A uorf element upstream of rice osgif1 or dep1 gene and use thereof

Abstract

The application provides a uORF element upstream of a rice OsGIF1 or DEP1 gene and use, the nucleotide sequence of the uORF element for regulating the expression of the rice OsGIF1 or DEP1 gene is shown as any one or more of SEQ ID NO.1-4, wherein OsGIF1-uORF1 and OsGIF1-uORF2 can be used as expression regulation elements of the OsGIF1 gene, the nucleotide sequences are shown as SEQ ID NO.1 and 2; DEP1-uORF1 and DEP1-uORF2 can be used as expression regulation elements of the DEP1 gene, the nucleotide sequences are shown as SEQ ID NO.3 and 4.The uORF regulation element of the application can be used for regulating the protein expression level of the rice OsGIF1 or DEP1 gene, and improving the growth and development of plants, and the uORF regulation element is applied to genetic improvement of rice varieties, and has important breeding value.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and in particular relates to a uORF element upstream of the rice OsGIF1 or DEP1 gene and its uses. Background Technology

[0002] Rice is the staple food for more than half the world's population. However, with arable land dwindling, increasing crop yields to feed a growing population is becoming increasingly challenging. The structure of the rice plant, including the morphology of tillers, stems, panicles, and leaves, are all important agronomic traits closely related to rice yield.

[0003] DEP1 encodes an atypical Gγ subunit and is a major QTL for panicle structure, grain shape, and nitrogen use efficiency. Transgenic rice overexpressing DEP1 showed an increase in grain length of 6.85–9.58% under normal plant conditions. Leaf curling and leaf size are considered key agronomic traits in plant morphology and can subsidize yield parameters. GRF interactor (GIF) genes control cell proliferation during leaf development and are positive regulators of leaf proliferation, thereby improving panicle and grain traits.

[0004] Currently, crop breeding research prioritizes changes in coding region sequences and gene transcription levels. However, the untranslated region (UTR) of the plant genome has factors that influence the efficiency or stability of mRNA gene translation. The upstream open reading frame (uORF) is a major regulatory element of the 5′ untranslated region (5′UTR), regulating gene expression at the posttranscriptional or translational level, and may interfere with the translation of the downstream primary ORF (pORF). Existing studies have demonstrated that uORF-based gene expression regulation plays an important role in plant metabolism, disease resistance, development, and nutrient uptake. However, research on finely upregulating the expression of endogenous genes in rice at the translational level based on uORF elements, thereby using gene editing to achieve transgenic-free improvement of plant traits, is still relatively limited.

[0005] Therefore, the discovery of uORF elements of important agronomic traits in rice is of great significance for elucidating the characteristics and molecular mechanisms of uORF in rice and its application in breeding. Summary of the Invention

[0006] Purpose of the invention: In order to solve the above-mentioned technical problems, the present invention aims to provide a uORF element for regulating the expression of rice OsGIF1 or DEP1 genes, which solves the problem of improving rice traits by upregulating gene expression without transgenic traces.

[0007] The present invention also provides the use of uORF elements upstream of the rice OsGIF1 or DEP1 gene.

[0008] Technical solution: In order to achieve the above objectives, the uORF element nucleotide sequence for regulating the expression of rice OsGIF1 or DEP1 genes described in this invention is as shown in any one or more of SEQ ID NO.1-4.

[0009] Furthermore, the nucleotide sequence of the uORF element regulating the expression of the rice OsGIF1 gene is shown in SEQ ID NO. 1 and / or 2, and the nucleotide sequence of the uORF element regulating the expression of the rice DEP1 gene is shown in SEQ ID NO. 3 or SEQ ID NO. 3 and 4.

[0010]

[0011] The present invention relates to a recombinant expression vector of uORF elements that regulate the expression of rice OsGIF1 or DEP1 genes.

[0012] Furthermore, the method for constructing the recombinant expression vector is as follows: a target site for editing is designed near the uORF element, the target site is designed as a reverse complementary primer and ligated to the intermediate vector SK-gRNA, the ligated enzyme digestion product is ligated to the final vector pC1300-Cas9, and the recombinant expression vector is obtained by Agrobacterium transformation.

[0013] The application of the uORF element for regulating the expression of rice OsGIF1 or DEP1 genes as described in this invention in regulating rice agronomic traits.

[0014] Furthermore, by editing the uORF element to regulate the protein expression levels of the rice OsGIF1 and / or DEP1 genes, plant growth and development were improved.

[0015] Furthermore, the gene editing includes mutants, alleles, or derivatives created by adding, substituting, inserting, or deleting one or more nucleotides.

[0016] Furthermore, by editing uORF elements to induce base mutations, the expression levels of rice OsGIF1 and / or DEP1 genes were upregulated, promoting plant growth and development.

[0017] The present invention discloses a method for regulating the growth and development of rice plants by editing the uORF element sequence to change the expression of the OsGIF1 or DEP1 gene, thereby regulating the growth and development of rice plants.

[0018] This invention relates to the application of uORF elements for regulating the expression of rice OsGIF1 or DEP1 genes in the breeding of high-yield rice germplasm.

[0019] Furthermore, the method of application is as follows: the uORF element of the rice OsGIF1 and / or DEP1 gene is edited to change the expression level of the OsGIF1 or DEP1 gene in the target rice variety.

[0020] Furthermore, the gene editing includes, but is not limited to, mutants, alleles, or derivatives generated by adding, substituting, inserting, or deleting one or more nucleotides, thereby altering the expression level of the OsGIF1 or DEP1 gene in the target rice variety, and thus obtaining rice plants with different developmental morphologies.

[0021] Gene editing technologies, represented by CRISPR / Cas9, are currently popular site-specific genome editing techniques. In rice, they have been proven to be highly efficient and convenient for targeted editing of specific sites. More importantly, the target sites and T-DNA insertion sites are generally located on different chromosomes. Therefore, in Agrobacterium-mediated transformation of transgenic rice plants, transgenic traces can be removed through progeny selection, thus enabling its application in production practices.

[0022] In this invention, OsGIF1 positively regulates the morphology and size of rice grains, leaves, and stems; upregulating its expression level has a beneficial effect on increasing yield. Different allelic variants of the DEP1 gene have different effects; upregulating its expression level can increase grain length, potentially increasing yield per plant. Conventional overexpression transgenic technology can upregulate gene expression, but due to the presence of transgenic traces, it is currently difficult to use in production practice. Therefore, using CRISPR / Cas9 gene editing technology to edit uORF elements and upregulate the expression of important agronomical trait genes such as OsGIF1 and DEP1 is an important method for rice variety improvement.

[0023] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0024] This invention is the first to discover that uORF elements can regulate the expression of OsGIF1 and DEP1 genes, improving important agronomic traits in rice. By editing uORF elements to induce base mutations, the expression levels of OsGIF1 or DEP1 genes in rice are upregulated, promoting plant growth and development. Furthermore, transgenic traces can be removed through simple offspring segregation. This invention broadens the application scope of OsGIF1 and DEP1 genes, providing useful gene resources for rice variety improvement and demonstrating significant breeding application value. Attached Figure Description

[0025] Figure 1 It is the wild-type sequence and mutant sequence of the uORF element upstream of the OsGIF1 gene in Example 1 of this invention;

[0026] Figure 2This describes the effect of mutations in the upstream uorf element of the OsGIF1 gene on gene expression levels in Example 1 of this invention.

[0027] Figure 3 This describes the effect of upstream uorf element mutation of the OsGIF1 gene on agronomic traits of rice in Example 1 of this invention.

[0028] Figure 4 It is the wild-type sequence and mutant sequence of the uORF element upstream of the DEP1 gene in Example 2 of this invention;

[0029] Figure 5 This describes the effect of upstream uorf element mutation of the DEP1 gene on gene expression levels in Example 2 of this invention.

[0030] Figure 6 This describes the effect of upstream uorf element mutation of the DEP1 gene on agronomic traits of rice in Example 2 of this invention. Detailed Implementation

[0031] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0032] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer.

[0033] Young spikelets and grains during the high expression stages of the OsGIF1 and DEP1 genes were preserved and provided by Yangzhou University.

[0034] For details on the construction of the pC1300-Cas9 recombinant vector and the intermediate vector SK-gRNA, please refer to patent CN105112435A, Construction and Application of Plant Multi-Gene Knockout Vectors.

[0035] Example 1

[0036] Discovery, identification and effect analysis of uORF elements upstream of the OsGIF1 gene in rice

[0037] 1. uORF component discovery and identification

[0038] Nihonbare is a japonica rice variety that has completed whole-genome sequencing. It is an important variety for rice breeding research. It was introduced to China by the Chinese Academy of Agricultural Sciences in 1967 and is a variety that can be obtained completely from the public. Using Nipponbare rice stored in the applicant's laboratory for a long period as the subject, young spikelets (5 cm and 10 cm in length) during the OsGIF1 gene high expression period (He et al., 2017, OsGIF1 positively regulates the sizes of stems, leaves, and grains in rice, Frontier in Plant Science), grains at key grain development stages (10, 15, and 20 days after flowering), and leaves during the vegetative growth stage were used as experimental materials. Ribo-seq and RNA-seq analyses were performed, and combined with bioinformatics methods, the main uORF elements of the OsGIF1 gene (LOC Os03g52320) were identified. The results showed two uORF elements in the upstream untranslated region of the OsGIF1 gene, and the nucleotide sequences of these uORF elements are shown in SEQ ID NO. 1 and 2, respectively. Figure 1 , OsGIF1-uORF1, OsGIF1-uORF2).

[0039] 2. Creation and identification of rice materials containing mutant UORF elements

[0040] Based on existing CRISPR / Cas9-related experimental methods, two sequences containing NGG as PAM sites were selected on the uORF element of the OsGIF1 gene as knockout target sites. One specific target site sequence is 5'-GGTCCTCAGTTTGAGATGAT-3', and the other specific target site sequence is 5'-TATATTCATGCATATGTCAT-3'. The target sites were designed as reverse complementary primers and ligated into the intermediate vector SK-gRNA digested with Aar I. The intermediate vector containing the target sites was then ligated with Kpn I and Bgl II. The gRNA fragment containing the target sites was recovered and ligated into the final vector pC1300-Cas9 digested with Kpn I and BamHI to obtain the recombinant vector. The sequenced recombinant vector was then transformed into Agrobacterium strains. Using Nipponbare as the transformation recipient, the recombinant vector was transferred into rice using Agrobacterium-mediated genetic transformation. Positive transgenic seedlings were obtained through tissue culture, and after detection and identification, they were transplanted to the field to obtain T0 generation rice plants, which are plants containing mutant uorf elements (including plants containing mutant uorf1 and / or uorf2 elements, including OsGIF1-uORF1, OsGIF1-uORF2, and OsGIF1-uORF1&2).

[0041] The control variety wild-type Nipponbare containing the uORF element and the plant containing the mutant uORF element prepared in this invention showed only sequence differences near the uORF element. Genomic DNA was rapidly extracted from rice leaves at the tillering stage using the CTAB method. Then, a pair of PCR sequencing primers (detection primers: OsGIF1-uORF-F: TTCCACCTTCCCATTGTT; OsGIF1-uORF-R: GGTCTGCTTGG CCTATTC) were designed upstream and downstream of the uORF element editing target site sequence to detect sequence variations near the target site. After PCR amplification and sequencing analysis based on the target site sequence, the sequence of the mutant uORF element was obtained. Compared to the wild-type uORF element, the mutant uORF element had multiple base deletions, indicating that the uORF element characteristics were completely destroyed. Figure 1 (GIF1-uORF1 and / or 2).

[0042] 3. Effects of upstream uorf element mutations in the OsGIF1 gene on gene expression levels in rice.

[0043] Young spikes (approximately 5 cm in length) of wild-type Nipponbare (control variety containing uORF element) and plants containing mutant uorf element prepared according to this invention were taken. The samples were ground and the cells were broken in liquid nitrogen, and total RNA was extracted. cDNA was obtained using a reverse transcription kit. Then, the mRNA expression level of OsGIF1 gene in the control variety Nipponbare and plants containing mutant uorf element was detected according to the SYBR Green real-time PCR method (detection primers: qRT-OsGIF1-F: TATGCTTCCCCTACCACCGTC, qRT-OsGIF1-R: TCTTCCACCTTCCCATTGTTCTG). Furthermore, the effect of uORF on regulating the expression of downstream target gene proteins was detected in tobacco leaves using a dual-luciferase in vitro transient expression system. Sequences of unmutated uORF elements (wild-type, containing uORF1 and uORF2, SEQ ID NO. 1 and 2), elements containing mutant uorf1 (artificially synthesized with the start codon ATG of wild-type uORF1 mutated to AAA), and elements containing mutant uorf2 (artificially synthesized with the start codon ATG of wild-type uORF2 mutated to AAA) were respectively ligated into the expression vector pGreenII0800-LUC containing a dual-luciferase reporter gene. The ligated uORF or uorf elements were located upstream of the firefly luciferase reporter gene (reference method: Xing et al., 2020, Fine-tuning sugar content in strawberry. Genome Biology), obtaining recombinant vectors. The recombinant vectors, after being sequenced correctly, were transformed into Agrobacterium strains. Then, *Agrobacterium tumefaciens* containing the recombinant vector was used to infect tobacco leaves. After 48 hours of culture, tobacco leaves from the infected areas were collected for luciferase activity detection (reference method: Xiong et al., 2022, Brassinosteroids regulate rice seed germination through the BZR1-RAmy3D transcriptional module. Plant Physiology). The results showed that, as Figure 2 As shown, there was no difference in the mRNA expression level of the OsGIF1 gene in plants containing mutant uorf elements. However, the fluorescence signal of the downstream reporter gene was enhanced in plants containing mutant uorf elements (LUC / REN activity), that is, the protein expression level increased. This is consistent with the typical characteristic of uORF elements that can regulate the protein expression of their downstream target genes without affecting mRNA expression.

[0044] 4. Determination of agronomic traits in rice containing mutant UORF elements

[0045] To clarify the biological function of the uORF element, the field agronomic traits of plants containing the mutant uORF element were investigated. Planted in a field environment under conventional cultivation and management conditions, at rice maturity, compared with the control variety Nipponbare, as follows: Figure 3 As shown, plants containing mutant uorf1 or uorf2 elements exhibit changes in grain length, grain width, and grain weight, promoting rice growth. Simultaneously, plants containing mutant uorf1 and uorf2 elements show altered growth and development, manifested as significant increases in seedling vigor, plant height, panicle length, effective tiller number, and apparent amylose content, further promoting rice growth. The overall trend is similar to the reported effects of OsGIF1 gene coding region sequence variations on grain shape (He et al., 2017, OsGIF1 positively regulates the sizes of stems, leaves, and grains in rice, Frontier in Plant Science). Therefore, the uORF element in this invention, as a regulatory element, can slightly upregulate the expression of endogenous genes at the translational level, enabling precise improvement of rice traits. This demonstrates that the uORF element discovered in this invention does indeed affect plant growth, particularly promoting it, by regulating OsGIF1 gene expression.

[0046] Example 2

[0047] Discovery, identification and effect analysis of uORF elements in the DEP1 gene of rice

[0048] 1. uORF component discovery and identification

[0049] Using Nipponbare rice varieties preserved in our laboratory, we collected young spikelets (5 cm and 10 cm in length) at the high expression stage of the DEP1 gene (Huang et al., 2009, Natural variation at the DEP1 locus enhances grain yield in rice, Nature Genetics), grains at key stages of grain development (10, 15, and 20 days after flowering), and control leaves as experimental materials. We performed ribosome imprinting sequencing (Ribo-seq) and transcriptome sequencing (RNA-seq) analyses. Combining bioinformatics methods, we identified the main uORF elements of the DEP1 gene (LOC_Os09g26999). We found two uORF elements in the upstream untranslated region of the DEP1 gene. The nucleotide sequences of these uORF elements are shown in SEQ ID NO. 3 and 4. Figure 4 (DEP1-uORF1, DEP1-uORF2)

[0050] 2. Creation and identification of rice materials containing mutant UORF elements

[0051] Based on existing CRISPR / Cas9-related experimental methods, two sequences containing NGG as PAM sites were selected on the uORF of the DEP1 gene as knockout target sites. The first specific target site sequence was 5'-TCACGCTCGCTGCTATATGG-3', and the other specific target site sequence was 5'-CCCTCGCCGCCTTCACTCAT-3'. The target sites were designed as reverse complementary primers and ligated into the intermediate vector SK-gRNA digested with Aar I. The intermediate vector was digested with Kpn I and Bgl II, and the gRNA fragment containing the target sites was recovered and ligated into the final vector pC1300-Cas9 digested with Kpn I and BamHI to obtain the recombinant vector. After sequencing confirmed to be correct, the vector was transformed into Agrobacterium strains. Using Nipponbare as the transformation recipient, recombinant vectors were transferred into rice using Agrobacterium-mediated genetic transformation. Positive transgenic seedlings were obtained through tissue culture, and after detection and identification, they were transplanted to the field to obtain T0 generation rice plants, which are plants containing mutant uORF elements (including DEP1-uORF1, DEP1-uORF2, and DEP1-uORF1&2).

[0052] The control variety Nipponbare, containing the wild-type uORF element, and plants containing the mutant uORF element showed sequence differences only near the uORF element. Genomic DNA was rapidly extracted from rice leaves at the tillering stage using the CTAB method. A pair of PCR sequencing primers (detection primers: DEP1-uORF-F: GAACAAAGCCCACAGACACAA, DEP1-uORF-R: ACTTGCTTCGTCTTCCTTTGAC) were designed upstream and downstream of the uORF element editing target site sequence to detect sequence variations near the target site. PCR amplification and sequencing analysis based on the target site sequence yielded the sequence of the mutant uORF element. Compared to the wild-type uORF, the mutant uORF exhibited multiple base deletions, and the uORF element characteristics were completely destroyed. Figure 4 DEP1-uORF1 and / or 2).

[0053] 3. Effects of upstream uorf element mutations in the DEP1 gene on gene expression levels in rice.

[0054] Young spikelets (approximately 5 cm in length) from the control variety Nipponbare containing the wild-type uORF element and plants containing the mutant uORF element were collected. The samples were ground and cells were lysed in liquid nitrogen, and total RNA was extracted. cDNA was obtained using a reverse transcription kit. The mRNA expression level of the DEP1 gene in the control variety Nipponbare and plants containing the mutant uORF element was then detected using SYBR Green quantitative PCR (detection primers: qRT-DEP1-F: CTCAGCCCCGTTTCTCGTTCT, qRT-DEP1-R: AGCACAGCAGTTCGGTTTG). Similarly, the young spikelet samples were ground and cells were lysed in liquid nitrogen, and total protein was extracted. The protein expression level of the OsGIF1 gene in the control variety Nipponbare and plants containing the mutant uORF element was then detected using Western blotting. The results showed that, as Figure 5 As shown, there was no difference in the expression of DEP1 gene mRNA in plants containing mutant uorf elements, but the protein expression level of DEP1 gene was increased in plants containing mutant uorf1 elements, which is consistent with the typical characteristic of uORF elements that can regulate the protein expression of their downstream target genes without affecting mRNA expression.

[0055] 4. Determination of agronomic traits in rice containing mutant UORF elements

[0056] To clarify the biological function of the uORF element, the field agronomic traits of plants containing the mutant uORF element were investigated. Planted in a field environment under conventional cultivation and management conditions, at rice maturity, compared with the control variety Nipponbare, as follows: Figure 6As shown, plants containing the mutant uorf1 or uorf2 element showed no changes in grain width, panicle length, effective tiller number, grains perpanicle, or seed setting rate. Only plants containing only the mutant uorf1 element or both mutant uorf1 and uorf2 elements showed a significant increase in grain length and grain weight, promoting rice growth. Plants containing only the mutant uorf2 element showed no change in grain length or grain weight. The trend of the mutant uorf1 or uorf2 element affecting plant traits is consistent with its trend in regulating DEP1 gene expression. The plant trait changes caused by the mutant DEP1-uorf1 are similar to the reported effects of DEP1 gene coding region sequence variations on grain shape (Huang et al., 2009, Natural variation at the DEP1 locus enhances grain yield in rice, Nature Genetics). Therefore, the uORF in this invention, as a regulatory element, can slightly upregulate the expression of endogenous genes at the translational level, which can be used to finely improve rice traits. This demonstrates that the uORF element discovered in this invention does indeed improve grain shape and increase grain weight by regulating the expression of the DEP1 gene, thereby promoting rice growth.

Claims

1. An application of knocking out the uORF element shown in SEQ ID NO. 3 to promote increased grain length and weight in rice.

2. An application of simultaneously knocking out the uORF element shown in SEQ ID NO. 3 and 4 to promote increased grain length and weight in rice.

Images