Bacillus ginsengisoli from the rumen of ruminants, and isolation method and application thereof

Abstract

The application discloses a rumen-derived bacillus ginsengisoli for ruminants, and a 16S rDNA sequence of the bacillus ginsengisoli is shown as SEQ ID NO.1. The strain is collected from a rumen of a ruminant, inoculated into a culture medium with straws as substrates to perform anaerobic culture, subcultured and enriched to obtain a dominant strain utilizing straws, subjected to cellulose bacteria screening culture, selected by single colonies, purified, and the strain with a single cellulose degradation capacity is obtained. The bacillus ginsengisoli has strong adaptability, can effectively ferment feed in aerobic and anaerobic environments, and has rapid start-up fermentation, high fermentation process stability, improved feed quality, and reduced feeding cost.

Description

Technical Field

[0001] This invention belongs to the field of microbial inoculant technology, specifically relating to a rumen-derived Bacillus subtilis, its isolation method, and its application. Background Technology

[0002] Bacillus subtilis (Ginseng) Weizmannia ginsengihumi ) [1] As a Bacillus strain, it exhibits facultative aerobic characteristics. Due to its biological properties, this strain is considered an excellent biocontrol agent, capable of playing a positive role in agriculture, environmental protection, and other fields. (In Anna et al.) [3] Further research revealed that *Bacillus ginseng* possesses a highly efficient phytase production capacity. Phytase, as an enzyme additive, is widely used in the feed industry. Its function lies in effectively converting phytic acid, a substance that is difficult to digest, into inositol derivatives and inorganic phosphates, which are more easily digested and absorbed by animals. [4] Kyung Dong and others [2] In this study, *Bacillus ginseng* was revealed to have the potential as a novel probiotic, particularly in combating obesity and related metabolic disorders, where the strain demonstrated a positive effect. By regulating the balance of the gut microbiota, this strain may help optimize host energy metabolism and weight control.

[0003] Bacillus species are rich in cellulase, and some Bacillus species can act as cellulose probiotics. When used as feed additives, they have the ability to degrade cellulose, effectively breaking down indigestible plant cell wall components in feed and releasing nutrients that can be absorbed and utilized by animals, thereby improving the utilization efficiency of feed resources. [5-6] These bacteria colonize and multiply in the animal gut, interacting with the native flora to form a stable symbiotic relationship. Through competitive exclusion mechanisms, they inhibit the growth of potential pathogens and harmful microorganisms, maintaining the stability and diversity of the gut microbiota and playing a positive regulatory role in the balance of the gut microbiota. [7] These products enhance animal immunity. They improve digestive health, stress resistance, and overall production performance by competitively inhibiting the growth of pathogenic microorganisms, producing beneficial metabolites (such as short-chain fatty acids and phytase), and maintaining intestinal barrier function. This results in increased daily weight gain, improved feed conversion efficiency, and reduced disease incidence. [8-9] Furthermore, treating feed with cellulose probiotics can reduce the amount of undigested fiber in animal excrement, thereby reducing the total amount of organic matter in feces and emissions of greenhouse gases such as ammonia and methane. [10-11] This helps improve the breeding environment and aligns with the modern livestock industry's goals of pursuing environmental protection and low carbon emissions.

[0004] Although Bacillus species possess cellulose-degrading capabilities, there are currently no reports on the cellulose-degrading ability of *Bacillus ginseng*. A search revealed that CN202311431491.0 discloses a novel *Bacillus ginseng* strain and its application in promoting crop growth, screening it from soybean rhizosphere soil for use in promoting crop growth; CN202110638843.4 discloses a novel *Bacillus ginseng* strain and its uses, isolating a novel *Bacillus ginseng* strain from wild ginseng for use in cosmetics, quasi-pharmaceuticals, and food. However, existing *Bacillus ginseng* strains are costly to cultivate, hindering large-scale application. Summary of the Invention

[0005] This invention addresses the technical problem to be solved and overcomes the shortcomings of existing technologies by providing a method for isolating and applying Bacillus subtilis from the rumen of ruminants.

[0006] One of the objectives of this invention is to provide a rumen-derived Bacillus subtilis, the 16S rDNA sequence of which is shown in SEQ ID NO.1.

[0007] The above-mentioned rumen-derived *Weizmannia ginsengihumi* has the accession number CCTCC NO:20242880, is deposited at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Wuhan, China, on December 23, 2024, and is classified as *Weizmannia ginsengihumi* W1.

[0008] The second objective of this invention is to provide a method for isolating Bacillus subtilis from the rumen of ruminants, comprising the following steps: Step 1: Collect fresh food residue from the rumen of ruminants, dilute it with physiological saline, filter it, and inoculate it into an adaptive culture medium for anaerobic culture. Step 2: Inoculate the bacterial culture from Step 1 into a culture medium with straw as the substrate, continue anaerobic culture, and subculture and enrich at least 5 times to obtain the dominant strain that utilizes straw. Step 3: Spread the enriched bacterial solution onto a cellulose-selective culture medium for cultivation, select single colonies, purify, and obtain strains with cellulose single-degradation ability.

[0009] The further optimized technical solution of this invention is as follows: Preferably, the adaptive culture medium is composed of a mixture of buffer A, buffer B and buffer C, wherein buffer A is a potassium dihydrogen phosphate solution, buffer B includes potassium dihydrogen phosphate solution, ammonium sulfate solution and magnesium sulfate heptahydrate solution, and buffer C includes calcium chloride dihydrate solution and sodium chloride solution. Mix buffer solutions A, B, and C in equal proportions, add cyanin solution, adjust the pH to 7.0, continuously purge CO2 into the prepared culture medium until the culture medium turns light yellow, then dispense the culture medium into culture bottles of the same size, seal, and autoclave at 121°C for 15 min.

[0010] Preferably, the method for preparing the culture medium using straw as a substrate is as follows: Add 10g of straw powder, 2g of potassium dihydrogen phosphate, 2g of disodium hydrogen phosphate, 0.3g of magnesium sulfate, 0.3g of calcium chloride, 1g of L-cysteine ​​hydrochloride, 1mg of gentian root extract, and 100ml of cell-free rumen fluid to each liter of deionized water. Adjust the pH to 7.0. Continuously purge CO2 into the prepared culture medium until the culture medium turns light yellow. Then dispense the contents and autoclave at 121°C for 15 minutes.

[0011] Preferably, the method for preparing the cellulosic bacteria screening culture medium is as follows: Add 20g sodium carboxymethyl cellulose, 2g potassium dihydrogen phosphate, 1.4g ammonium sulfate, 0.3g magnesium sulfate, 0.3g calcium chloride, 1g L-cysteine ​​hydrochloride, 100mL cell-free rumen fluid, and 1g Congo red to each liter of deionized water. Then add agar powder at a ratio of 10g / L to adjust the pH to 7.0. Continuously purge CO2 into the prepared culture medium until the culture solution turns light yellow. Autoclave at 121°C for 15 minutes. Dispense the prepared culture solution into petri dishes and store after cooling.

[0012] The third objective of this invention is to provide an application of Bacillus subtilis derived from the rumen of ruminants in the preparation of fermented feed.

[0013] The rumen-derived Bacillus subtilis of the present invention has strong adaptability and can effectively ferment feed in both aerobic and hypoxic environments. It can also quickly start fermentation, and the fermentation process is highly stable, which improves feed quality and reduces feeding costs. Attached Figure Description

[0014] Figure 1 This is a Gram staining image of Bacillus subtilis in this invention.

[0015] Figure 2 This is a Congo red transparent circle image of Bacillus ginseng in this invention.

[0016] Figure 3 This is a growth curve diagram of ginseng soil buds in this invention.

[0017] Figure 4 This is an electrophoresis diagram of the PCR product of ginseng spores in this invention.

[0018] Figure 5This is a phylogenetic tree diagram of the ginseng soil bud stem in this invention.

[0019] Figure 6 This is a schematic diagram showing the verification results of the cellulose degradation function of the present invention. Detailed Implementation

[0020] The technical solution of the present invention will be further described in detail below with reference to the embodiments: This embodiment is implemented under the premise of the technical solution of the present invention, and provides detailed implementation methods and specific operation processes, but the protection scope of the present invention is not limited to the following embodiments.

[0021] Except for the biological materials and reagents specifically described herein, all other materials and reagents mentioned in this invention are commercially available and can be purchased from domestic and international commercial channels, and will not be described in detail here. Example 1

[0022] I. Culture medium preparation (1) Adaptive culture medium composition and preparation Buffer A: Potassium dihydrogen phosphate (0.3 g / 100 mL); Buffer B: Potassium dihydrogen phosphate (0.3 g / 100 mL), ammonium sulfate (0.6 g / 100 mL), magnesium sulfate heptahydrate (0.06 g / 100 mL); Buffer C: Calcium chloride dihydrate (0.06 g / 100 mL), sodium chloride (0.6 g / 100 mL). Mix the prepared buffers A, B, and C in equal proportions, add anylanine solution (1 mg / L), and adjust the pH to 7.0. Continuously purge the prepared culture medium with CO2 until the culture medium turns pale yellow (anaerobic). Then, dispense the culture medium into culture flasks of the same size, stopper with rubber stoppers and cap with aluminum caps, and autoclave at 121°C for 15 min.

[0023] (2) Composition and preparation of culture medium with straw as substrate Add 10g of straw powder, 2g of potassium dihydrogen phosphate, 2g of disodium hydrogen phosphate, 0.3g of magnesium sulfate, 0.3g of calcium chloride, 1g of L-cysteine ​​hydrochloride, 1mg of gentian root extract, and 100ml of cell-free rumen fluid to each liter of deionized water, adjusting the pH to 7.0. Continuously purge the prepared culture medium with CO2 until the culture solution turns pale yellow (anaerobic). Then, dispense and autoclave the culture solution into culture bottles of the same size, stopper with rubber stoppers and cap with aluminum caps, and autoclave at 121°C for 15 minutes.

[0024] (3) Preparation of screening culture medium for cellulosic bacteria Cellulose bacteria were screened using Congo red agar, prepared as follows: 20g sodium carboxymethyl cellulose, 2g potassium dihydrogen phosphate, 1.4g ammonium sulfate, 0.3g magnesium sulfate, 0.3g calcium chloride, 1g L-cysteine ​​hydrochloride, 100mL cell-free rumen fluid, 1g Congo red, and 10g / L agar powder were added to each liter of deionized water. The pH was adjusted to 7.0. CO2 was continuously bubbled into the prepared medium until the culture solution turned light yellow (anaerobic). The medium was then autoclaved at 121°C for 15 minutes. The prepared culture solution was dispensed into petri dishes and allowed to cool before use.

[0025] II. Acquisition of Infectious Sources Three healthy Hu sheep from Yangzhou University were selected and fitted with rumen fistulas. They were fed their daily rations twice a day and had free access to water. Fresh 10 mL of rumen chyme was collected through the fistula, placed in a thermos filled with carbon dioxide, and quickly transferred to the laboratory.

[0026] III. Bacterial Isolation and Culture Procedures (1) Dilution and activation of the bacterial source CO2 was continuously introduced into the collected rumen chyme, and 5 times the volume of physiological saline was added for dilution. The diluted rumen fluid was filtered through four layers of sterile gauze, and the filtrate was inoculated into an adaptive culture medium and anaerobically cultured at 39°C for 24 h.

[0027] (2) Enrichment culture of cellulose-degrading bacteria using straw as substrate The activated bacterial solution was further inoculated into a culture medium with straw as the substrate and anaerobically cultured at 39°C for 24 h. The cultured bacterial solution was then further inoculated into a new culture medium with straw as the substrate and cultured for another 24 h. The above operation was repeated 5 times to enrich the dominant bacteria that utilize straw.

[0028] (3) Screening and purification of cellulose-degrading bacteria The enriched bacterial suspension was diluted and spread onto a cellulose-selective medium, incubated at 39°C for 48 h. Once single colonies appeared, as many colonies as possible were picked and inoculated onto fresh cellulose-selective medium, incubated at 39°C for 48 h, and the above steps were repeated 3-5 times. During this process, colonies exhibiting a Congo red clear zone were selected to purify the strain capable of single-cell cellulose degradation (see...). Figure 2 ).

[0029] (4) Identification and preservation of isolated strains After culturing the pure strain obtained above for 24 h, it was mixed evenly with sterilized 50% glycerol (1:1, v:v) and stored at -80°C.

[0030] IV. Identification of Isolated Strains (1) Morphological identification of the strain Observe the morphology of the colonies (oil immersion, 1000X magnification), and observe the morphology and color of the cells after Gram staining (purple for G+, pink for G-). The Gram staining result of the colonies showed a positive result (see...). Figure 1 ).

[0031] Observation of colony morphology revealed that the colonies of Bacillus ginseng was milky white, moist, glossy, and round-drop shaped.

[0032] Morphological identification of the colonies of Bacillus ginseng strain was performed, and the results are shown in Table 1.

[0033] Table 1 Morphological Identification

[0034] (2) Identification of physiological and biochemical properties The strains were physiologically and biochemically identified using biochemical identification tubes from Hangzhou Microbiology, and the results were recorded in detail. The test results were further confirmed using the standards of the "Manual of Systematic Identification of Common Bacteria" and "Bergey's Manual of Bacterial Identification" (results are shown in Table 2).

[0035] The acid production results of the strain are shown in Table 3.

[0036] Table 2 Identification of Physicochemical Properties

[0037] Note: + indicates positive; - indicates negative.

[0038] Table 3 Acid production results

[0039] Growth performance assessment: The strain was inoculated at 1% into the adaptive culture medium (Example 1 (1)), with pH values ​​set to 4, 4.5, 5, 5.5, 6 and 6.5, three replicates per group, and incubated at 160 r / min and 37°C for at least 24 h. The absorbance of the bacterial solution at OD600 nm was measured every 4 h using an ELISA reader. After recording the data, the growth curve was plotted using Graphpad Prism 9 (see [link to graphs]). Figure 3 ).

[0040] (3) Molecular biological identification of strains and construction of phylogenetic trees Two ml of bacterial culture in the logarithmic growth phase was taken, and genes were extracted from the isolated strain using a bacterial gene kit from Beijing Tiangen. Primer design involved synthesizing primers for the V3-V4 region of the bacterial 16S rDNA gene; the sequence primers were 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). The PCR products, after amplification and testing, were sent to Shanghai Lingen Biotech for further sequencing. After sequencing, the obtained sequence data were compared and analyzed against known sequences in the NCBI and GenBank databases. Multiple comparisons were performed using MEGA X software, and a phylogenetic tree was constructed using the Neighbor-Joining algorithm (see [link to MEGA X]). Figure 5 ).

[0041] 16S rDNA Genome Identification: The bacteria were amplified by PCR. The nucleotide sequence of the amplified 16S rDNA gene fragment is shown in SEQ ID NO.1. The PCR product was examined by 1% agarose gel electrophoresis to confirm whether the amplified fragment was the target fragment. The result showed that it was the target fragment of approximately 8000 bp (see...). Figure 4 Gene sequences were obtained by BLAST alignment in the NCBI GeneBank database. Based on the alignment results, 10 strains with high homology were selected as references, and a phylogenetic tree was constructed by performing multiple sequence comparisons using MEGA software (using the Neighbor-Joining method). It was found that they shared over 99% homology with *Bacillus ginseng*, belonging to the same branch (see...). Figure 5 ).

[0042] The sequencing results were compared with existing market feasibility and economic benefit forecasts: The comparison revealed that the strain was a *Bacillus ginsengae* strain. Weizmannia ginsengihumi The accession number is OR459948 (https: / / www.ncbi.nlm.nih.gov / nuccore / OR459948.1 / ). *Bacillus ginseng* of rumen origin from ruminants is deposited at the China Center for Type Culture Collection (CCTCC), with accession number CCTCC NO:20242880.

[0043] V. Fiber Degradability Test Enzyme-linked immunosorbent assay (ELISA) kits from Jiangsu Kete were used. For endonuclease activity, the carboxymethyl cellulase (CCE) ELISA kit was used to determine the enzyme activity of the bacterial suspensions; for exonuclease activity, the microcrystalline cellulase (MCCase) ELISA kit was used; for β-glucosidase activity, the β-glucosidase ELISA kit was used; and for filter paper enzyme activity, the filter paper enzyme (EP) ELISA kit was used. Cellulase activity of the bacterial suspensions was determined according to the manufacturer's instructions.

[0044] As shown in Table 4, the activities of carboxymethyl cellulase were 66.46±5.5 IU / mL, filter paper enzyme activity was 7.03±0.43 IU / mL, microcrystalline cellulase activity was 6.56±1.17 IU / mL, and β-glucosidase activity was 7.54±0.86 IU / mL.

[0045] Table 4 Cellulase Activity

[0046] VI. Verification of Cellulose Degradation Function Straw and glucose were used as the sole carbon sources, respectively, with a carbon-free substrate as a blank control. Isolated bacterial strains were inoculated and subjected to in vitro fermentation, and the gas production was measured. Results are as follows: Figure 6 As shown, compared with the blank control (no substrate), the gas production of the isolated strains was significantly increased under the substrate of rice straw as carbon source, suggesting that W1 can degrade and utilize rice straw.

[0047] The *Bacillus ginsengae* of this invention is a probiotic, and its development is currently limited. This invention discovers that *Bacillus ginsengae*, as a facultative probiotic, plays an important role in feed fermentation, including efficiently initiating and carrying out the fermentation process, improving feed quality, optimizing fermentation technology, and reducing costs.

[0048] (1) High-efficiency fermentation Highly adaptable: Bacillus subtilis can survive and function in both aerobic and anaerobic environments, enabling it to adapt to different fermentation stages and variations in local oxygen conditions during feed fermentation. Especially in large fermentation tanks or composting processes where oxygen distribution is uneven, this bacterium can fully utilize the oxygen conditions in different areas for effective fermentation.

[0049] Rapid fermentation initiation: In the early stages of fermentation, Bacillus subtilis proliferates rapidly using aerobic respiration, quickly consuming the oxygen in the fermentation system, which helps create an anaerobic environment, facilitating the growth and metabolism of subsequent obligate anaerobic bacteria.

[0050] (2) Improve feed quality Degradation of anti-nutritional factors: Bacillus subtilis can secrete a variety of enzymes (such as cellulase, pectinase, phytase, etc.) to effectively degrade anti-nutritional factors such as non-starch polysaccharides and phytic acid in feed, thereby improving the bioavailability of nutrients in feed.

[0051] Protein conversion: Bacillus subtilis can convert some of the protein in feed into more easily digestible and absorbable substances such as volatile fatty acids, biogenic amines, and polypeptides through reactions such as amino acid deamination and decarboxylation, thereby improving the nutritional value of the feed.

[0052] Producing beneficial metabolites: During fermentation, Bacillus subtilis can also produce beneficial metabolites such as organic acids (such as lactic acid) and short-chain fatty acids. These substances not only help improve the flavor of feed, but also regulate the pH value of animal intestines, inhibit the growth of harmful bacteria, and maintain the balance of intestinal microecology.

[0053] (3) Optimize the fermentation process Stable fermentation environment: Because Bacillus subtilis can switch its metabolic mode under aerobic and anaerobic conditions, it helps maintain the stability of the fermentation process and reduces fermentation abnormalities caused by insufficient or excessive oxygen supply.

[0054] Synergistic effect: In multi-strain fermentation systems, there is a synergistic effect with other aerobic and anaerobic bacteria, which improves the overall fermentation efficiency and product quality through complementary metabolism and symbiotic relationships.

[0055] (4) Reduce costs Alternative feed ingredients: Bacillus subtilis fermentation can transform some low-value, indigestible agricultural by-products (such as straw, bran, soybean meal, etc.) into high-nutritional-value feed, reducing dependence on expensive feed ingredients and lowering feeding costs.

[0056] Improve feed conversion rate: Since the nutrients in fermented feed are more easily digested and absorbed by animals, using feed fermented with Bacillus subtilis can improve feed conversion rate, reduce feed waste, and indirectly save costs.

[0057] Its unique metabolic characteristics make it an indispensable part of feed fermentation processes, which helps to improve the nutritional value of feed, improve animal digestive performance and health, and also provides technical support for the efficient use of feed resources and the sustainable development of animal husbandry.

[0058] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any transformations or substitutions that can be conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

[0059] References: [1]Calvo-Garrido C, Roudet J, Aveline N, et al. Microbial AntagonismToward Botrytis Bunch Rot of Grapes in Multiple Field Tests Using OneBacillus ginsengihumi Strain and Formulated Biological Control Products[J]. Front Plant Sci. 2019;10:105. [2]Toymentseva AA, Suleimanova AD, Boulygina EA, et al. Draft GenomeSequence of Bacillus ginsengihumi Strain M2.11 with Phytase Activity[J]. Genome Announc. 2015;3(4):e00851-15. [3] Gu Bintao, Guo Jianjun, Zeng Jing, et al. Expression of phytase gene in Lactobacillus acidophilus [J / OL]. China Feed: 1-5 [2024-03-21]. https: / / doi.org / 10.15906 / j.cnki.cn11-2975 / s.2023030067-03. [4]Lee KD, Ilavenil S, Karnan M, et al. Novel Bacillus ginsengihumiCMRO6 Inhibits Adipogenesis via p38MAPK / Erk44 / 42 and Stimulates GlucoseUptake in 3T3-L1 Pre-Adipocytes through Akt / AS160 Signaling[J]. Int J MolSci. 2022;23(9):4727. [5] Sun Junke, Zhang Wanying, Deng Ruozhu, et al. Isolation of cellulose-degrading bacteria I2 and functional verification of related degradation genes [J / OL]. Food and Fermentation Industries: 1-12 [2024-04-21]. [6] Chen Huan, Shi Zihao, Wu Chunhui, et al. Screening, identification and comparison of enzyme production capacity of cellulose-degrading bacteria from different sources [J / OL]. Acta Agronomica Sinica: 1-8 [2024-04-21]. [7] Li Miao, He Haijuan, Li Zhongqiu, et al. Research progress on the role of probiotics in the intestinal health of livestock and poultry [J / OL]. Feed Research, 2024(06):154-158 [2024-04-21]. [8] Tang Jun, He Li, Wang Penghui, et al. Research progress on the role of gut microbiota in healthy production of ruminants [J]. Chinese Journal of Animal Husbandry and Veterinary Medicine, 2024, 51(04):1466-1479. [9] Nie Yuxia, Wen Haiyan, Wang Xiangkun, et al. Research progress on the application of probiotics in feed [J]. Shandong Animal Husbandry and Veterinary Medicine, 2024, 45(03):81-84.

[10] Wang Xuejun, Min Changli, Han Penglei, et al. Isolation and identification of cellulose-degrading bacteria in cow dung and their enzyme production study [J]. Natural Product Research and Development, 2015, 27(07):1181-1186+1258.

[11] Yang, Linli. Screening of cellulose-degrading bacteria and determination of cellulose degradation capacity of mixed strains [D]. Northwest A&F University, 2014.

Claims

1. A rumen-derived Bacillus subtilis from ruminants, characterized in that, Its 16S rDNA sequence is shown in SEQ ID NO.1, and its accession number is CCTCC NO:20242880. This strain can effectively ferment feed under both aerobic and anaerobic conditions.

2. The application of Bacillus subtilis from the rumen of ruminants as described in claim 1 in the preparation of fermented feed from straw, bran, or soybean meal.

Images