36H7 antibody heavy and light chain DNA sequences for recombination.

[0419] (2) Plasmid recombination

[0420] Perform antibody DNA fragment plasmid recombination according to the reaction system shown in the table below to construct the expression plasmid:

[0421]

[0422] (3) Colony screening experiment

[0423] 1) Transfect the constructed plasmid into E. coli, incubate overnight, and pick a single colony from the overnight plate.

[0424] 2) Colony PCR was performed using specific primers, and the PCR amplification products were then subjected to electrophoresis to identify positive clones. The specific primer sequences are as follows:

[0425] BI-CMV-F:CGCAAATGGGCGGTAGGCGTG (SEQ ID NO: 28);

[0426] BI-SEQ-R: AGCGTAAAAGGAGCAACATAGT (SEQ ID NO: 29).

[0427] 3) Four positive bacteria were randomly selected for culture. DNA was extracted from the cultured positive bacterial solution, amplified using primers, and the amplified products were sequenced for identification.

[0428] 4) Select the positive clone bacterial culture with correct sequencing, expand the culture, extract low endotoxin plasmids, and verify with sequencing.

[0429] (4) Plasmid extraction

[0430] Plasmids were extracted using a commercial plasmid extraction kit, and the plasmid concentration and purity were identified to obtain a sufficient quantity of plasmids. (5) Transfection and expression (taking 20 mL as an example)

[0431] 1) Take 145M cells, centrifuge and discard the supernatant.

[0432] 2) Add about 0.5 ml of electroporation buffer to the cells, mix well, and then add 2-3 mg of heavy chain plasmid and light chain plasmid mixture (mixing ratio of 1:1) (concentration 500 ng / ul).

[0433] 3) After thoroughly mixing the above cell plasmid suspension, take 1 ml and add it to a 1 ml electroporation tube. Place the electroporation tube into the electroporation apparatus for electroporation.

[0434] 4) After electroporation, aliquot the cells from the electroporation tube into a shaker containing 20ml of culture medium and incubate statically for 40min.

[0435] 5) After incubation, place the shake flask in a 37°C, 270 rpm, 8% CO2 incubator. After 24 hours, add feed / sodium butyrate / bismuth substrate.

[0436] Continue culturing for 3-7 days. On day 5, samples are taken to test the concentration of B7H3(36H7) antibody.

[0437] (6) Antibody purification: Purification was performed using a Protein A affinity chromatography column.

[0438] 1) Equilibration chromatography column: 1xPBS, flow rate 1ml / min, 20ml

[0439] 2) Sample loading: Flow rate 1 ml / min

[0440] 3) Washing: 1xPBS, flow rate 1ml / min, 20ml

[0441] 4) Elution: Sodium acetate buffer (pH 3.4), 1 ml / min, collected in aliquots, approximately 500 μL per tube. Collect a total of 10 tubes and read the absorbance at 280 nm using a NanoDrop instrument.

[0442] 5) Dialysis: Aspirate high-concentration protein into a dialysis bag and place it in a beaker containing 1XPBS for dialysis.

[0443] 6) Obtain antibodies with a purity of not less than 95%.

[0444] 3. Quality control of B7H3 rabbit monoclonal antibody

[0445] (1) Purity detection (SEC-HPLC)

[0446] Acceptable standard: Antibody purity ≥ 95%.

[0447] SEC experiments were performed using a high-performance liquid chromatograph (LC-20AT) and a gel chromatography column. The experimental conditions were as follows:

[0448]

[0449] Replace the water with the mobile phase, and slowly increase the flow rate to 1,000 ml / min until the baseline stabilizes. Transfer 25 μL of antibody to the corresponding numbered vial, place the vial in the appropriate position on the instrument, and inject the sample for 15 min. Analyze, process, and save the data. Replace the mobile phase with deionized water and rinse for 1.5 h.

[0450] (2) Endotoxin detection

[0451] 1) Preparation of test solution:

[0452] Sample dilution factor: MVD = C·L / λ

[0453] *Note: MVD: Maximum effective dilution factor of the test sample; L: Limit of bacterial endotoxin of the test sample (1 EU / mg); C:

[0454] Test sample concentration, λ: Limulus amebocyte lysate (LAL) reagent labeled sensitivity. 200 μL test solution sample volume = C / MVD * 200 μL

[0455] 2) Preparation of positive control solution: Prepare an aqueous solution containing 2λ endotoxin standard.

[0456] 3) Preparation of positive control solution for test sample: Prepare a test sample solution containing 2λ endotoxin standard.

[0457] 4) Sample addition: Take four caliber Limulus amebocyte lysate (LAL) reagents (sensitivity 0.06 EU / ml) that have passed sensitivity verification, wipe with a 75% alcohol swab, open, and add 0.1 ml of endotoxin test water to each vial to dissolve. Negative control tube: 10 μl of endotoxin test water; Positive control tube: 100 μl of positive control solution (0.12 EU / ml); Sample positive control tube: 100 μl of test sample positive solution; Test sample tube: 100 μl of test solution.

[0458] 5) Reaction: Seal the tube opening, shake gently, and incubate vertically in a 37℃ constant temperature incubator for 60 minutes.

[0459] 6) Acceptable standards for experimental results.

[0460]

[0461]

[0462] (3) Detection of B7H3 antibody molecular weight

[0463] 1) Prepare separating and stacking gels of appropriate concentrations according to the size of the proteins.

[0464] 2) Pour the prepared separating gel into a gel casting plate, seal with water, remove water after solidification, add stacking gel, insert the comb, remove the comb after solidification, and add buffer solution to submerge the gel.

[0465] 3) Denatured sample processing: Take a certain volume of sample, dilute it according to the protein loading buffer dilution ratio, heat it, centrifuge it and take the supernatant for electrophoresis.

[0466] 4) Add the denatured sample, non-denatured sample, and protein marker to the sample wells in sequence, close the electrophoresis tank lid, set the initial voltage to 80V, and start electrophoresis. After the sample enters the separating gel, increase the voltage to 100V until the electrophoresis is completed.

[0467] 5) After electrophoresis, remove the gel and stain it with dye solution. When the gel becomes opaque, start destaining it with destaining solution. Take a picture and save it after the background is clear.

[0468] Results: The theoretical molecular weight of the B7H3 (clone number 36H7) antibody is 142 kDa, with heavy and light chain molecular weights of 48 kDa and 23 kDa, respectively. Protein electrophoresis results showed that the molecular weight of the undenatured B7H3 antibody was 100–150 kDa, while the molecular weights of the heavy and light chains after denaturation were around 50 kDa and 25 kDa, respectively, consistent with the theoretical molecular weight of the B7H3 antibody. This indicates that the produced B7H3 antibody is identical to the B7H3 antibody obtained through screening. Figure 2 ).

[0469] Example 2: Affinity detection of B7H3 antibody

[0470] This embodiment illustrates that the antibody of this application can specifically bind to B7H3 with strong affinity. The affinity of the antibody described in this application was detected using an ELISA assay.

[0471] The experimental steps are as follows:

[0472] (1) Preparation of B7H3 antigen-coated ELISA plates. Add 100 μl of 0.5 μg / mL B7H3 antigen (Human B7-H3 / CD276 Protein, His Tag (MALS verified)) to each well of the ELISA plate, incubate at 4℃ for 16 h, wash the plate 5 times with PBST, add 200 μl of 5% BSA to each well, incubate at 25℃ for 60 min, and then wash the plate 5 times with PBST.

[0473] (2) Primary antibody incubation. Add different concentrations of B7H3 antibody (clone number 36H7), repeat for two wells for each concentration, incubate at 25°C for 1 h, and wash the plate 5 times with PBST.

[0474] (3) Secondary antibody incubation. Add HRP-labeled goat anti-rabbit secondary antibody, incubate at 25℃ for 0.5h, and wash the plate 5 times with PBST.

[0475] (4) Color development. Add color development reagent, incubate at 25℃ for 15 min, and add stop reagent.

[0476] (5) Detection and Analysis. The absorbance was measured at 450 nm using a microplate reader. An absorbance curve was plotted. The EC was calculated based on the obtained absorbance curve. 50 value.

[0477] The affinity test results are shown in Table 2. After fitting with four parameters, the absorbance and B7H3 antibody concentration showed an S-shaped curve. The absorbance plateaued after the antibody concentration reached ≥0.1 μg / mL. 50 The concentration was 0.01807 μg / mL, indicating that the B7H3 antibody described in this application has a high affinity for the B7H3 antigen. Figure 3 ).

[0478]

[0479] Example 3: The B7H3 antibody has a high titer.

[0480] This embodiment illustrates that the B7H3 antibody of this application has a high titer. Even at a low concentration, the B7H3 antibody can still detect the expression of B7H3 without obvious background staining.

[0481] This embodiment uses B7H3-positive and B7H3-negative cell lines to verify the effect of different B7H3 antibody concentrations (clone number 36H7) on the detection efficiency of B7H3. Immunohistochemical experiments were performed using four B7H3 antibody concentrations, from highest to lowest: 10 μg / mL, 3.5 μg / mL, 1 μg / mL, and 0.5 μg / mL. Figure 4A The immunohistochemical results showed that at all four concentrations, the B7H3 antibody produced a significant positive signal and distinct cell membrane staining in B7H3-positive cell lines, indicating that the B7H3 antibody specifically recognizes the B7H3 extracellular antigen. Conversely, the B7H3 antibody did not exhibit significant specific staining in B7H3-negative cell lines; only at high antibody concentrations was some background staining observed, which gradually disappeared as the antibody concentration decreased.

[0482] To further investigate the minimum titer of the B7H3 antibody, based on the above cell line experiments, gastric cancer, prostate cancer, liver cancer, and glioma cells expressing B7H3 were selected for further validation. The staining performance of the B7H3 antibody at concentrations of 0.5 μg / mL and 0.1 μg / mL was verified, respectively. Figure 4B The immunohistochemical results showed that at an antibody concentration of 0.5 μg / mL, significant staining signals were observed in B7H3-positive gastric cancer, prostate cancer, liver cancer, and glioma samples. At an antibody concentration of 0.1 μg / mL, weaker staining signals were observed in these samples, indicating that the staining signal increased accordingly with increasing B7H3 antibody concentration. Immunohistochemical staining was most effective at B7H3 antibody concentrations ≥0.5 μg / mL.

[0483] Therefore, this embodiment further explored the optimal immunohistochemical concentration of B7H3 antibody, such as... Figure 4C As shown, this embodiment selects B7H3-positive renal cell carcinoma, prostate cancer, and liver cancer samples to explore the optimal immunohistochemical concentration of B7H3 antibody. Based on Figure 4A and Figure 4B Based on the experimental data, immunohistochemical experiments were conducted at concentrations of 1 μg / mL, 0.7 μg / mL, and 0.5 μg / mL. The results showed that 1 μg / mL, 0.7 μg / mL, and 0.5 μg / mL all produced typical staining in renal cell carcinoma, prostate cancer, and liver cancer samples, with obvious cell membrane staining. The staining pattern of B7H3 antibody was very consistent across the three concentrations. The staining intensity was slightly deeper at 1 μg / mL, but the difference in staining intensity between the three concentrations was not significant. To improve the detection sensitivity of B7H3 and reduce non-specific background staining, 0.7 μg / mL was selected as the optimal immunohistochemical concentration for B7H3 antibody.

[0484] Example 4: The B7H3 antibody has high sensitivity.

[0485] To determine the sensitivity of the B7H3 (clone number 36H7) antibody in immunohistochemical experiments, this embodiment selected four glioma samples with B7H3 expression intensities of strong positive, moderate positive, weak positive, and negative, respectively. Immunohistochemical experiments were performed on these four glioma samples with different B7H3 expression intensities according to the immunohistochemical method described in this patent to verify the sensitivity of the B7H3 antibody. Figure 5 As shown, the staining intensity of B7H3 (clone number 36H7) antibody in the four samples was consistent with the trend of B7H3 expression intensity in the aforementioned tissues. Specifically, in strongly positive and moderately positive glioma samples, strong staining signals were observed after B7H3 antibody incubation, with the staining signal in strongly positive samples being stronger than that in moderately positive samples. However, in weakly positive samples, the staining signal significantly decreased after B7H3 antibody incubation, and no staining signal was observed in negative samples. These data indicate that B7H3 antibody staining can effectively detect clinical samples with different levels of B7H3 expression, and can also effectively detect and identify samples with low B7H3 expression.

[0486] Example 5: Specificity of B7H3 (clone number 36H7) antibody for diagnosis.

[0487] This embodiment illustrates that B7H3 can be used as an indicator of disease state. By using the B7H3 antibody of this application, the level of B7H3 in biological samples can be specifically detected, which can be used for the diagnosis of diseases related to B7H3 expression.

[0488] This embodiment simulates the specificity of the B7H3 antibody in recognizing the B7H3 protein in clinical samples by adding different concentrations of recombinant B7H3 protein antigen and different types of B7H3 homologous proteins to the B7H3 antibody (clone number 36H7). The experiment explores the specificity of the B7H3 antibody in recognizing the B7H3 protein in clinical samples. This embodiment uses a clinical sample of a glioma with high B7H3 expression for the experiment. Figure 6As shown, high concentrations of B7H3 homologous proteins (B7H1, B7H2, and B7H4) were added to B7H3 antibody to form a mixture. Immunohistochemical experiments were performed using this mixture. The results showed that the B7H3 antibody containing B7H3 homologous proteins (B7H1, B7H2, and B7H4) could still detect B7H3 in glioma samples with high B7H3 expression, exhibiting a strong staining signal. This indicates that the B7H3 homologous proteins (B7H1, B7H2, and B7H4) do not bind to the B7H3 antibody, thus avoiding false positive signals. Furthermore, different concentrations of recombinant B7H3 protein were added to the B7H3 antibody to investigate the effect of the specific binding of the B7H3 antibody to the recombinant B7H3 protein on the detection of B7H3 expression in clinical samples. Figure 6 As shown, without the addition of recombinant B7H3 protein, the B7H3 antibody can detect B7H3 in glioma samples with a strong staining signal. However, as the amount of recombinant B7H3 protein added increases, the staining signal of the B7H3 antibody gradually weakens and eventually disappears, resulting in no staining signal, similar to the negative control. This indicates that the B7H3 antibody binds to the B7H3 protein with high specificity and does not bind to other components in the clinical sample. Therefore, no false positive signals were observed due to non-specific binding of the B7H3 antibody. The above data demonstrate that the B7H3 antibody described in this application has very high specificity for B7H3 and will not bind non-specifically to other components in the clinical sample, thus avoiding false positive signals. Therefore, the B7H3 antibody described in this application has excellent performance in detecting B7H3 expression in clinical samples and can be further developed into a diagnostic reagent for clinical B7H3 expression detection.

[0489] Example 6: Comparison of immunohistochemical properties of the B7H3 antibody of this application and commercially available antibodies.

[0490] Currently, there are commercially available monoclonal antibodies targeting B7H3. To determine the performance of the B7H3 antibody in this application, this embodiment selects the most widely used B7H3 rabbit monoclonal antibody (catalog number CST-B7H3-#14058) on the market and compares its immunohistochemical performance with that of the B7H3 antibody in this patent application to further demonstrate the performance of the B7H3 antibody. In this comparative experiment, the primary antibody concentration and reaction system of the B7H3 rabbit monoclonal antibody (catalog number CST-B7H3-#14058) are as per the antibody's instruction manual and COA. The experimental steps of the immunohistochemical method are as listed in this patent. The concentration of the B7H3 antibody (clone number 36H7) was selected as 0.7 μg / mL. This embodiment selects B7H3-positive cell lines, B7H3-negative cell lines, and 6 clinical samples of B7H3-positive gallbladder, breast cancer, gastric cancer, renal cancer, gallbladder cancer, and lung adenocarcinoma for testing.

[0491] like Figure 7 As shown, both B7H3 (clone number 36H7) antibody and B7H3 (CST-B7H3-#14058) antibody showed typical cell staining in B7H3-positive cell lines, but no staining in B7H3-negative cell lines, with relatively little background. However, the staining intensity of B7H3 (clone number 36H7) antibody in B7H3-positive cell lines was stronger than that of B7H3 (CST-B7H3-#14058) antibody, indicating that under their respective optimal reaction conditions, the staining intensity of B7H3 antibody is higher than that of B7H3 (CST-B7H3-#14058) antibody. Furthermore, in this embodiment, B7H3 antibody and B7H3 (CST-B7H3-#14058) antibody were used to perform immunohistochemical tests on six B7H3-positive clinical samples from gallbladder, breast cancer, gastric cancer, renal cancer, gallbladder cancer, and lung adenocarcinoma. Figure 8 As shown, in all 6 clinical samples, there were significant differences in the staining signals of the two antibodies in the same areas of the clinical samples: in renal cell carcinoma, normal gallbladder, and gallbladder cancer samples, the staining intensity of B7H3 antibody was higher than that of B7H3(CST-B7H3-#14058) antibody. In breast cancer, gastric cancer, and pancreatic cancer samples, the staining intensity of B7H3 antibody was also higher than that of B7H3(CST-B7H3-#14058) antibody. Moreover, B7H3 antibody had higher sensitivity, and the percentage of cells expressing B7H3 positive by immunohistochemistry was higher than that of B7H3(CST-B7H3-#14058) antibody. In areas where B7H3(CST-B7H3-#14058) antibody did not stain, B7H3 antibody could sensitively identify them, showing better sensitivity. This helps to correctly identify the expression status of B7H3 and assists in disease diagnosis and prognosis.

[0492] In summary, the B7H3 antibody exhibits superior performance compared to the representative commercially available B7H3 antibody (CST-B7H3-#14058). Diagnostic products can be further developed based on the B7H3 antibody for clinical applications such as diagnosis and efficacy prediction of B7H3-related diseases.

[0493] Example 7: Immunoreactivity Detection of B7H3 Antibody

[0494] This embodiment illustrates that the B7H3 antibody of this application can bind to the B7H3 (CD276) protein molecule expressed in tumor tissue with high affinity, and can be used for the detection of B7H3 in various tumor tissues.

[0495] This embodiment selected representative and prevalent tumor indications in which B7H3 is highly expressed. These indications include: breast cancer, cervical cancer, gastric cancer, prostate cancer, liver cancer, kidney cancer, lung cancer, and glioma. The ability of the B7H3 antibody described in this application to detect B7H3 expression in these tumor samples was tested using samples from the aforementioned tumor indications. The immunohistochemical method used for the B7H3 (clone number 36H7) antibody in this embodiment has been described in detail above.

[0496] like Figure 9 As shown, the B7H3 antibody detected B7H3 expression in clinical samples from breast cancer, cervical cancer, gastric cancer, prostate cancer, liver cancer, kidney cancer, lung cancer, and glioma, with significant cell membrane staining. This indicates that although there are differences in tumor tissue types, the B7H3 antibody can still recognize the extracellular antigenic epitopes of B7H3 protein in different tumor tissues. This demonstrates that the B7H3 antibody of this application has broad applicability in detecting B7H3 expression in various tumor types. The B7H3 antibody of this application can be used to detect B7H3 expression in various tumor indications, including but not limited to breast cancer, cervical cancer, gastric cancer, prostate cancer, liver cancer, kidney cancer, lung cancer, and glioma, providing support for drug efficacy evaluation, diagnosis, treatment, and prognosis of B7H3 expression-related diseases.

[0497] Example 8: Performance Evaluation of the B7H3 Detection Kit (Immunohistochemistry)

[0498] This embodiment illustrates that the B7H3 antigen-binding protein described in this application can be further prepared into a detection kit, and the kit can be used as an in vitro diagnostic reagent for the detection of B7H3 expression in clinical practice, thereby supporting drug efficacy evaluation, diagnosis, treatment and prognosis of diseases related to B7H3 expression.

[0499] The B7H3 kit described in this application can detect B7H3 expression via immunohistochemistry. In addition to the B7H3 antigen-binding protein described in this application, the kit may also include positive and negative cell line control slides and rabbit isotype antibody IgG. The performance of this detection kit was tested on a Leica BOND III automated staining platform (including the BOND III automated staining machine, antigen retrieval reagent, and signal enhancement reagent). Specific implementation steps are shown in Table 3 of this embodiment, and the reagents, consumables, and equipment involved in the experiment are shown in Tables 4 and 5 of this embodiment.

[0500] Table 3 Experimental Procedure

[0501] step Time / min Conditions: Room temperature 18-27℃ Antigen repair ER2(EDTA) Hydrogen peroxide blocking 5min Primary Antibody 0.7 μg / ml 36H7, incubate at room temperature for 30 min Polymer color enhancement agent Room temperature, 4 minutes DAB colorimetric assay 5min Hematoxylin 8min

[0502] Table 4 Experimental Instruments

[0503]

[0504] Table 5 Experimental Reagents

[0505]

[0506] like Figure 10A As shown, this embodiment uses glioma samples for testing. This kit can accurately detect different levels of B7H3 protein expression in glioma samples, and the cell membrane staining is relatively clear. The staining results are interpreted based on the percentage and intensity of positive cell staining, determining the detected glioma samples to have strong positive, moderate positive, weak positive, and negative B7H3 expression levels, indicating that this kit can detect different levels of B7H3 expression and has high sensitivity. Furthermore, as... Figure 10B As shown, no staining was observed with the negative control IgG antibody in the positive and negative cell line control slides. Similarly, no staining was observed with the B7H3 antibody in the negative cell line control slide, but staining was observed in the positive cell line control slide. This indicates that the selected negative control reagent and positive / negative control slides have good performance and can be used for monitoring the entire experimental system, ensuring the experiment proceeds normally and obtaining accurate data. Therefore, the kit consisting of positive / negative cell line control slides, rabbit Isotype antibody IgG, and B7H3 antibody (clone number 36H7) demonstrates good application potential for immunohistochemical detection on the Leica immunohistochemical staining platform.

Claims

1. An antibody or an antigen-binding fragment thereof, capable of specifically binding to B7H3, comprising HCDR1, HCDR2, and HCDR3, and LCDR1, LCDR2, and LCDR3, wherein, (1) CDR partitioning is performed using the Kabat method, wherein HCDR1 is shown as SEQ ID NO:1, HCDR2 is shown as SEQ ID NO:2, and HCDR3 is shown as SEQ ID NO:3; LCDR1 is shown as SEQ ID NO:4, LCDR2 is shown as SEQ ID NO:5, and LCDR3 is shown as SEQ ID NO:6; or, (2) CDRs are partitioned using the IMGT method, wherein HCDR1 is shown in SEQ ID NO:7, HCDR2 is shown in SEQ ID NO:8, and HCDR3 is shown in SEQ ID NO:9; LCDR1 is shown in SEQ ID NO:10, LCDR2 is shown in SEQ ID NO:11, and LCDR3 is shown in SEQ ID NO:6; or, (3) CDRs are partitioned using the Chothia method, wherein HCDR1 is shown in SEQ ID NO:12, HCDR2 is shown in SEQ ID NO:13, and HCDR3 is shown in SEQ ID NO:3; LCDR1 is shown in SEQ ID NO:4, LCDR2 is shown in SEQ ID NO:5, and LCDR3 is shown in SEQ ID NO:6; or, (4) CDRs are divided using the Contact method, wherein HCDR1 is shown in SEQ ID NO:14, HCDR2 is shown in SEQ ID NO:15, HCDR3 is shown in SEQ ID NO:16; LCDR1 is shown in SEQ ID NO:17, LCDR2 is shown in SEQ ID NO:18, and LCDR3 is shown in SEQ ID NO:

19.

2. The antibody or antigen-binding fragment thereof according to claim 1, comprising a heavy chain variable region (VH) as shown in SEQ ID NO:

20.

3. The antibody or antigen-binding fragment thereof according to claim 1, comprising a light chain variable region (VL) as shown in SEQ ID NO:

21.

4. The antibody or antigen-binding fragment thereof according to claim 1, comprising a heavy chain variable region of the amino acid sequence shown in SEQ ID NO: 20 and a light chain variable region of the amino acid sequence shown in SEQ ID NO:

21.

5. The antibody or antigen-binding fragment thereof according to claim 1, comprising a heavy chain constant region derived from a human or rabbit antibody heavy chain constant region.

6. The antibody or antigen-binding fragment thereof according to claim 1, comprising a heavy chain constant region derived from the IgG heavy chain constant region.

7. The antibody or antigen-binding fragment thereof according to claim 1, wherein the heavy chain constant region comprises the amino acid sequence shown in SEQ ID NO:

22.

8. The antibody or antigen-binding fragment thereof according to claim 1, comprising a light chain constant region derived from the light chain constant region of a human or rabbit antibody.

9. The antibody or antigen-binding fragment thereof according to claim 1, comprising a light chain constant region derived from a human or rabbit κ or λ chain.

10. The antibody or antigen-binding fragment thereof according to claim 1, wherein the light chain constant region is shown in SEQ ID NO:

23.

11. The antibody or antigen-binding fragment thereof according to claim 1, comprising an antibody heavy chain as shown in SEQ ID NO:

24.

12. The antibody or antigen-binding fragment thereof according to claim 1, comprising an antibody light chain as shown in SEQ ID NO:

25.

13. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antigen-binding fragment comprises Fab, Fab', Fv fragment, F(ab')2, F(ab)2, scFv, and / or di-scFv.

14. The antibody or antigen-binding fragment thereof according to claim 1, wherein when the antigen-binding fragment is scFv, a linker peptide is present between the variable regions of its heavy and light chains.

15. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody is selected from one or more of the group consisting of: monoclonal antibodies, rabbit antibodies, chimeric antibodies, humanized antibodies, recombinant antibodies, and single-chain antibodies.

16. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody is an IgG antibody.

17. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment thereof is labeled.

18. The antibody or antigen-binding fragment thereof according to claim 17, wherein the labeling comprises fluorescent labeling, enzyme labeling, biotin labeling or radiolabeling.

19. A nucleic acid molecule encoding an antibody or an antigen-binding fragment thereof as described in any one of claims 1-16.

20. A vector comprising the nucleic acid molecule of claim 19.

21. A cell expressing the antibody or antigen-binding fragment thereof as described in any one of claims 1-16, or comprising the nucleic acid molecule as described in claim 19, or the vector as described in claim 20.

22. A pharmaceutical composition comprising an antibody or an antigen-binding fragment thereof as described in any one of claims 1-18, a nucleic acid molecule as described in claim 19, a carrier as described in claim 20, and / or a cell as described in claim 21, and a pharmaceutically acceptable carrier.

23. A reagent comprising the antibody or antigen-binding fragment thereof of any one of claims 1-18, the nucleic acid molecule of claim 19, the carrier of claim 20, the cell of claim 21, and / or the pharmaceutical composition of claim 22.

24. A detection plate comprising an antibody or antigen-binding fragment thereof as described in any one of claims 1-18, a nucleic acid molecule as described in claim 19, a carrier as described in claim 20, a cell as described in claim 21, and / or a pharmaceutical composition as described in claim 22.

25. A kit comprising the antibody or antigen-binding fragment thereof of any one of claims 1-18, the nucleic acid molecule of claim 19, the vector of claim 20, the cell of claim 21, the pharmaceutical composition of claim 22, the reagent of claim 23, and / or the detection plate of claim 24.

26. The kit of claim 25, wherein the kit comprises the antibody or an antigen-binding fragment thereof at a concentration of 0.1-10 μg / mL.

27. The kit according to claim 25, comprising a negative control reagent, a negative control material, a quality control reagent and / or a quality control material.

28. The kit according to claim 25, comprising a negative control sample and / or a positive control sample.

29. The kit of claim 28, wherein the negative control sample comprises slices of human cell lines that do not express B7H3.

30. The kit of claim 28, wherein the positive control sample comprises a slice of a human cell line expressing B7H3.

31. The kit according to claim 27, wherein the negative control reagent comprises isotype IgG antibody.

32. The kit according to claim 25, comprising an antibody dilution reagent.

33. The kit according to claim 32, wherein the antibody dilution reagent comprises a protein stabilizer, an antibacterial agent, and / or a preservative.

34. The kit according to claim 32, wherein the antibody dilution reagent comprises phosphate buffer.

35. The kit according to claim 34, wherein the phosphate buffer comprises 0.01M PBS (phosphate buffer) containing 1% BSA (bovine serum albumin) and 0.05% proclin 300.

36. The kit according to claim 25, wherein it is an immunohistochemical detection kit, an enzyme-linked immunosorbent assay kit, a protein or peptide chip detection kit, an immunoblotting detection kit, a microbead immunoassay kit, or a microfluidic immunoassay kit.

37. The kit according to claim 25, wherein the kit is an immunohistochemical detection kit, the kit further comprising reagents for antigen retrieval, reagents for blocking, chromogenic reagents, chromogenic enhancement reagents and / or signal enhancement reagents.

38. The kit according to claim 37, wherein the reagent for antigen retrieval comprises heat-induced antigen retrieval buffer and / or enzyme-catalyzed antigen retrieval reagent.

39. The kit according to claim 38, wherein the reagent for antigen retrieval comprises sodium citrate buffer, EDTA antigen retrieval solution and / or Tris-EDTA buffer.

40. The kit according to claim 39, wherein the sodium citrate buffer comprises 10 mM sodium citrate and 0.05% Tween-20, and has a pH of 6.0; the EDTA antigen retrieval solution comprises 1 mM EDTA and has a pH of 8.0; and the Tris-EDTA buffer comprises 10 mM Tris, 1 mM EDTA solution, and 0.05% Tween-20, and has a pH of 9.

0.

41. The kit according to claim 37, wherein the blocking reagents include hydrogen peroxide blocking reagent, IHC blocking serum, protein blocking buffer, and biotin blocking agent.

42. The kit according to claim 41, wherein the IHC blocking serum comprises goat serum.

43. The kit according to claim 41, wherein the protein blocking buffer comprises skim milk powder.

44. The kit of claim 37, wherein the chromogenic reagent comprises a substrate and an enzyme that converts the substrate into a chromogenic product.

45. The kit according to claim 37, wherein the chromogenic reagent comprises 3,3'-diaminobenzidine (DAB), 3-amino-9-ethylcarbazole (AEC), p-nitrophenyl phosphate (p-NPP), horseradish peroxidase (HRP), and / or alkaline phosphatase (AP).

46. ​​The kit of claim 37, wherein the signal enhancement reagent comprises an enzyme-labeled second antibody that specifically recognizes the antibody or its antigen-binding fragment.

47. The kit according to claim 46, wherein the second antibody comprises a rabbit antibody.

48. A method for preparing the antibody or antigen-binding fragment thereof as described in any one of claims 1-18.

49. The method of claim 48, further comprising the steps of: a) Culturing the cells of claim 21; and / or b) Isolate the antibody or antigen-binding fragment thereof as described in claim 1 from the culture.

50. Use of the antibody or antigen-binding fragment thereof of any one of claims 1-18, the nucleic acid molecule of claim 19, the carrier of claim 20, the cell of claim 21, and / or the pharmaceutical composition of claim 22 in the preparation of a medicament for the prevention and / or treatment of a disease and / or condition, said disease and / or condition being breast cancer, glioma, kidney cancer, liver cancer, lung cancer, prostate cancer, gastric cancer, and / or cervical cancer.

51. Use of the antibody or antigen-binding fragment thereof of any one of claims 1-18, the nucleic acid molecule of claim 19, the vector of claim 20, the cell of claim 21, and / or the pharmaceutical composition of claim 22 in the preparation of a reagent for detecting B7H3.

52. The use according to claim 51, wherein the detection includes immunohistochemical detection, immunofluorescence detection, flow cytometry detection, enzyme-linked immunosorbent assay (ELISA), protein / peptide microarray detection, Western blotting detection, microbead immunoassay, and / or microfluidic immunoassay.

Citation Information

Patent Citations

  • Human antibodies derived from immunized xenomice

    US6150584A

  • Production of multimeric protein by cell fusion method

    US6420140B1

  • Production of antibodies using cre-mediated site-specific recombination

    US6458592B1

  • Compositions and methods for treating inflammatory disorders

    WO2006003388A2

  • Compositions monovalent for CD40l binding and methods of use

    WO2006030220A1