Mutant strain of mannheimia haemolytica bovis and application thereof

Abstract

This invention discloses a mutant strain of *Mannella hemolyticus* and its application, relating to the field of bioengineering technology. The mutant strain, named MhA6-118, is deposited at the China Center for Type Culture Collection (CCTCC) with accession number M20242493, dated November 8, 2024. This invention employs a chemical mutagenesis method to treat a highly virulent strain of *Mannella hemolyticus*, Mh3-1, successfully screening for the weakened mutant strain MhA6-118. The inactivated vaccine prepared using this mutant strain exhibits significant cross-immunoprotective effects against multiple serotypes of *Mannella hemolyticus*, including bovine and ovine strains, providing a highly promising candidate strain for the development of a universal vaccine against *Mannella hemolyticus*.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, specifically to a bovine hemolytic Manslaughter bacillus mutagenesis strain and its application. Background Technology

[0002] Mannheimia haemolytica (Mh) is a facultative anaerobic coccus that shows bipolar staining after Wright's staining. Belonging to the family Pasteurellaceae and genus Mannheimia, it exhibits weak hemolytic activity and is highly similar to Pasteurella multocida. Mannheimia is an opportunistic pathogen, normally parasitizing the nasopharynx and tonsils of healthy cattle and sheep, maintaining a symbiotic relationship with the host. However, under stress conditions, such as weaning, long-distance transport, sudden weather changes, or mixed infections with other microorganisms, it can cause various bovine respiratory disease syndrome (BRDC), ovine pneumonia, and acute septicemia in newborn lambs, posing a significant threat to the health of cattle and sheep. Among the Mannheimia genus, hemolytic Mannheimia haemolytica is the most pathogenic member, with 12 serotypes (A1, A2, A5-A9, A12-A14, A16, and A17), of which A1, A2, and A6 are the most common. Cattle are primarily infected with serotypes A1 and A6, while sheep can be infected with almost all serotypes. Cross-immunity between different serotypes is weak or nonexistent.

[0003] Currently, my country only has one commercially available inactivated vaccine against Bovine Mansicae hemolyticus, but its clinical efficacy data is lacking. Furthermore, the immunization efficacy of foreign vaccines against Mansicae hemolyticus after clinical application has not been ideal. This poor vaccine protection means that the control of Mansicae hemolyticus still relies on antibiotics, leading to a large number of drug-resistant strains. Therefore, developing a broad-spectrum vaccine against Mansicae hemolyticus is crucial for the effective prevention and control of this pathogen. Summary of the Invention

[0004] To address the aforementioned shortcomings of the prior art, this invention provides a bovine hemolytic Mansl bacillus MhA6-118 and its applications.

[0005] To achieve the above-mentioned objectives, the technical solution adopted by this invention is as follows:

[0006] A mutant strain of bovine hemolytic Mannheimia haemolytica or its variant or progeny is provided. The bovine hemolytic Mannheimia haemolytica mutant strain is named MhA6-118Mannheimia haemolytica MhA6-118 and is deposited at the China Center for Type Culture Collection (CCTCC), Wuhan, China, with accession number CCTCC No. M20242493 and deposit date of November 8, 2024.

[0007] The present invention also provides an inactivated vaccine for bovine hemolytic mansoni infection, comprising an adjuvant and an antigen, wherein the antigen is the aforementioned bovine hemolytic mansoni mutant strain mhA6-118.

[0008] Furthermore, the vaccine provides cross-immune protection against both homologous and heterologous Mansorobacter infections.

[0009] Furthermore, cross-immunity protection is the cross-immunity protection against infections caused by bovine hemolytic Mansonia solani strains A6, A1, and A2, sheep-derived hemolytic Mansonia solani strains, and bovine multi-source Mansonia solani strains.

[0010] The beneficial effects of this invention are as follows:

[0011] This invention employs a chemical mutagenesis method to treat a highly virulent strain of bovine hemolytic Manslaughter Mh3-1, successfully screening for a weakened mutant strain, MhA6-118. The inactivated vaccine prepared using this mutant strain exhibits significant cross-immunoprotective effects against multiple serotypes of hemolytic Manslaughter, including bovine and ovine strains, providing a highly promising candidate strain for the development of a universal vaccine against hemolytic Manslaughter. Attached Figure Description

[0012] Figure 1 This is a Wright staining image of hemolytic Mansonia MhA6-118 in Example 1;

[0013] Figure 2 This is a diagram showing the PCR amplification results of hemolytic Mansonia MhA6-118 in Example 1;

[0014] Figure 3 This is a graph showing the drug resistance and drug resistance gene assay of the strain in Example 3;

[0015] Figure 4 The images show the SDS-PAGE and Western blot results of the mutant strain in Example 4.

[0016] Figure 5 This is a comparison chart of the immunoprotective assays of the mutant strains in Example 5. Detailed Implementation

[0017] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0018] Example 1: Isolation and Comparative Analysis of Bovine Hemolytic Mansonepaes

[0019] The strains were isolated from bovine nasal swabs collected from several beef cattle farms in Southwest China. The collected nasal swabs were directly placed in EP containing 1 mL of sterile physiological saline and shaken thoroughly. 100 μL of the mixed nasal swab liquid was then evenly spread onto Martin broth medium containing 5% rabbit blood and incubated at 37°C for 24 h. Martin broth medium (MD) was purchased from Qingdao Haibo Biotechnology Co., Ltd.

[0020] The growth of colonies on the culture medium was observed. Single colonies exhibiting hemolysis were selected and purified. Purified single colonies were picked using an inoculation loop and placed in Martin broth for enrichment, incubated at 37°C in a shaker for 12–24 hours. First, single colonies were picked for Wright's staining and microscopic examination. Wright's staining solution was purchased from Qingdao Haibo Biotechnology Co., Ltd. Next, the morphology and staining characteristics of the stained cells were observed, specifically as follows: Figure 1 As shown in the table. Subsequently, for the isolated bacteria with intense staining at both extremes, we extracted their genomic DNA and used the LktA gene of *Mannia* for PCR amplification and identification. Based on this, we further amplified and sequenced the 16S rRNA gene, using the upstream primer LktA-F (SED ID NO.1) with the sequence: GCAGGAGGTGATTATTAAAGTGG; the downstream primer LktA-R (SED ID NO.2) with the sequence: CAGCAGTTATTGTCATACCTGAAC; the upstream primer 16S-F (SED ID NO.3) with the sequence: AGAGTTTGATCCTGGCTCAG; and the downstream primer 16S-R (SED ID NO.4) with the sequence: AAGGAGGTGATCCAGCCGCA. The reaction system is shown in Table 1 below.

[0021] Table 1

[0022] 2×Taq Master PCR Mix 10 upstream primer 1 Downstream primer 1 DNA template 1 <![CDATA[ddH2O]]> 7 total 20

[0023] The reaction procedure was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 1 min, 56℃ annealing for 30 s, 72℃ extension for 90 s (30 cycles), and a final extension at 72℃ for 5 min. The PCR amplification products were examined using 1% agarose gel electrophoresis. The amplification results of the lktA gene are as follows: Figure 2As shown in the figure, the specific gene lktA of *Mannella* was successfully amplified from all isolated strains. Subsequently, the 16S rRNA gene sequences of these strains were further amplified, and the amplified products were sent to a biotechnology company for sequencing. Sequence alignment using NCBI BLAST confirmed that all isolates were hemolytic *Mannella*. Finally, the bacterial suspensions of the identified hemolytic *Mannella* strains were mixed with 50% glycerol at a 1:1 ratio and stored at -80°C for later use.

[0024] Example 2: Pathogenicity determination of hemolytic Mansonia solani isolates

[0025] The experimental animals were 18-22g female Kunming mice, purchased from the Enswell Laboratory Animal Center. All animal experimental procedures and feeding methods were carried out in accordance with the relevant requirements of the Southwest University Laboratory Animal Ethics Review Committee.

[0026] The isolates were streaked onto Martin plates and incubated at 37°C for 24 hours. Two to three colonies from each isolate were picked and incubated in 5 mL of Martin broth with shaking at 200 rpm for 12 hours. Colony counts were performed, and 2 × 10⁻⁶ colonies were collected from each plate. 8 CFU-containing bacteria were used to challenge Kunming mice via intraperitoneal infection. Mouse mortality was recorded, and the pathogenicity of each strain was analyzed. The results showed that strain Mh3-1 exhibited the strongest virulence among the isolated strains. Further determination of the LD50 of Mh3-1 was conducted. 50 The bacterial culture was concentrated and diluted to 1×10⁻⁶. 10 1×10 9 1×10 8 1×10 7 CFU / mL, each concentration constituted one group, with 8 mice in each group. Each experimental Kunming mouse was intraperitoneally inoculated with 100 μL of each concentration of bacterial suspension per mouse, while the control group received 100 μL of sterile PBS injected at the same site. The mice's mental status, time of death, and number of deaths were observed, and the LD50 was calculated using the modified Kohl's method. 50 The measured LD50 results 50 It is 6.04×10 7 CFU, see Table 2 below for details.

[0027] Table 2

[0028] A <![CDATA[1×10 9 CFU]]> 8 7 1 0.875 B <![CDATA[1×10 8 CFU]]> 8 7 1 0.875 C <![CDATA[1×10 7 CFU]]> 8 0 8 0 D <![CDATA[1×10 6 CFU]]> 8 0 8 0

[0029] Example 3: Biochemical assays, drug resistance, and drug resistance gene detection of each isolate.

[0030] Each strain of hemolytic Mansonia was streaked onto Martin plates and incubated at 37°C for 12 hours. Single colonies were picked and inoculated into microbiochemical tubes and incubated at 37°C for 24–36 hours. Biochemical results were observed and recorded. Results were determined according to the instructions of the bacterial biochemical tubes. The biochemical characteristics of isolates at different time points were compared. The results are shown in Table 3.

[0031] Table 3

[0032]

[0033] In Table 3, gray squares represent fermentation, and white squares represent no fermentation.

[0034] The drug susceptibility of various isolates of hemolytic Mansonia solani was determined using the disk diffusion method (KB method). Take 100 μL (1×10⁻⁶) of the solution. 8 Bacterial suspensions (CFU / mL) were spread onto Martin broth agar plates, with 5 plates per plate. Twenty-seven antibiotics were tested, and the plates were incubated at 37°C for 12 hours. The diameter of the inhibition zone was measured, and the drug susceptibility and resistance of each strain were determined according to NCCLS (National Committee for Clinical Laboratory Standards). The results showed that clinically isolated bacterial strains exhibited high susceptibility to cephalosporins and quinolones, but complete resistance to oxacillin, amikacin, and clindamycin. Significant differences in resistance characteristics were observed among the isolates. Some strains contained the blaTEM and sul2 genes. The aadA25 and aadB genes were detected only in Mh 3-11, and not in other isolates. The lnuA and ermC genes were not detected in any isolate. The test results are as follows: Figure 3 As shown in the figure. Mh represents Mannheimia haemolytica; red indicates sensitivity to the drug; yellow indicates an intermediate state; blue indicates resistance; gray indicates carrying the gene; and white indicates deletion of the gene.

[0035] Example 4 Selection of Mutagenic Strains

[0036] Bovine polymorphic Mansula mv2-12, bovine hemolytic Mansula mh3-1 (A6), Mh3-3 (A2 type), Mh3-12 (A6), and Mh1 (A1 type) stored at -80℃ were streaked onto TSA plates and incubated at 37℃ for 24 h. Two to three single colonies from each were picked and incubated in 5 mL of TSB medium at 37℃ for 12 h on a shaker. Genomic DNA was extracted from Mv2-12, Mh3-3, Mh3-12, and Mh1 for later use. Separately, an appropriate amount of nitrosoguanidine chemical mutagen granules was dissolved in sterile ddH2O and filtered through a 0.22 μm sterile filter. Inoculate 100 μL of Mh3-1 into 5 mL of TSB medium, along with genomic DNA and mutagens from Mv2-12, Mh3-3, Mh3-12, and Mh1. Incubate at 37°C with a shaker. Repeat this mixture for multiple passages. For the first five passages, use 100 μL of the mixture, adding DNA and 20 μL of mutagens for each passage. From the sixth passage onwards, add DNA and 50 μL of mutagens for passage until the tenth passage. From the eleventh passage onwards, passage without mutagens until the fifteenth passage. Dilute and plate the culture, observe colony morphology, pick colonies of different sizes into 5 mL of TSB medium, incubate at 37°C with a shaker, and perform SDS-PAGE electrophoresis to observe differences from Mh3-1. Verify the mutants with differential bands using Western blot. Use Mh3-1-immunized mouse serum as the primary antibody, combined with... Figure 4 The SDS-PAGE and Western blot results shown indicate that strains differing from Mh3-1 and Mh1 (MhA6-118, MhA6-155, MhA6-158, MhA6-159) were selected for further vaccine preparation and immunoprotective assays. Among these, Figure 4 The image on the left shows the SDS-PAGE electrophoresis result of the strain. Figure 4 The image on the right is a Western blot validation image of the strain.

[0037] Example 5: Screening of hemolytic Mansonia solani vaccine strains

[0038] The hemolytic Mansonia solani mutant strains MhA6-118, MhA6-155, MhA6-158, and MhA6-159 screened in Example 4 were cultured in TSB medium for 12 hours. Formaldehyde solution was then added to adjust the final concentration to 0.3%, and the mixture was thoroughly mixed. The mixture was placed in a 37°C incubator, shaken every 2 hours to ensure homogeneity, and allowed to stand for 24 hours for inactivation. Finally, it was mixed with 15VG adjuvant to prepare a vaccine with a final concentration of 2.5 × 10⁻⁶. 9An inactivated vaccine with a concentration of CFU / mL was prepared. Mice were immunized using the prepared inactivated vaccine. The immunization schedule was as follows: the back of the mouse was selected as the immunization site, and multiple injection sites were used for administration. A second immunization was administered 14 days after the first immunization. The dose for the first immunization was 0.2 mL per mouse, while the dose for the second immunization was reduced to 0.1 mL per mouse.

[0039] The mental state and absorption of mice were observed after immunization. Seven days after the second immunization, blood was collected from the tail vein to separate serum and detect antibody levels. Eight female Kunming mice were used in each group, with PBS used as the control group, followed by PBS (2.0 × 10⁻⁶). 8 Mice were challenged intraperitoneally with CFU-containing bovine hemolytic Mansoni strain A6, Mh3-1. The mice were observed for 7 consecutive days post-challenge, and their clinical symptoms were recorded. Mice nearing death were euthanized, and the mortality was recorded. Statistical results are as follows: Figure 5 As shown in Figure A, the results showed that the inactivated vaccines prepared from the mutant strains MhA6-118 and MhA6-155 had better immunoprotective effects than the other mutant strains.

[0040] To evaluate the immunoprotective efficacy of the vaccine, an intraperitoneal challenge experiment was conducted using bovine hemolytic Mansonia solani strain Mh1 (A1 type). The challenge dose was 2.4 × 10⁻⁶. 8 CFU / mouse. Mice were observed for 7 consecutive days after challenge, and their clinical symptoms were recorded. Mice nearing death were euthanized and recorded as deceased. Results showed that the inactivated vaccine prepared from MhA6-118 provided significantly better immunoprotective effects than the wild-type strain and several other mutant strains.

[0041] Mice were immunized again with the inactivated vaccine of the mutant strain MhA6-118. Subsequently, challenge protection tests were conducted using bovine hemolytic Manslaughter bacillus A6 strain Mh3-1, A1 strain Mh1, A2 strain Mh3-3, ovine hemolytic Manslaughter bacillus Mh3836, and bovine multi-source Manslaughter bacillus Mv2-12. All challenge tests used a 2.0 × 10⁻⁶ m²·g ... 8 The dosage of CFU / mouse was administered via intraperitoneal injection. Mice were closely monitored for 7 consecutive days after challenge, and clinical symptoms were recorded in detail. Mice nearing death were euthanized, and their mortality was recorded. The immunization dosage and protection results after challenge are shown in Table 4.

[0042] Table 4

[0043]

[0044] As shown in Table 4, the vaccine prepared from the inactivated hemolytic Manslaughter mutant strain mhA6-118 has strong cross-immunoprotective effect against multiple serotypes of hemolytic Manslaughter in cattle and sheep. Therefore, the mutant strain mhA6-118 can be used as a target strain for the research of broad-spectrum hemolytic Manslaughter vaccine.

Claims

1. The application of a bovine hemolytic Manslaughter mutant strain in the preparation of an inactivated vaccine for the prevention and control of infections caused by multiple serotypes of hemolytic Manslaughter, characterized in that: The bovine hemolytic Manslaughter bacillus mutant strain was named MhA6-118 and deposited at the China Center for Type Culture Collection (CCTCC) with accession number M20242493 on November 8, 2024. The vaccine contains an adjuvant and an antigen, wherein the antigen is a bovine hemolytic Mansonia solani mutant strain MhA6-118; The vaccine provides cross-immune protection against both homologous and heterologous Mansor bacteria infections. The cross-immune protection refers to cross-immune protection against infections caused by bovine hemolytic Mansonia solani strains A6, A1, and A2, sheep-derived hemolytic Mansonia solani strains, and bovine multi-source Mansonia solani strains.

2. The application according to claim 1, characterized in that, The inactivation treatment involved using a 0.3% formaldehyde solution and allowing it to stand at 37°C for 24 hours to inactivate the formaldehyde.

3. The application according to claim 2, characterized in that, The final concentration of antigen in the inactivated vaccine is 2.5 × 10⁻⁶. 9 CFU / mL.

Images