Use of cisd2 gene as a target in regulating replication of picornaviruses and / or vaccine production
Patent Information
- Application Number
- CN202510190006.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-20
- Publication Date
- 2026-09-15
- Estimated Expiration
- 2045-02-20
AI Technical Summary
已有研究表明,CISD2在衰老、神经退行性疾病、骨骼肌和神经元变性及癌症等多种生理和病理过程中发挥作用,但对于其与小RNA病毒的复制有何种关系未见报道
[0025]This invention provides the application of CISD2 protein or CISD2 gene as a target in the preparation of products regulating the replication of Picornaviridae viruses and/or in vaccine production. Overexpression of CISD2 in host cells inhibits the replication of Picornaviridae viruses, while inhibiting CISD2 gene expression in host cells promotes their replication. This invention provides a CISD2-specific sgRNA that can specifically target the CISD2 gene, achieving accurate targeting and high knockout efficiency. Cell lines obtaining the CISD2 gene-encoded protein with lost function can be further used as production cell lines for Picornaviridae viruses and their vaccines, significantly promoting viral replication, increasing viral titer and antigen yield, and contributing to the preparation of highly effective vaccines, demonstrating broad application prospects.
Smart Images

Figure CN120026026B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to the application of the CISD2 gene as a target in regulating small RNA virus replication and / or vaccine production. Background Technology
[0002] The Picornaviridae family is a large family of viruses composed of various positive-sense RNA viruses with a wide host range, significantly impacting human health and agricultural production. Foot-and-mouth disease virus (FMDV), belonging to the genus FMDV within the Picornaviridae family, is the pathogen causing foot-and-mouth disease (FMD), severely affecting cloven-hoofed animals such as pigs, cattle, and sheep. FMDV has 17 serotypes: O, A, C, SAT1, SAT2, SAT3, and Asia, with no cross-immunity between serotypes. Senecavirus A (SVA) is the only member of the genus Senecavirus within the Picornaviridae family. It causes vesicular lesions on the snout and coronal band of the hooves in pigs, making it clinically difficult to distinguish from foot-and-mouth disease and swine vesicular disease. Developing highly effective vaccines is currently the most effective measure to control the above-mentioned diseases. Screening cell lines that can efficiently reproduce viruses can help prepare highly effective vaccines. Therefore, there is an urgent need to provide a cell line that can efficiently reproduce small RNA viruses.
[0003] Gene editing technology is a technique that uses molecular biology methods to target and precisely mutate, modify, or edit genes in various cells. It has continuously developed and matured, evolving from the first generation of zinc finger nuclease (ZFN)-based editing technology, to the second generation of transcription activator-like effector nuclease (TALEN)-based editing technology, and finally to the third generation of CRISPR / Cas9-based editing technology, which utilizes clustered, regularly spaced short palindromic repeats. Over nearly 30 years of development, it has achieved groundbreaking progress. CRISPR / Cas9 is a targeted genome editing technology that uses small molecule sgRNA to edit target genes. Compared to the previous two generations of editing technologies, this technology is more convenient, efficient, precise, and stable, and its associated costs are much lower. It has brought about a revolutionary breakthrough in the targeted modification, regulation, and application of genomes, and is widely used in various fields of medicine and life sciences.
[0004] CDGSH iron-sulfur domain 2 (CISD2) is a member of the CDGSH iron-sulfur domain protein family. It is located on the endoplasmic reticulum, outer mitochondrial membrane, and mitochondrial-associated membrane, and participates in regulating mitochondrial function, cellular metabolism, and redox homeostasis. Previous studies have shown that CISD2 plays a role in various physiological and pathological processes, including aging, neurodegenerative diseases, skeletal muscle and neuronal degeneration, and cancer. However, its relationship with small RNA virus replication has not been reported. Summary of the Invention
[0005] In view of this, the purpose of this invention is to provide the application of CISD2 protein or CISD2 gene as a target in the preparation of products and / or vaccine production that regulate the replication of microRNAviridae viruses. Upregulating the expression level of CISD2 gene can inhibit the replication of microRNAviridae viruses, while reducing the expression level of CISD2 gene can promote the replication of microRNAviridae viruses. Furthermore, by using sgRNA to knock out the CISD2 gene to prepare cell lines with lost gene-encoded protein function, these cell lines can be used for the production of microRNAviridae viruses and their vaccines, promoting the replication of microRNAviridae viruses and increasing viral titer and antigen yield.
[0006] This invention provides the application of CISD2 protein or CISD2 gene as a target in the preparation of products that regulate the replication of microRNAviridae viruses and / or in vaccine production.
[0007] Preferably, the microRNAviridae virus includes foot-and-mouth disease virus and / or Seneca virus.
[0008] Preferably, the regulatory effect is exerted by upregulating or downregulating the expression level of the CISD2 gene; upregulating the expression level of the CISD2 gene can inhibit the replication of microRNAviridae viruses, while downregulating the expression level of the CISD2 gene can promote the replication of microRNAviridae viruses.
[0009] Preferably, the method of reducing the expression level of the CISD2 gene includes interfering with the expression of the CISD2 gene or knocking out the CISD2 gene.
[0010] Preferably, the sgRNA that knocks out the CISD2 gene includes CISD2-sgRNA1 and / or CISD2-sgRNA2; the target sequence of CISD2-sgRNA1 is shown in SEQ ID NO.1; and the target sequence of CISD2-sgRNA2 is shown in SEQ ID NO.2.
[0011] This invention provides an sgRNA for knocking out the CISD2 gene, wherein the sgRNA includes CISD2-sgRNA1 and / or CISD2-sgRNA2;
[0012] The target sequence of CISD2-sgRNA1 is shown in SEQ ID NO.1;
[0013] The target sequence of CISD2-sgRNA2 is shown in SEQ ID NO.2.
[0014] Preferably, CISD2-sgRNA1 is a double-stranded fragment formed by annealing CISD2-sgRNA1-F and CISD2-sgRNA1-R; CISD2-sgRNA2 is a double-stranded fragment formed by annealing CISD2-sgRNA2-F and CISD2-sgRNA2-R.
[0015] The gene sequence of CISD2-sgRNA1-F is shown in SEQ ID NO.3;
[0016] The gene sequence of CISD2-sgRNA1-R is shown in SEQ ID NO.4;
[0017] The gene sequence of CISD2-sgRNA2-F is shown in SEQ ID NO.5;
[0018] The gene sequence of CISD2-sgRNA2-R is shown in SEQ ID NO.6.
[0019] This invention provides a reagent or kit for knocking out the CISD2 gene, the reagent or kit comprising the sgRNA described above.
[0020] Preferably, the reagent or kit further includes the coding sequence of the Cas9 protein.
[0021] This invention provides the application of the sgRNA or the reagent or kit described herein in the preparation of cell lines in which the protein encoded by the CISD2 gene has lost its function.
[0022] This invention provides a cell line in which the protein encoded by the CISD2 gene loses its function, wherein the cell line is obtained by knocking out the CISD2 gene in a host cell using the sgRNA or the reagent or kit described herein.
[0023] This invention provides the application of the sgRNA, the reagent or kit, or the cell line described herein in the production of vaccines against Picornaviridae viruses and / or Picornaviridae viruses.
[0024] The beneficial effects of this invention are:
[0025] This invention provides the application of CISD2 protein or CISD2 gene as a target in the preparation of products regulating the replication of Picornaviridae viruses and / or in vaccine production. Overexpression of CISD2 in host cells inhibits the replication of Picornaviridae viruses, while inhibiting CISD2 gene expression in host cells promotes their replication. This invention provides a CISD2-specific sgRNA that can specifically target the CISD2 gene, achieving accurate targeting and high knockout efficiency. Cell lines obtaining the CISD2 gene-encoded protein with lost function can be further used as production cell lines for Picornaviridae viruses and their vaccines, significantly promoting viral replication, increasing viral titer and antigen yield, and contributing to the preparation of highly effective vaccines, demonstrating broad application prospects. Attached Figure Description
[0026] Figure 1 The effect of CISD2 overexpression on FMDV replication is shown in the figure.
[0027] Figure 2 A schematic diagram of sgRNAs targeting the CISD2 genomic region.
[0028] Figure 3 This is a sequencing analysis diagram of gene deletion mutations in the CISD2-KO-1 cell line.
[0029] Figure 4 This is a sequencing analysis diagram of gene deletion mutations in the CISD2-KO-2 cell line.
[0030] Figure 5 Figure showing the expression of CISD2 protein in CISD2 gene knockout cell lines as detected by Western blot.
[0031] Figure 6 The results show the cell viability of the CISD2 gene knockout cell line; where ns represents no significant difference.
[0032] Figure 7 The figure shows the results of indirect immunofluorescence analysis of FMDV-infected CISD2 gene knockout cell lines and control cells.
[0033] Figure 8 The graph shows the difference in viral protein levels between FMDV-infected CISD2 gene knockout cell lines and control cells as detected by Western blot.
[0034] Figure 9 The figure shows the difference in mRNA levels between FMDV-infected CISD2 gene knockout cell lines and control cells detected by RT-qPCR. In the figure, ** indicates P < 0.01.
[0035] Figure 10 The image shows the fluorescence analysis results of SVA-infected CISD2 gene knockout cell lines and control cells. Detailed Implementation
[0036] This invention provides the application of CISD2 protein or CISD2 gene as a target in the preparation of products that regulate the replication of microRNAviridae viruses and / or in vaccine production.
[0037] In this invention, the microRNAviridae virus preferably includes foot-and-mouth disease virus and / or Seneca virus. CISD2 is CDGSH iron-sulfur domain 2 protein, and the preferred gene sequence of CISD2 is shown in SEQ ID NO.7, and the preferred amino acid sequence is shown in SEQ ID NO.8.
[0038] In this invention, the regulatory effect is preferably achieved by upregulating or downregulating the expression level of the CISD2 gene. Upregulating the expression level of the CISD2 gene can inhibit the replication of microRNAviridae viruses, while downregulating the expression level of the CISD2 gene can promote the replication of microRNAviridae viruses. This invention does not specifically limit the method of upregulating the expression level of the CISD2 gene; any method conventional in the art can be used. Preferably, the method of upregulating the expression level of the CISD2 gene includes overexpressing the CISD2 gene. Preferably, the method of downregulating the expression level of the CISD2 gene includes interfering with the expression of the CISD2 gene or knocking out the CISD2 gene. Preferably, the method of knocking out the CISD2 gene includes gene editing, which preferably includes knocking out the CISD2 gene using sgRNA. The sgRNA used to knock out the CISD2 gene preferably includes CISD2-sgRNA1 and / or CISD2-sgRNA2; the target sequence of CISD2-sgRNA1 is shown in SEQ ID NO.1; the target sequence of CISD2-sgRNA2 is shown in SEQ ID NO.2. The preferred gene editing method includes CRISPR / Cas9 gene editing technology.
[0039] This invention provides an sgRNA for knocking out the CISD2 gene, wherein the sgRNA includes CISD2-sgRNA1 and / or CISD2-sgRNA2;
[0040] The target sequence of CISD2-sgRNA1 is shown in SEQ ID NO.1;
[0041] The target sequence of CISD2-sgRNA2 is shown in SEQ ID NO.2.
[0042] The CISD2-sgRNA1 is preferably a double-stranded fragment formed by annealing CISD2-sgRNA1-F and CISD2-sgRNA1-R; the CISD2-sgRNA2 is preferably a double-stranded fragment formed by annealing CISD2-sgRNA2-F and CISD2-sgRNA2-R.
[0043] The gene sequence of CISD2-sgRNA1-F is shown in SEQ ID NO.3;
[0044] The gene sequence of CISD2-sgRNA1-R is shown in SEQ ID NO.4;
[0045] The gene sequence of CISD2-sgRNA2-F is shown in SEQ ID NO.5;
[0046] The gene sequence of CISD2-sgRNA2-R is shown in SEQ ID NO.6.
[0047] The present invention provides a reagent or kit for knocking out the CISD2 gene, the reagent or kit comprising the sgRNA, and preferably further comprising the coding sequence of the Cas9 protein.
[0048] In one embodiment, the reagent or kit preferably includes a recombinant vector containing the sgRNA, and the backbone vector of the recombinant vector preferably includes the expression vector PX459. The recombinant vector is preferably obtained by digesting the PX459 vector with the restriction endonuclease Bbs I and then ligating it with the sgRNA using T4 ligase.
[0049] This invention provides the application of the described sgRNA or the described reagent or kit in preparing cell lines with loss of function of the CISD2 gene-encoded protein. Preferably, the cell lines with loss of function of the CISD2 gene-encoded protein include CISD2 gene knockout cell lines.
[0050] In this invention, the method for preparing a cell line with loss of function of the CISD2 gene-encoded protein is preferably to use sgRNA to induce loss of function of the CISD2 gene-encoded protein in host cells through gene editing technology, wherein the gene editing technology is preferably CRISPR / Cas9 technology. In one embodiment, the specific steps of the method preferably include: ligating sgRNA into a PX459 plasmid to obtain a recombinant plasmid that simultaneously expresses Cas9 protein and sgRNA sequence; transfecting the recombinant plasmid into PK-15 cells, screening with antibiotics, and obtaining a CISD2 gene knockout cell line, which is the cell line with loss of function of the CISD2 gene-encoded protein.
[0051] This invention provides a cell line in which the CISD2 gene-encoded protein loses its function. The cell line is obtained by knocking out the CISD2 gene in host cells using the described sgRNA or the described reagent or kit. The host cells preferably include PK-15 cells.
[0052] This invention provides the application of the described sgRNA, reagent, kit, or cell line in the production of Picornaviridae virus and / or Picornaviridae virus vaccines. Infection of cell lines with a loss-of-function CISD2 gene-encoded protein using a Picornaviridae virus significantly promotes the replication of the virus, increasing viral titer and antigen yield. The Picornaviridae virus is preferably foot-and-mouth disease virus and / or Seneca virus.
[0053] In this invention, the following definitions apply to related terms:
[0054] The term "loss of protein function" refers to a frameshift mutation in a protein-encoding protein caused by knocking out, mutating, or inserting a portion of the gene into the protein-encoding gene segment, resulting in the protein's inability to perform its normal biological function. This invention achieves loss of function of the CISD2 gene-encoding protein by targeting and knocking out the CISD2 gene in host cells, thereby constructing a cell line with loss of CISD2 gene-encoding protein function, which is then used for vaccine production against FMDV and SVA viruses. However, this invention is not limited to CISD2 gene knockout; other techniques can also be used to achieve loss of function of the CISD2 gene-encoding protein and construct cell lines with loss of CISD2 gene-encoding protein function.
[0055] The term "gene editing" refers to targeted transgenic technology that uses site-specific homologous recombination of DNA to change the genetic information of cells or organisms. This mainly includes gene knockout, gene inactivation, gene knock-in, point mutation, deletion mutation, and large-segment deletion of the chromosome. "Gene knockout" specifically refers to the experimental deletion or inactivation of a particular gene in an organism's genome, preventing its expression or production of functional proteins. This invention uses gene knockout technology to knock out the CISD2 gene in host cells. The resulting monoclonal cell lines with loss of function of the CISD2 gene-encoded protein can promote the replication levels of FMDV and SVA viruses. This invention can also construct cell lines with loss of function of the CISD2 gene-encoded protein by mutating the CISD2 gene in host cells or inserting gene fragments, causing frameshift mutations in the CISD2 gene-encoded protein.
[0056] The term "sgRNA" stands for single-stranded guide RNA, a key component of the CRISPR / Cas9 gene editing system. It guides the Cas9 nuclease to target sites in the genome through its specific sequence, enabling precise gene editing.
[0057] This invention utilizes CRISPR / Cas9 gene editing technology to specifically knock out the CISD2 gene by designing sgRNAs targeting it. The method for CISD2 gene knockout is detailed using PK-15 cells as an example. Although this invention only knocks out the CISD2 gene in PK-15 cells to obtain CISD2 gene knockout cells, the method described herein can be extrapolated and extended to knocking out the CISD2 gene in other host cells, constructing gene knockout cell lines that enhance FMDV and SVA viral replication and antigen expression.
[0058] CRISPR / Cas9 gene editing technology achieves targeted gene recognition and cleavage through sgRNA and Cas9. sgRNA determines the targeting and cleavage activity of Cas9. By designing sgRNAs that target specific genes, Cas9 protein is guided to bind to specific sequence positions within those genes, cleaving the DNA double strand. This results in double-strand breaks, which, under the cell's own repair mechanisms, generate random mutations. Nucleotide deletions or insertions alter the gene's reading frame, ultimately leading to the loss of function of the gene-encoded protein and obtaining a cell line with this function. This invention aims to apply CRISPR / Cas9 gene editing technology to accurately and efficiently knock out the CISD2 gene by screening for sgRNA sequences targeting it in vitro and in vivo. The goal is to obtain a CISD2 gene knockout cell line that promotes FMDV and SVA viral replication and antigen expression, thus providing new strategies and material support for the production of FMDV and SVA small RNA virus vaccines.
[0059] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0060] Unless otherwise specified, the following embodiments are all conventional methods.
[0061] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0062] The FMDV (O / BY / CHA / 2010 strain) used in the following examples was deposited by the National Foot-and-Mouth Disease Reference Laboratory designated by the Ministry of Agriculture and Rural Affairs; the recombinant Seneca virus Re-SVA-EGFP labeled with EGFP was constructed and preserved by the Foot-and-Mouth Disease and Emerging Disease Epidemiology Team of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences (the preparation method of Re-SVA-EGFP is as follows: using gene synthesis technology, the EGFP gene is fused with the Teschovirus 2A gene (T2A) to obtain the EGFP-T2A gene fragment, and the EGFP-T2A fusion gene is inserted between the Seneca virus genes 2A and 2B of the eukaryotic transcription plasmid prSVV / FJ-M (the eukaryotic transcription plasmid prSVV / FJ-M is disclosed in the authorized invention patent "A recombinant nucleic acid of Seneca virus, a recombinant vaccine strain and its preparation method and application", ZL 202010212460.6). The detailed preparation method is obtained according to the corresponding preparation method in the following reference: Chen Z. et al. (2016). "Construction and characterization of a full-length cDNA infectiousclone of emerging porcine Senecavirus A". Virolog-y.2016,497:111-124).
[0063] Example 1: Effect of CISD2 overexpression on FMDV replication
[0064] 1. Construction of CISD2 eukaryotic expression plasmid
[0065] Query the CISD2 gene sequence from the NCBI database, design primers, CISD2-NheI-F: CGTCTA G CTAGC ATGGTGCTGGAGTGCGTGGCCCGGAT (SEQ ID NO.9) (underlined is the N heI restriction site); CISD2-BamHI-R: CGC GGATCCTACTTCTTTCTTCTTCAGTA TTAGT (SEQ ID NO.10) (underlined indicates BamHI restriction site). RNA was extracted from PK-15 cells, reverse transcribed into cDNA, and used as a template to amplify the CISD2 gene (nucleotide sequence as shown in SEQ ID NO.7, amino acid sequence as shown in SEQ ID NO.8). The amplified fragment was recovered by nucleic acid electrophoresis and double-digested with NheI and BamHI restriction endonucleases. At the same time, the pcDNA3.1 / myc vector plasmid was double-digested with the same restriction endonucleases. The CISD2 gene and the linearized vector fragment were purified and recovered, respectively. They were ligated overnight at 4°C using T4 ligase, transformed into DH5α competent cells, and the plasmid was extracted and sequenced. The successfully constructed plasmid was named CISD2-Myc.
[0066] 2. Effects of CISD2 overexpression on FMDV replication
[0067] PK-15 cells were seeded into 6-well plates and cultured at 37°C in a 5% CO2 cell culture incubator until the cell density reached approximately 70%. The cells were then transfected with different doses (0 μg, 1 μg, and 3 μg) of the CISD2 eukaryotic expression plasmid CISD2-Myc. After 24 hours, the cells were infected with FMDV and Western blot analysis was performed.
[0068] The results are as follows Figure 1 As shown, overexpression of CISD2 on PK-15 cells inhibits the abundance of FMDV viral proteins in a dose-dependent manner.
[0069] Example 2: Construction of CISD2 gene knockout PK-15 cell line
[0070] 1. Design of sgRNA targets
[0071] Based on the CISD2 gene sequence in the NCBI database, the sgRNA sequence CISD2-sgRNA1 was designed at position 197 of the first exon region of the CISD2 gene, and the sgRNA sequence CISD2-sgRNA2 was designed at position 233 of the first exon region of the CISD2 gene. See the schematic diagram below. Figure 2 .
[0072] The target sequence for CISD2-sgRNA1 is: AGCTCCCCGCGTATCTTAAG (SEQ ID NO.1);
[0073] CISD2-sgRNA1-F (5'-CACCGAGCTCCCCGCGTATCTTAAG-3', SEQ ID NO.3) and CISD2-sgRNA1-R (5'-AAACCTTAAGATACGCGGGGAGCTC-3', SEQ ID NO.4) were synthesized based on the targeting sequence of CISD2-sgRNA1.
[0074] The target sequence for CISD2-sgRNA2 is: AGAGCATTACCGGGTTCGCC (SEQ ID NO.2);
[0075] CISD2-sgRNA2-F (5'-CACCGAGAGCATTACCGGGTTCGCC-3', SEQ ID NO.5) and CISD2-sgRNA2-R (5'-AAACGGCGAACCCGGTAATGCTCTC-3', SEQ ID NO.6) were synthesized based on the targeting sequence of CISD2-sgRNA2.
[0076] 2. Construction of PX459-CISD2-sgRNA recombinant plasmid
[0077] The synthesized sgRNA upstream and downstream sequences were diluted to 10 μmol / L, and 22.5 μL of each were taken. 5 μL of 10×PCR buffer was added to prepare a 50 μL system, which was then annealed at 95℃ for 5 min to allow the upstream and downstream primers to form double strands. The PX459 vector was digested with the restriction endonuclease Bbs I, and the digestion products were subjected to 1% agarose gel electrophoresis to recover the fragments. The recovered linearized PX459 fragment was ligated with the annealed double-stranded sgRNA using T4 ligase. The ligation product was transformed into *E. coli* DH5α competent cells, and single colonies were picked and cultured with shaking. Plasmids were extracted and sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing. The positive recombinant plasmids identified by sequencing were named PX459-CISD2-sgRNA1 and PX459-CISD2-sgRNA2, respectively.
[0078] 3. Cell transfection and screening
[0079] Press Polyplus Transfection reagent instructions: Transfect PK-15 cells with the sgRNA recombinant plasmid. 24 h after transfection, digest the transfected cells with trypsin and add puromycin at a final concentration of 3 μg / mL for selection for 3 days. Replace with complete culture medium. When the cells grow to about 70%, digest the cells with trypsin and count them. Dilute the cells with complete culture medium containing puromycin and seed them into 96-well cell plates, ensuring one cell per well. Continue to culture in a 37℃, 5% CO2 incubator for 7 days. Observe and label the wells with single clones of cells in good growth condition, and passage them into 48-well and 24-well plates for expansion culture.
[0080] 4. Identification of monoclonal cell lines
[0081] Different cell clones were collected and identified at both the gene and protein levels.
[0082] 4.1 DNA was extracted from the monoclonal cell line to be identified according to the instructions of the genomic DNA extraction kit. Fragments containing sgRNA target sites were amplified using identification primers (CISD2-F: 5'-ATGGTGCTGGAGTGCGTGGCCC-3' (SEQ ID NO.11); CISD2-R: 5'-TACTTCTTTCTTCTTCAGTATTAG-3' (SEQ ID NO.12)). After electrophoresis on a 1% agarose gel, the amplified products were recovered from the gel and sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing, and the sequencing results were analyzed. Cell lines with frameshift mutations, such as gene deletions or insertions, were labeled as PK-15-CISD2-KO (CISD2 gene knockout cell lines) and named PK-15-CISD2-KO-1 (labeled CISD2-KO-1, obtained by transfection with recombinant plasmid PX459-CISD2-sgRNA1) and PK-15-CISD2-KO-2 (labeled CISD2-KO-2, obtained by transfection with recombinant plasmid PX459-CISD2-sgRNA2).
[0083] The results are as follows Figure 3 and Figure 4 As shown, PK-15-CISD2-KO-1 has a 1-base deletion at the predetermined cleavage site in exon 1 (between the 3rd and 5th bases of the PAM motif (CGG), and PK-15-CISD2-KO-2 has an 11-base deletion at the predetermined cleavage site in exon 1 (between the 1st and 12th bases of the PAM motif (CGG), both resulting in frameshift mutations in the CISD2 gene sequence.
[0084] 4.2 To further confirm the knockout effect of CISD2 in the cell lines identified by sequencing, identification was performed at the protein level. The expression of CISD2 protein in the monoclonal cell lines to be identified was analyzed by Western blot. Rabbit anti-CISD2 polyclonal antibody was purchased from Proteintech (Cat No. 13318-1-AP).
[0085] The results are as follows Figure 5 As shown, no expression of CISD2 protein was detected in either PK-15-CISD2-KO-1 or PK-15-CISD2-KO-2 cells. These results indicate that the CISD2 gene knockout PK-15 cell line was successfully constructed.
[0086] Example 3: Viability assay of CISD2 gene knockout PK-15 cell lines
[0087] The CISD2 gene knockout PK-15 cells (CISD2-KO-1 and CISD2-KO-2) and wild-type control cells (WT) prepared in Example 2 were digested with trypsin, and the cell suspension density was adjusted. The cells were seeded into 96-well cell culture plates at 100 μL / well and cultured in a 37°C, 5% CO2 cell culture incubator for 6 h. Then, 10 μL of CCK-8 solution was added to each well and the cells were cultured for another 3 h. The OD value at 450 nm was measured using a microplate reader and the data were analyzed.
[0088] The results are as follows Figure 6 As shown, there was no significant difference in cell viability between CISD2 gene knockout PK-15 cells (CISD2-KO-1 and CISD2-KO-2) and wild-type control cells, indicating that knockout of the CISD2 gene does not affect the normal growth characteristics of cells.
[0089] Example 4: Effect of CISD2 gene knockout on FMDV replication
[0090] The CISD2 gene knockout PK-15 cell lines CISD2-KO-1 and CISD2-KO-2 used in this example were prepared in Example 2.
[0091] 1. Indirect immunofluorescence assay
[0092] FMDV was used to infect CISD2 gene knockout PK-15 cell lines CISD2-KO-1 and CISD2-KO-2, as well as wild-type control cells (CISD2-WT). Cytopathic effects were observed. The supernatant was discarded, and the cells were washed three times with PBS, fixed with 4% paraformaldehyde at room temperature for 30 min, washed three times with PBS, permeabilized with 0.3% Triton X-100 at room temperature for 30 min, washed three times with PBS, and blocked with 5% BSA at 4℃ for 4 h. Using rabbit FMDV polyclonal antibody as the primary antibody, the cells were incubated overnight at 4℃, washed three times with PBST for 10 min each time. Using FITC-labeled goat anti-rabbit IgG as the secondary antibody, the cells were incubated overnight at 4℃ in the dark, washed three times with PBST for 10 min each time. Finally, DAPI was added, and the nuclei were stained at room temperature for 15 min. Fluorescence was observed and analyzed using a laser confocal microscope.
[0093] The results are as follows Figure 7 As shown, the green fluorescence in CISD2-KO-1 and CISD2-KO-2 PK-15 cells with CISD2 gene knockout was significantly higher than that in wild-type control cells, indicating that FMDV replication was significantly increased in cells with CISD2 gene knockout compared to wild-type control cells.
[0094] 2. Western blot analysis
[0095] FMDV was used to infect CISD2 gene knockout PK-15 cell lines CISD2-KO-1 and CISD2-KO-2, as well as wild-type control cells (WT). Protein samples were prepared at 0h, 8h, 10h, and 12h after infection. Rabbit anti-CISD2 antibody, rabbit anti-O type FMDV antibody, and mouse anti-β-Actin antibody were used as primary antibodies, and HRP-labeled goat anti-rabbit IgG and HRP-labeled goat anti-mouse IgG antibodies were used as secondary antibodies. Western blot analysis was performed.
[0096] The results are as follows Figure 8 As shown, the abundance of FMDV viral proteins in CISD2 knockout cells was significantly higher than that in wild-type control cells.
[0097] 3. RT-qPCR detection and analysis
[0098] FMDV was used to infect CISD2 knockout PK-15 cell lines CISD2-KO-1 and CISD2-KO-2, as well as wild-type control cells (WT). Total RNA was extracted at 0h, 8h, and 12h after infection and reverse transcribed. GAPDH was used as an internal reference gene, and the relative mRNA level of FMDV was quantitatively detected by qPCR.
[0099] The results are as follows Figure 9As shown: At different time points after FMDV infection, the mRNA level of FMDV in knockout CISD2 cells was significantly increased compared with that in wild-type control cells.
[0100] All of the above results indicate that knocking out the CISD2 gene can significantly promote the replication level of FMDV.
[0101] Example 5: Effect of CISD2 gene knockout on SVA replication
[0102] The CISD2 gene knockout PK-15 cell lines CISD2-KO-1 and CISD2-KO-2 used in this example were prepared in Example 2.
[0103] Recombinant Seneca virus Re-SVA-EGFP labeled with EGFP was used to infect CISD2 gene knockout PK-15 cell lines CISD2-KO-1 and CISD2-KO-2 and wild-type control cells (WT), respectively, and the cells were observed using a fluorescence microscope.
[0104] The results are as follows Figure 10 As shown: After infection with Re-SVA-EGFP, the green fluorescence in CISD2-KO-1 and CISD2-KO-2 PK-15 cells with CISD2 gene knockout was significantly higher than that in wild-type control cells, indicating that the replication level of SVA in cells with CISD2 gene knockout was significantly increased compared with wild-type cells.
[0105] The results in summary indicate that CISD2 gene knockout cell lines can significantly promote the replication of microRNAviridae viruses FMDV and SVA, and can be used for the production of microRNAviridae virus vaccines.
[0106] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. CISD2 The application of cell lines with lost-function gene-encoded proteins in the production of Picornaviridae viruses or Picornaviridae virus vaccines, characterized by: The cell line is formed by knocking out host cells using sgRNA or reagents or kits containing sgRNA. CISD2 The gene was obtained; the host cell was PK-15 cell; the sgRNA included CISD2 -sgRNA1 and / or CISD2 -sgRNA2; the CISD2 The target sequence of -sgRNA1 is shown in SEQ ID NO.1; CISD2 The target sequence for -sgRNA2 is shown in SEQ ID NO.2; The virus in question is either foot-and-mouth disease virus or Seneca virus.
2. The application as described in claim 1, characterized in that, The CISD2 -sgRNA1 is composed of CISD2 -sgRNA1-F and CISD2 The double-stranded fragment formed by annealing -sgRNA1-R; CISD2 -sgRNA2 is produced by CISD2 -sgRNA2-F and CISD2 -sgRNA2-R annealing forms a double-stranded fragment; The CISD2 The gene sequence of -sgRNA1-F is shown in SEQ ID NO.3; The CISD2 The gene sequence of -sgRNA1-R is shown in SEQ ID NO.4; The CISD2 The gene sequence of -sgRNA2-F is shown in SEQ ID NO.5; The CISD2 The gene sequence of -sgRNA2-R is shown in SEQ ID NO.
6.
3. The application according to claim 1, characterized in that, The reagent or kit also includes the coding sequence of the Cas9 protein.
Citation Information
Patent Citations
Recombinant nucleic acid of seneca virus, recombinant vaccine strain as well as preparation method and application thereof
CN111394367A
Use of modulators of NEET proteins for the treatment of infection
US20210038566A1