Salt-tolerant gene RaERF030 of mangrove and application of salt-tolerant gene RaERF030

Abstract

The invention discloses a positive mangrove salt-tolerant gene RaERF030 and application of the positive mangrove salt-tolerant gene RaERF030. The RaERF030 gene is obtained by being separated from halophyte positive mangrove, the nucleotide sequence of the RaERF030 gene is shown as SEQ ID NO.1, and the coded amino acid sequence of the RaERF030 gene is shown as SEQ ID NO.2. The invention further discloses a preparation method of the RaERF030 gene. The RaERF030 gene is transferred into arabidopsis thaliana by constructing a plant overexpression vector to obtain a transgenic arabidopsis thaliana strain, so that the seed germination rate of the transgenic arabidopsis thaliana under the salt stress condition can be improved, the inhibition of salt stress on the root growth of the transgenic arabidopsis thaliana and the membrane damage of the salt stress on the transgenic arabidopsis thaliana can be relieved, and the like. It is shown that the RaERF030 gene has the function of improving the salt tolerance of the plant and has important significance in revealing the molecular mechanism that the mangrove adapts to the high-salt habitat and cultivating salt-tolerant crops.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to a mangrove salt-tolerance gene RaERF030 and an application thereof. Background Art

[0002] Soil salt is a major environmental factor that affects plant growth and development. Salt stress inhibits the growth of plant tissues and organs by affecting plant physiological processes, such as photosynthesis, protein synthesis, and energy metabolism, and then inhibits the development of individual plants, causing plants to show physiological phenomena such as shortened growth and development period, early flowering, and premature aging (Yang Xiaohui et al., 2006). At the cellular level, salt stress mainly affects plant growth and development through osmotic stress, oxidative stress, ion toxicity, membrane disorder, inhibition of cell division and elongation, and interruption of key metabolic processes, leading to slow plant growth, reduced yield, and even death (Chen Yinhua, 2007; Rinse et al., 2013).

[0003] Under salt stress, plants will actively accumulate small molecules such as proline and betaine in their bodies, and the corresponding key genes encoding these small molecules become important salt-tolerant genes, such as the P5CS gene involved in encoding proline and the BADH gene involved in encoding betaine. The BADH gene of Avicennia marina was transferred into yeast cells, and the salt tolerance of recombinant yeast was improved (Li Fang, 2008). Yamada et al. found that the introduction of an enzyme gene homologous to tobacco allene oxygen cyclase (AOC) can improve the salt tolerance of sea lotus. The AOC homolog was named "mangrin", and its biosynthesis may be an effective means to improve the salt tolerance of mangrove plants (Yamada et al., 2002). The expression of OEE1 protein (oxygen evolving enhancer protein 1) in the rhizophoraceae plant Bruguiera gymnorrhiza was enhanced under 500mM NaCl stress (Sugihara et al., 2000). OEE1 protein is composed of OEE subunits and D1 protein. Increased OEE1 protein content may improve the photosynthetic efficiency of Bruguiera gymnorrhiza (Waditee et al., 2002).

[0004] Transcription factor (TF) is a specific protein that can receive upstream signals, regulate the expression of downstream target genes, and then regulate many life activities. Transcription factors play a vital role in the regulation of plant salt tolerance. Transcription factors related to salt stress include WRKY, MYB, NAC, bZIP, C2H2 and AP2 / ERF (Khan et al., 2018). The plant zinc finger protein WRKY family is directly involved in the plant salt stress response and alleviates the damage caused by high salt (Qi Yingxue, 2019). Overexpression of the GsWRKY15 gene can significantly enhance the alkali tolerance of alfalfa (Medicago sativa) (Zhu Pinghui et al., 2017); under salt stress, the tomato SlWRKY39 gene is significantly induced, which increases the proline content in the plant and improves the resistance of tomato (Solanum lycopersicum) plants to salt damage (Sun et al., 2015).

[0005] Rhizophora apiculata Bl. is a typical halophyte of the genus Rhizophora in the family Rhizophoraceae. Rhizophora apiculata is often distributed in the mid-tidal zone and has a strong adaptability to the variable habitats of the intertidal zone (Zheng Dezhang, 1995), often forming a single dominant community. The leaves of Rhizophora apiculata are leathery, with dark brown glandular dots on the back (Wang Wenqing, 2007). Lenticel drainage structures can be observed in the leaf anatomy (Li Yuanyue, 2006), and the tannin content of the epidermal cells of Rhizophora apiculata leaves is very high (Zhang Xiuzhi, 2008). Rhizophora apiculata is rich in antioxidant active substances (Gao et al., 2012), which may be related to its adaptation to high-salt habitats. Shijili et al. predicted 63 MATE proteins in Rhizophora apiculata. The concentration of MATE proteins in plants growing in salt environments is higher, and they may have multiple functions (Shijili et al., 2023). Lin Qifeng and others used the pollen tubes formed after self-pollination to introduce the total DNA of Mangrove into peppers, and the transformed offspring showed significantly stronger salt tolerance (Lin Qifeng, 1999). At present, the identification of Mangrove's salt tolerance genes is relatively backward compared with other plants, and its molecular mechanism of adapting to the halophytic environment has not yet been elucidated.

[0006] AP2 / ERF (APETALA2 / ethylene-responsive factor) is one of the largest transcription factor families in plants. It contains at least one AP2 domain, which is a conserved domain containing 60-70 amino acid residues. Its three-dimensional structure is composed of three antiparallel β folds and one amphipathic α helix (Nakano et al., 2006). The AP2 / ERF superfamily is divided into AP2, RAV, ERF and Soloist according to the number and similarity of AP2 domains. Most members of the AP2 family contain two AP2 domains repeated in series, members of the RAV family also contain a B3 domain, and members of the ERF family contain only one AP2 domain.

[0007] At present, a large number of studies have shown that AP2 / ERF transcription factors play an important role in plant salt stress response. JERF3 can regulate the abiotic stress response of plants by regulating oxidative stress response. Under abiotic stress, JERF3 activates the expression of oxidative and osmotic response-related genes such as osmotic responsive GCCbox, DRE and CE1 through transcription, thereby reducing the accumulation of ROS and enhancing the tolerance of tobacco to adverse conditions such as salt (Wu et al., 2008). Studies have shown that AP2 / ERF transcription factors participate in regulating plant growth and development, biotic and abiotic stress response processes through plant hormone signal transduction pathways such as salicylic acid, jasmonic acid, ethylene and abscisic acid (Zhang Jiyu et al., 2012). Wang Shaoxia et al. found that after DREB transcription factors are induced by adverse stress, they can activate up to 12 other stress resistance genes that depend on DRE cis-acting elements, causing an increase in proline and sucrose content, thereby enhancing the resistance of plants to various adversities (Wang Shaoxia et al., 2004). Mangroves are one of the main vegetation in saline-alkali wetlands and are an ideal system for studying the genetic background of stress tolerance. The halophyte mangrove can form a single-species dominant community in the high-salinity coastal intertidal environment, indicating that it has evolved a complete salt stress adaptation mechanism, but the identification of its salt-tolerance genes and the molecular mechanism of its adaptation to the halophytic environment remain to be elucidated.

[0008] The present invention uses the halophyte Rhizophora serrata as the research object, clones a key gene RaERF030 corresponding to salt stress, and finds through sequence analysis that the gene contains the AP2 conserved domain unique to ERF family members. The gene is overexpressed in wild-type Arabidopsis by Agrobacterium-mediated inflorescence infiltration method, and transgenic Arabidopsis strains are obtained through positive identification and screening. Salt stress treatment experiments found that RaERF030 overexpression confers salt stress tolerance to transgenic Arabidopsis seed germination, seedling root growth and seedling growth stages. At the same time, the salt stress treatment of soil-cultured Arabidopsis seedlings about one month old, the physiological and biochemical test results show that in the early stage of treatment, the MDA content of the transgenic strain is lower than that of the wild type and the POD enzyme activity is higher than that of the wild type, indicating that the transgenic seedlings have stronger tolerance to salt stress.

[0009] The present invention provides genetic resources and a theoretical basis for further exploring the function of the gene, the molecular adaptation mechanism of mangrove to high-salt environment, and cultivating new salt-tolerant plant varieties, thereby achieving sustainable development of the ecological environment and agricultural production. Summary of the invention

[0010] In view of this, one of the purposes of the present invention is to provide a salt-tolerance gene RaERF030 from Rhizophora mangrove, whose nucleotide sequence is shown in SEQ ID NO. 1, or its encoded amino acid sequence is shown in SEQ ID NO. 2. RaERF030 gene belongs to the AP2 / ERF gene family and contains AP2 conserved motif.

[0011] The second object of the present invention is to provide a recombinant expression vector, which is composed of the above-mentioned RaERF030 gene connected to a plant expression vector.

[0012] Preferably, the plant expression vector is pBinGlyRed.

[0013] The third object of the present invention is to provide a recombinant Agrobacterium cell containing the above RaERF030 gene or the above recombinant expression vector.

[0014] The fourth object of the present invention is to provide a transgenic Arabidopsis thaliana, which contains the above RaERF030 gene, or the above recombinant expression vector, or the T-DNA sequence of the above recombinant Agrobacterium. It can be obtained by the following method: using PCR cloning to obtain the full-length coding sequence of the gene, and obtaining the RaERF030-pBinGlyRed recombinant plant overexpression vector by homologous recombination; using the freeze-thaw method to transform the recombinant plasmid into Agrobacterium GV3101, and genetically transforming Arabidopsis thaliana by the pollen tube channel method; and obtaining a transgenic Arabidopsis thaliana strain (RaERF030-OE) overexpressing RaERF030 by red fluorescent protein marker screening and real-time quantitative PCR detection.

[0015] The fifth object of the present invention is to provide the use of the mangrove salt-tolerance gene RaERF030 in improving the salt tolerance of plants. The nucleotide sequence of the RaERF030 gene is shown in SEQ ID NO.1, or the amino acid sequence encoded by it is shown in SEQ ID NO.2.

[0016] Preferably, the plant is Arabidopsis thaliana.

[0017] Preferably, the improvement of plant salt tolerance is to improve seed germination and / or seedling root growth under salt stress and / or reduce plant cell membrane damage under salt stress. The seed germination rate and seedling root length of RaERF030 transgenic Arabidopsis thaliana under sodium chloride salt stress were significantly improved, and plant cell membrane damage was significantly reduced.

[0018] The present invention identified a new ERF family gene RaERF030 in the halophyte R. mangrove, and obtained the full-length coding sequence of the gene by PCR cloning. Through heterologous transformation of Arabidopsis thaliana, it was found that the gene can confer salt stress tolerance during seed germination, seedling root growth and seedling growth of transgenic Arabidopsis thaliana. It shows that by overexpressing the gene, salt-tolerant materials can be artificially created, which is of great significance for revealing the molecular mechanism of the mangrove plant R. mangrove to adapt to high-salt habitats and cultivating salt-tolerant crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a graph showing the agarose gel electrophoresis result of the RaERF030 gene cloning of the present invention;

[0020] Figure 2 This is the predicted map of the conserved domain of AP2 of the RaERF030 protein of the present invention;

[0021] Figure 3 This is a diagram for identifying positive strains of Arabidopsis thaliana after transformation according to the present invention;

[0022] Figure 4 This is a graph showing the expression level of the RaERF030 gene in the positive transgenic Arabidopsis thaliana of the present invention;

[0023] Figure 5 This is a diagram showing the germination phenotype and data statistics of RaERF030-OE seeds under salt stress conditions of the present invention;

[0024] Figure 6 This is a growth phenotype diagram of RaERF030-OE seedlings under salt stress conditions of the present invention;

[0025] Figure 7 This is a graph showing the results of measuring the physiological and biochemical indices of RaERF030-OE seedlings under salt stress conditions in the present invention. DETAILED DESCRIPTION

[0026] The present invention will be described in detail below in conjunction with examples. These examples are only illustrative and are not limited to the scope of application of the present invention. The present invention is not limited to the following embodiments or examples. Any modifications and variations that do not violate the spirit of the present invention should be included in the scope of the present invention. Unless otherwise specified, the experimental materials used in the following examples are commercially available; among them, the mangrove experimental materials were collected from the Dongzhaigang Mangrove Research Center in Haikou City, Hainan Province, China.

[0027] Example 1: Cloning and sequence analysis of RaERF030 gene

[0028] S1: Leaves, roots and other tissues of red mangroves were quickly frozen in liquid nitrogen for the extraction of total RNA. RNA was extracted using the Fuji Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (refer to the experimental instructions for the specific method).

[0029] Integrity and quality detection of total RNA of Rhizoma Mangroves: Take 1 μL of the extracted RNA solution and measure its light absorption values ​​at wavelengths of 260, 280 and 230 nm using a micro-ultraviolet nucleic acid protein detector to calculate the A260 / A280 ratio of the RNA solution; at the same time, take 3 μL of the RNA solution for agarose gel electrophoresis to detect the integrity of the RNA; if the A260 / A280 ratio of the RNA sample is between 1.8-2.0, and the agarose gel electrophoresis results show that the 28S rRNA band is clear and the brightness is about 1.5-2.0 times that of 18S rRNA, it indicates that the RNA quality is good and can be used for subsequent experiments.

[0030] The cDNA was synthesized using the RNA as a template. The cDNA chain was synthesized using the TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix Kit (Quanshijin, Beijing), and the operation process was carried out according to the instruction manual. The specific reaction system is shown in Table 1.

[0031] Table 1 cDNA synthesis reaction system

[0032]

[0033] The cDNA obtained above was diluted 5-fold with DNase-free ddH2O and used as a template for quantitative PCR.

[0034] S2: Using the genome sequence data of R. mangrovea, the local software Primer Premier 5.0 was used to design PCR primers for full-length cloning of the RaERF030 gene. The primer sequences are as follows:

[0035] F:5′cgggggactgaattcATGGAAAGAAGTCGGACAGATG 3′

[0036] R:5′cgcctcgagcccgggTTACAAAGCTCCAATTATTCTTGG 3′

[0037] The RaERF030 gene fragment was amplified using cDNA as a PCR template. The kit used in the process was 2×phata Maxmaster Mix (Nanjing Novozyme). The 50 μL PCR amplification reaction system was shown in Table 2 and the amplification program was shown in Table 3.

[0038] Table 2 RaERF030 gene PCR amplification system

[0039]

[0040] Table 3 RaERF030 gene PCR amplification program

[0041]

[0042]

[0043] The amplified product was detected by electrophoresis with 1.5% agarose gel and recovered. The agarose gel recovery was performed using EasyPure Quick Gel Extraction Kit DNA gel rapid purification kit, and the specific steps were carried out according to the instructions.

[0044] S3: Connect the above purified fragments to the T vector through TA cloning. Transform the recombinant T vector into E. coli competent DH5α by heat shock method, and obtain positive transformants through resistance screening and colony PCR identification. Obtain the recombinant plasmid in the positive transformant, and send the recombinant plasmid to Nanshan Bio for sequencing. The comparison results of the sequencing sequence prove that the full-length sequence of the RaERF030 gene coding region is obtained. The agarose gel electrophoresis results of the RaERF030 gene amplification are shown in Figure 1 .

[0045] S4: The sequencing results show that the coding region of the gene is 1161 bp in length (the nucleotide sequence is shown in SEQ ID NO.1), encoding 386 amino acids (the amino acid sequence is shown in SEQ ID NO.2). The amino acid sequence of the RaERF030 gene was submitted to the Conserved Domain Database (CDD) of the NCBI website to analyze the conserved motifs of the sequence. The results show that the regulatory factor contains the AP2 conserved domain unique to the ERF family ( Figure 2 ).

[0046] Example 2: Acquisition of RaERF030-OE overexpressing positive transgenic Arabidopsis

[0047] The plant overexpression vector pBinGlyRed and the positive recombinant T vector obtained in Example 1 were double-digested with restriction endonucleases XmaⅠ and EcoRⅠ, and the RaERF030 gene fragment obtained by gel recovery and the linearized overexpression vector were connected into the RaERF030-pBinGlyRed recombinant plasmid by homologous recombination. The recombinant plasmid was transformed into the competent Escherichia coli DH5α by the heat shock method, and the positive transformants were obtained by resistance screening and colony PCR identification. The recombinant expression vector in the positive transformant was obtained, and it was transformed into the competent cells of Agrobacterium GV3101 strain by the freeze-thaw method, and the positive transformant was obtained by resistance screening and PCR identification. The T-DNA sequence containing the target gene in the positive transformant was genetically transformed into the Arabidopsis Columbia ecotype (wild type, WT) by the flower dunking method, and the mature seeds were collected as T0 generation seeds. The red seeds were selected under the irradiation of green halogen lamps, which were positive transgenic seeds ( Figure 3 ), the plant expression vector used in the present invention contains a red fluorescent protein tag, and after transformation, the positive transgenic Arabidopsis thaliana will appear red under halogen or other irradiation.

[0048] Planting T1 generation, using Plant Tissue PCR Kit (Beijing Quanshijin) was used to perform PCR amplification and agarose gel electrophoresis using T1 leaves and target gene-specific primers, and the strains that could obtain the target gene were identified as positive transgenic strains. The results showed that the target gene had been successfully transferred into Arabidopsis, and T1 seeds were harvested for planting T2 and preservation.

[0049] Example 3: Application of RaERF030 gene in regulating plant salt tolerance

[0050] 1. Analysis of RaERF030 gene expression level in transgenic Arabidopsis

[0051] The transgenic Arabidopsis strain overexpressing the target gene was named RaERF030-OE-x, and a total of 15 independent transgenic strains were obtained, and 6 of them were randomly selected for real-time quantitative PCR experiments. The wild-type and transgenic strains were planted in an artificial climate chamber at the same time. When they grew to about 1 month old, leaves were collected from each plant and quickly frozen in liquid nitrogen for the extraction of total plant RNA. Three biological replicates were set for each strain.

[0052] Total RNA was extracted from the above materials, reverse transcribed to obtain cDNA, and diluted and then used for real-time quantitative PCR to detect the expression of RaERF030 in transgenic Arabidopsis. -ΔΔCt The gene primer sequences are as follows:

[0053] (1) Real-time quantitative PCR reference gene primer sequence:

[0054] Atactin-F:5′ATCACAACCTTCTACAACGAGC 3′

[0055] Atactin-R:5′CAGAGTCCAACACGATACCAG 3′

[0056] (2) Primer sequences for real-time quantitative PCR of RaERF030 gene:

[0057] RaERF030-F:5′GTTTGGGGGTCAACATCTTCAGT 3′

[0058] RaERF030-R:5′CCAGTGACAACAGGTCGCTT 3′

[0059] The results are as follows Figure 4 As shown, the expression levels of the target genes in the RaERF030-OE overexpression strains were significantly higher than those in the wild type, indicating that the present invention has obtained a transgenic Arabidopsis strain overexpressing the target gene RaERF030.

[0060] 2. Transgenic Arabidopsis thaliana RaERF030-OE strain has enhanced tolerance to salt stress during seed germination

[0061] Three transgenic lines with higher expression levels, RaERF030-OE-9 / 21 / 26, were selected for further planting to obtain T2 generation positive transgenic seeds. After surface disinfection with 75% alcohol and then rinsed with sterile water, vernalization was performed at 2-4°C for 2-4 days, and then sown in 1 / 2MS medium containing 0mM, 100mM and 200mM NaCl, 30 seeds per line per treatment, with the wild type as the control, and 3 biological replicates. The sown culture dishes were placed in an artificial climate incubator for culture, and the seed germination rate was counted every day from 0 to 11 days after sowing, and photographed and recorded on the 11th day (such as Figure 5 Seed germination phenotype shown in A). Seed germination rate statistics are shown in Figure 5As shown in Figure B, on the 1 / 2MS medium without NaCl, there was no significant difference in the germination rate between the wild type and the transgenic lines; on the 1 / 2MS medium containing NaCl, the germination rate of the transgenic lines was significantly higher than that of the wild type. Among them, on the 1 / 2MS medium containing 100mM NaCl, the germination rate of the three transgenic lines was significantly ahead of the wild type in the early stage of sowing, and the gap in germination rate narrowed to a certain extent in the later stage, but the germination rate of the transgenic lines was still significantly higher than that of the wild type; under the treatment of 200mM NaCl, the germination rate of the transgenic lines was significantly higher than that of the wild type. In summary, the RaERF030 gene improves the salt tolerance of plants, increases the germination rate of plants under salt stress, and the higher the salt stress concentration, the more obvious it is.

[0062] 3. Transgenic Arabidopsis thaliana RaERF030-OE seedlings have enhanced tolerance to salt stress

[0063] Positive and plump RaERF030-OE-9 / 21 / 26 seeds were selected, surface disinfected and vernalized as above, and then sown on 1 / 2MS solid medium containing 100mM NaCl. They were cultured vertically in an artificial climate incubator, and the plate sown with 1 / 2MS medium containing 0mM NaCl was used as a control. The photos were taken on the 14th day of culture. Figure 6 (CK is the control group and WT is the wild-type Arabidopsis) As shown in the figure, under normal conditions, there is no significant difference in root growth between wild-type and transgenic seedlings, but under salt stress conditions, the roots of transgenic seedlings are significantly longer than those of wild-type, among which RaERF030-9 / 26 seedlings have the best root length effect. In summary, the overexpression of the target gene weakens the inhibitory effect of salt stress on the root growth of transgenic Arabidopsis, thereby enhancing the salt tolerance of transgenic Arabidopsis seedlings.

[0064] One-month-old Arabidopsis seedlings grown in soil were treated with an aqueous solution containing 200 mM NaCl. Leaves were taken at 0, 1, and 8 days after treatment to determine the malondialdehyde (MDA) content and peroxidase (POD) activity. MDA was determined using the thiobarbituric acid method (Wang Aiguo, 1986), and POD enzyme activity was determined using a kit method (Suzhou Keming Biotechnology Co., Ltd., China). The specific operation method was carried out according to the instructions. The results are shown in the figure. Figure 7(where A is the MDA content determination graph, and B is the POD enzyme activity determination graph), indicating that there were no significant differences in POD activity and MDA content between the transgenic strain and the wild type at the early stage of treatment (0d). After 1d of treatment, the POD activity of the transgenic strain was significantly higher than that of the wild type, while the MDA content was basically the same. After 8d of treatment, the MDA content of the transgenic strain was significantly lower than that of the wild type, indicating that the introduction of the target gene increased the protective enzyme activity of the transgenic strain and reduced the degree of cell membrane damage, thereby enhancing the damage of salt stress to the transgenic strain, that is, the salt tolerance of the RaERF030-OE strain was stronger than that of the wild type.

[0065] The conventional techniques and schemes not described in detail in the above embodiments are well known in the art, so they will not be described in detail here. The above embodiments and / or experimental examples describe the preferred embodiments of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, the technical scheme of the present invention can be subjected to a variety of simple modifications, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. A mangrove salt tolerance gene RaERF030, characterized in that: The nucleotide sequence thereof is shown as SEQ ID NO.1, or the amino acid sequence encoded by the nucleotide sequence thereof is shown as SEQ ID NO.

2.

2. A recombinant expression vector, characterized in that: The salt-tolerant gene RaERF030 according to claim 1 is connected to a plant expression vector.

3. A recombinant Agrobacterium cell, characterized in that It contains the gene according to claim 1 or the recombinant expression vector according to claim 2.

4. A transgenic Arabidopsis thaliana, characterized in that: It contains the gene according to claim 1, or the recombinant expression vector according to claim 2, or the T-DNA sequence of the recombinant Agrobacterium according to claim 3.

5. Application of the salt-tolerance gene RaERF030 of mangrove in improving the salt tolerance of plants, characterized in that: The nucleotide sequence of the RaERF030 gene is shown as SEQ ID NO.1, or the amino acid sequence encoded by the gene is shown as SEQ ID NO.

2.

6. The use according to claim 5, characterized in that The plant is Arabidopsis thaliana.

7. The use according to claim 6, characterized in that The improving of plant salt tolerance is to improve seed germination and / or seedling root growth under salt stress and / or reduce plant cell membrane damage under salt stress.

Images