A streptococcus suis type 2 gene deletion strain and a construction method and application thereof
Patent Information
- Application Number
- CN202510224071.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-27
- Publication Date
- 2026-08-18
- Estimated Expiration
- 2045-02-27
AI Technical Summary
目前对减毒活疫苗的研究主要集中在通过缺失猪链球菌关键的毒力基因构建的基因缺失疫苗;但是,受限于毒力基因的研究,对于猪链球菌基因缺失疫苗的报道还相对较少
[0020] This invention, for the first time, deletes the B9H01_05210 gene from the genome of Streptococcus suis type 2 SC19 via homologous recombination. The constructed Streptococcus suis type 2 gene-deleted strain exhibits reduced resistance to hydrogen peroxide and nitric oxide stress, and significantly weakened pathogenicity in mice. Moreover, the growth performance of the Streptococcus suis type 2 gene-deleted strain is not significantly different from that of the wild-type strain SC19, and there is no gene recovery after continuous passage. It has the potential to be used as an attenuated live vaccine and provides good immunoprotection against different genotypes of Streptococcus suis type 2, such as SC19 and Streptococcus suis type 2 P1/7, with a certain degree of cross-immunoprotection.
Smart Images

Figure CN120060105B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biopharmaceutical technology, specifically to a Streptococcus suis type 2 gene deletion strain, its construction method, and its application. Background Technology
[0002] Streptococcus suis is a Gram-positive pathogen that can infect humans via foodborne transmission, causing clinical symptoms such as septicemia, meningitis, and toxic shock, and even death. Therefore, effective control of Streptococcus suis is necessary. Based on differences in capsular antigens, Streptococcus suis can be classified into 33 serotypes, among which Streptococcus suis serotype 2 is the most prevalent serotype causing disease in pigs. Based on differences in the sequences of seven housekeeping genes (aroA, cpn60, dpr, gki, mutS, recA, thrA), it can be classified into different genotypes (ST) (Auger et al., 2016). The pathogenicity of Streptococcus suis varies among different serotypes or genotypes.
[0003] Vaccination is an effective preventative measure against Streptococcus suis infection. Currently, most inactivated vaccines used to prevent Streptococcus suis infection are self-made multivalent inactivated vaccines. These vaccines are relatively inexpensive and have good safety profiles, but their immunization efficacy is not ideal. Compared to inactivated vaccines, live attenuated vaccines have stronger immunogenicity and do not require adjuvants to enhance immunization, theoretically possessing the potential to become mucosal immunization vaccines. Current research on live attenuated vaccines mainly focuses on gene-deleted vaccines constructed by deleting key virulence genes of Streptococcus suis; however, due to limitations in virulence gene research, reports on gene-deleted vaccines against Streptococcus suis are relatively few. Summary of the Invention
[0004] In view of the above-mentioned prior art, the purpose of this invention is to provide a Streptococcus suis type 2 gene deletion strain, its construction method and application.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] In a first aspect, the present invention provides a Streptococcus suis type 2 gene deletion strain, which is obtained by deleting the B9H01_05210 gene from the genome of Streptococcus suis type 2 SC19 strain, the nucleotide sequence of which is shown in SEQ ID No. 1; specifically as follows:
[0007]
[0008] SC19 is a virulent isolate of Streptococcus suis type 2. This invention has found that the B9H01_05210 gene can serve as a new virulence gene. Deleting the B9H01_05210 gene from SC19 weakens the antioxidant capacity of the bacteria and significantly reduces its pathogenicity. Moreover, after continuous subculturing, there is no phenomenon of virulence reversion, making it a good candidate strain for vaccine preparation.
[0009] A second aspect of the present invention provides a method for constructing the above-mentioned Streptococcus suis type 2 gene deletion strain, comprising the following steps:
[0010] Using the genomic DNA of Streptococcus suis type 2 strain SC19 as a template, the upstream and downstream homologous arms of the B9H01_05210 gene were amplified, respectively. The upstream and downstream homologous arms of the B9H01_05210 gene were cloned into the pSET4s plasmid to obtain the gene-deleted recombinant plasmid pSET4sΔB9H01_05210. The gene-deleted recombinant plasmid pSET4sΔB9H01_05210 was transformed into SC19 competent cells to construct the Streptococcus suis type 2 gene-deleted strain.
[0011] Preferably, the upstream homologous arm of the B9H01_05210 gene is amplified using primers Up-B9H01_05210-F shown in SEQ ID No. 2 and primers Up-B9H01_05210-R shown in SEQ ID No. 3; and the downstream homologous arm of the B9H01_05210 gene is amplified using primers Down-B9H01_05210-F shown in SEQ ID No. 4 and primers Down-B9H01_05210-R shown in SEQ ID No. 5.
[0012] Preferably, the method for cloning the upstream and downstream homologous arms of the B9H01_05210 gene into the pSET4s plasmid is as follows: the pSET4s plasmid is digested with EcoRI and BamHI restriction endonucleases, respectively, and the upstream and downstream homologous arms of the B9H01_05210 gene are ligated into the digested pSET4s plasmid.
[0013] Preferably, the gene-deleted recombinant plasmid pSET4sΔB9H01_05210 is transferred into SC19 competent cells by electroporation; the electroporation voltage is 2500V, the resistance is 500 ohms, and the electroporation time is 5ms.
[0014] A third aspect of the present invention provides the use of the above-described Streptococcus suis type 2 gene deletion strain in the preparation of a vaccine for the prevention or treatment of Streptococcus suis infection.
[0015] In the above applications, the vaccine is a live attenuated vaccine.
[0016] In the above applications, the Streptococcus suis infection is caused by Streptococcus suis type 2 SC19 and / or Streptococcus suis type 2 P1 / 7.
[0017] The live attenuated vaccine prepared using the genode deletion strain of Streptococcus suis type 2 of the present invention has broad-spectrum immunogenicity and can prevent or treat infections caused by different genotypes of Streptococcus suis, such as SC19 and P1 / 7.
[0018] In a fourth aspect, the present invention provides a live attenuated vaccine for preventing and treating Streptococcus suis infection, wherein the live attenuated vaccine uses the above-mentioned Streptococcus suis type 2 gene deletion strain as the active ingredient.
[0019] The beneficial effects of this invention are:
[0020] This invention, for the first time, deletes the B9H01_05210 gene from the genome of Streptococcus suis type 2 SC19 via homologous recombination. The constructed Streptococcus suis type 2 gene-deleted strain exhibits reduced resistance to hydrogen peroxide and nitric oxide stress, and significantly weakened pathogenicity in mice. Moreover, the growth performance of the Streptococcus suis type 2 gene-deleted strain is not significantly different from that of the wild-type strain SC19, and there is no gene recovery after continuous passage. It has the potential to be used as an attenuated live vaccine and provides good immunoprotection against different genotypes of Streptococcus suis type 2, such as SC19 and Streptococcus suis type 2 P1 / 7, with a certain degree of cross-immunoprotection. Attached Figure Description
[0021] Figure 1 The amplification results of the upstream and downstream homologous arms of the target gene B9H01_05210; lane 1 is the upstream homologous arm; lane 2 is the downstream homologous arm.
[0022] Figure 2 Identification results of the B9H01_05210 gene deletion recombinant plasmid pSET4s-ΔB9H01_05210.
[0023] Figure 3 PCR verification of the identification results of the gene-deleted strain SC19ΔB9H01_05210, where M 1 DL5000 Marker; M 2 : DL2000 Marker; 1: SC19; 2-16: PCR identification of suspected strains to screen for target strains; 6, 8, 11, 16: SC19ΔB9H01_05210 successfully constructed.
[0024] Figure 4Genetic stability of gene-deleted strain SC19ΔB9H01_05210: 1: wild-type SC19, 2-4: single colony cultures of gene-deleted strain after passage.
[0025] Figure 5 Growth curves of wild-type strain SC19 and gene-deleted strain SC19ΔB9H01_05210.
[0026] Figure 6 Hydrogen peroxide tolerance results of wild-type strain SC19 and gene-deleted strain SC19ΔB9H01_05210.
[0027] Figure 7 Nitric oxide tolerance results of wild-type strain SC19 and gene-deleted strain SC19ΔB9H01_05210.
[0028] Figure 8 Results of colony counting in mouse tissues and organs of wild-type strain SC19 and gene-deleted strain SC19ΔB9H01_05210.
[0029] Figure 9 Virulence assay (LD50) of wild-type strain SC19 and gene-deleted strain SC19ΔB9H01_05210 50 ).
[0030] Figure 10 The immunoprotective effect of the attenuated vaccine of gene-deleted strain SC19ΔB9H01_05210 on mice infected with Streptococcus suis type 2 SC19 strain.
[0031] Figure 11 The immunoprotective effect of the attenuated vaccine of gene-deleted strain SC19ΔB9H01_05210 on mice infected with Streptococcus suis type 2 P1 / 7 strain. Detailed Implementation
[0032] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0033] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.
[0034] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions. Wherein:
[0035] The wild-type Streptococcus suis strain SC19 is indexed in GenBank as MNPY00000000.1. Streptococcus suis P1 / 7 is described in the literature “Serotype distribution and production of muramidase-released protein, extracellular factor and suilysin by field strains of Streptococcus suis isolated in the United States.” Veterinary Microbiology 156(3-4):290-296.”
[0036] Example 1: Construction of a Streptococcus suis type 2 gene deletion strain
[0037] 1. Construct the recombinant vector pSET4sΔB9H01_05210 that deletes the B9H01_05210 gene.
[0038] Using the genome of wild-type Streptococcus suis strain SC19 as a template, the upstream and downstream homologous arms of the B9H01_05210 gene were amplified using the primers Up-B9H01_05210-F / Up-B9H01_05210-R and Down-B9H01_05210-F / down-B9H01_05210-R in Table 1, and the upstream and downstream homologous arms of the B9H01_05210 gene were ligated and recovered.
[0039] Table 1: Primers for constructing gene deletion strains
[0040]
[0041] Reaction system: 25 μL of 2×Taq Master PCR Mix, 1 μL of DNA template, 1 μL of forward primer (20 μM), 1 μL of reverse primer (20 μM), and ddH2O to make up to 50 μL.
[0042] Reaction program: 95℃ for 5 min, 94℃ for 1 min, 55℃ for 30 s, 72℃ for 1 min, 30 cycles, 72℃ for 10 min. The PCR product was recovered and purified according to the instructions of the BIOMIGA PCR product purification kit. 2 μL was taken for detection, and the results are as follows: Figure 1 As shown, upstream and downstream homologous arms of the target length were successfully amplified.
[0043] The pSET4s plasmid was extracted according to the plasmid extraction kit instructions. The pSET4s plasmid was double-digested with EcoRI and BamHI. The digested pSET4s product was recovered, and the upstream and downstream homologous arm fragments of the amplified B9H01_05210 gene were ligated into the double-digested pSET4s plasmid. 10 μL of the ligation product was added to 100 μL of *E. coli* competent cells, mixed well, and incubated on ice for 30 min. The cells were then treated at 42°C for 90 s, followed by an ice bath for 2 min. 900 μL of LB medium was added, and the cells were incubated at 30°C for 10 min to recover. The cells were then shaken at 30°C for 90 min. 100 μL of the bacterial culture was evenly spread on an antibiotic-containing plate and incubated overnight at 30°C. Several clonal clones were picked from the plate for colony PCR amplification, and the products were detected by gel electrophoresis. The electrophoresis results are shown below. Figure 2 As shown in the image. The plasmid was also sent to Sangon Biotech for sequencing.
[0044] The above results show that the present invention successfully constructed the recombinant vector pSET4sΔB9H01_05210 with the B9H01_05210 gene missing.
[0045] 2. Construct a Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210)
[0046] The recombinant vector pSET4sΔB9H01_05210 was electroporated into SC19 competent cells under the following electroporation conditions:
[0047] Voltage 2500V, resistance 500Ω, time 5ms. Immediately after electroporation, add THB medium, mix well, and transfer to EP tubes; preheat at 30℃ for 10 min, then incubate at 37℃ on a shaker for 2–3 h; spread 100 μL of the cultured bacterial suspension onto a THB plate containing 50 μg / mL spectinomycin, and pick single colonies to place in THB liquid medium (containing 50 μg / mL spectinomycin) and incubate overnight at 37℃; dilute the bacterial suspension and spread it onto THB solid medium (containing 50 μg / mL spectinomycin) and incubate at 37℃ for 12 h; select single colonies and place them in THB liquid medium (without spectinomycin) and incubate overnight at 30℃, then transfer at a 1:5 ratio to... The culture was continued at 30°C in fresh THB liquid medium (without spectinomycin), and the culture was transferred three times. After continuous culture, the bacterial suspension was serially diluted and spread onto THB solid medium (without spectinomycin) and incubated overnight at 37°C. Single colonies from the above solid medium were selected and streaked on THB solid medium containing 50 μg / mL spectinomycin and THB solid medium without spectinomycin, respectively, and incubated at 37°C for 12 h. Colonies that did not grow on THB solid medium containing 50 μg / mL spectinomycin but grew on THB solid medium without spectinomycin were selected and transferred to fresh THB liquid medium (without spectinomycin) and incubated overnight at 37°C for identification.
[0048] The primers used for PCR identification of the deletion bacteria are as follows:
[0049] B9H01_05210-Secondary Exchange-F:TTCTAAATGCACCGATTGCG;
[0050] B9H01_05210-Secondary Exchange-R:ATGGCTGCATCCTTATTCTCA.
[0051] Reaction system: 10 μL of 2×Taq Master PCR Mix, 1 μL of DNA template, 1 μL of forward primer (20 μM), 1 μL of reverse primer (20 μM), and 7 μL of ddH2O.
[0052] The reaction procedure was as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 30 s; annealing at 57℃ for 30 s; extension at 72℃ for 90 s; repeated 35 times; extension at 72℃ for 10 min; and cooling at 16℃.
[0053] PCR identification results as follows Figure 3 As shown, the results indicate that the fragment lengths of the suspected strains in lanes 6, 8, 11, and 16 are significantly shorter than those of the wild-type SC19 in lane 1, thus indicating that they are strains with missing target fragments.
[0054] The genome of the target fragment deletion strain identified by PCR was resequencing (Sangon Biotech). The results of genome resequencing (Sangon Biotech) showed that the B9H01_05210 gene of the target fragment deletion strain identified by PCR was deleted.
[0055] The above results demonstrate that the present invention successfully constructed a Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210).
[0056] Example 2: Investigation of the genetic stability of the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210)
[0057] The Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) constructed in Example 1 was passaged for 30 consecutive generations. Single colonies after 30 consecutive generations were picked and the expression of the B9H01_05210 gene was detected by PCR.
[0058] The results are as follows Figure 4 As shown, the gene-deleted bacterium SC19ΔB9H01_05210, after continuous subculturing, exhibits good genetic stability, and the mutated gene deletion has not been restored.
[0059] Example 3: Growth observation of Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210)
[0060] Equal amounts of wild-type strain SC19 and the *Streptococcus suis* type 2 gene-deleted strain (SC19ΔB9H01_05210) constructed in Example 1 were inoculated into THB liquid medium and cultured at 37°C and 220 rpm in a shaker. Every 1 hour, 1 mL of bacterial culture was collected into a cuvette and the OD value was read using a spectrophotometer. 600 The absorbance values were recorded and the bacterial in vitro growth curve was plotted.
[0061] The results are as follows Figure 5 As shown, there was no significant difference in growth between the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) and the wild-type strain SC19, indicating that the deletion of the B9H01_05210 gene has little effect on the growth of Streptococcus suis.
[0062] Example 4: Investigation of hydrogen peroxide tolerance in Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210)
[0063] 1. Test method:
[0064] (1) Preparation of bacterial suspension:
[0065] Streptococcus suis type 2 gene-deleted strain (SC19ΔB9H01_05210) and wild-type strain SC19 were cultured separately to obtain bacterial suspensions of Streptococcus suis type 2 gene-deleted strain and wild-type strain SC19. The bacterial suspensions were centrifuged at 4000 rpm for 5 min, the supernatant was discarded, and the bacterial cells were resuspended in sterile PBS, with the cell concentration adjusted to 2 × 10⁻⁶. 8 CFU / ml was used to obtain a bacterial suspension.
[0066] (2) Hydrogen peroxide treatment:
[0067] Add equal volumes of the prepared bacterial suspension to sterile centrifuge tubes, and add H2O2 to make the final concentrations 0 mM (control) and 20 mM, respectively. Set up 3 replicates for each concentration, gently shake to mix, and incubate in a 37°C, 5% CO2 incubator for 40 min to induce oxidative stress in Streptococcus suis under hydrogen peroxide induction.
[0068] (3) Dilution plate:
[0069] After incubation, each tube of bacterial culture was serially diluted. 7 μL of the diluted culture was then dropped onto a THB agar plate, with three replicates for each dilution.
[0070] Invert the plate and incubate it in a 37°C incubator for 10-15 hours until colonies grow.
[0071] (4) Data processing and analysis:
[0072] Count the number of colonies on the plates and calculate the survival rate of Streptococcus suis in each experimental group using the following formula:
[0073] Survival rate (%) = (Average colony count in experimental group / Average colony count in blank control group) × 100%
[0074] Statistical software was used to analyze the data, with P < 0.05 considered statistically significant. Bar charts were plotted to show the changes in the survival rate of Streptococcus suis under different hydrogen peroxide concentrations.
[0075] 2. Test Results:
[0076] The results are as follows Figure 6 As shown, the results indicate that compared with the wild-type strain SC19, the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) has a significantly reduced tolerance to hydrogen peroxide.
[0077] Example 5: Investigation of nitric oxide tolerance in Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210)
[0078] 1. Test method:
[0079] (1) Preparation of bacterial suspension:
[0080] Streptococcus suis type 2 gene-deleted strain (SC19ΔB9H01_05210) and wild-type strain SC19 were cultured separately to obtain bacterial suspensions of Streptococcus suis type 2 gene-deleted strain and wild-type strain SC19. The bacterial suspensions were centrifuged at 4000 rpm for 5 min, the supernatant was discarded, and the bacterial cells were resuspended in sterile PBS, with the cell concentration adjusted to 2 × 10⁻⁶. 8 CFU / ml was used to obtain a bacterial suspension.
[0081] (2) Nitric oxide treatment:
[0082] Add equal volumes of the prepared bacterial suspension to sterile centrifuge tubes, and add DETA NONOate to make final concentrations of 0 mM (control) and 5 mM, respectively. Set up 3 replicates for each concentration, gently shake to mix, and incubate in a 37°C, 5% CO2 incubator for 1 h to induce oxidative stress in Streptococcus suis under nitric oxide induction.
[0083] (3) Dilution plate:
[0084] After incubation, serially dilute each tube of bacterial suspension. Take 7 μL of each diluted suspension and drop it onto a THB agar plate, performing three replicates for each dilution. After the bacterial suspension dries, invert the plates and incubate them in a 37°C incubator for 10-15 hours, until colonies appear.
[0085] (4) Data processing and analysis:
[0086] Count the number of colonies on the plates and calculate the survival rate of Streptococcus suis in each experimental group using the following formula:
[0087] Survival rate (%) = (Average colony count in experimental group / Average colony count in blank control group) × 100%
[0088] Statistical software was used to analyze the data, with P < 0.05 considered statistically significant. Bar charts were plotted to show the changes in the survival rate of Streptococcus suis under different nitric oxide concentrations.
[0089] 2. Test Results:
[0090] The results are as follows Figure 7 As shown, the results indicate that compared with the wild-type strain SC19, the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) has a significantly reduced tolerance to nitric oxide.
[0091] Example 6: Colony counting experiment of Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210)
[0092] Wild-type strain SC19 and Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) were inoculated into THB liquid medium and cultured at 37°C and 220 rpm in a shaker. After 12 h, they were transferred at a concentration of 2.5 × 10⁻⁶. 8 Mice were challenged with CFU at a dose, and 24 hours later, mouse tissues and organs were collected in a sterile environment and homogenized. Using a 100 μL micropipette, 100 μL of a 1:10 sample homogenate was slowly poured along the tube wall into a sterile test tube containing 900 μL of diluent, and the tube was shaken to homogenize the sample. For each 10-fold serial dilution, 10 μL of sample was added to sterile THB solid medium, with each dilution performed in triplicate. Simultaneously, 10 μL of blank dilution was used as a blank control. After the dilution solidified, the solid medium was inverted and incubated at 36℃±1℃ for 48h±2h. After incubation, the medium was removed, and the dilution factor and corresponding colony count were recorded visually. The colony count was expressed as colony forming units (CFU).
[0093] The results are as follows Figure 8 As shown, the bacterial colonization of the gene-deleted strain SC19ΔB9H01_05210 in tissues and organs was significantly lower than that of the wild-type strain SC19.
[0094] Example 7: Virulence test (LD50) of Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) 50 )
[0095] Fifty female mice weighing 18-20g and in essentially the same physiological condition were randomly divided into 10 groups of 5 mice each. Five of these groups received an intraperitoneal injection of 5 × 10⁻⁶ doses. 8 2.5×10 8 1×10 8 5×10 7 2.5×10 7 CFU wild-type strain SC19; the other 5 groups were administered via intraperitoneal injection at a dose of 5 × 10⁻⁶. 8 2.5×10 8 1×10 8 5×10 7 2.5×10 7 CFU of Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210).
[0096] Mice were observed for 5 days after inoculation, and their status was recorded every 8 hours. The number of mice that died and survived within 5 days was recorded, and the LD50 of wild-type strain SC19 and Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) was calculated.50 .
[0097] The results are as follows Figure 9 As shown, the results indicate that the LD50 of the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) is... 50 1×10 8 CFU, LD of wild-type SC19 50 2×10 7 CFU showed lower toxicity than wild-type SC19.
[0098] Example 8: Immunoprotective assay of Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210)
[0099] Twenty female mice weighing 18-20g were randomly divided into four groups of five each. Groups 1 and 2 were designated as the immunization group, receiving an intramuscular injection of 2.5 × 10⁻⁶ mg / kg. 8 CFU of Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210); Groups 3-4 served as the PBS control group, receiving an equal volume of PBS via intramuscular injection.
[0100] 14 days after immunization, using an equal dose (5×10) 8 Group 1 of the wild-type Streptococcus suis strain SC19 challenge immunization group (CFU) and Group 3 of the PBS control group; using equal doses (5×10) 8 Two groups were immunized with Streptococcus suis P1 / 7 challenge (CFU), and four groups were immunized with PBS control group.
[0101] After challenge, mice were observed for 7 days. The status of the mice was recorded daily, the number of surviving mice was counted, and the survival rate of the mice was calculated.
[0102] The results are as follows Figure 10-11 As shown, mice immunized with the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) showed significantly improved survival rates under challenges from P1 / 7 and SC19, indicating that the Streptococcus suis type 2 gene deletion strain (SC19ΔB9H01_05210) has protective and cross-immunizing effects.
[0103] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.
Claims
1. A Streptococcus suis type 2 gene deletion strain, characterized in that, The genome of Streptococcus suis strain SC19 is... B9H01_ 05210 Obtained after gene deletion, the aforementioned B9H01_05210 The nucleotide sequence of the gene is shown in SEQ ID No.
1.
2. The use of the Streptococcus suis type 2 gene deletion strain according to claim 1 in the preparation of a vaccine for the prevention or treatment of Streptococcus suis infection, characterized in that, The Streptococcus suis infection is caused by Streptococcus suis type 2 SC19 and / or Streptococcus suis type 2 P1 / 7.
3. The application according to claim 2, characterized in that, The vaccine in question is a live attenuated vaccine.
4. A live attenuated vaccine for the prevention and treatment of Streptococcus suis infection, characterized in that, The attenuated live vaccine uses the Streptococcus suis type 2 gene deletion strain described in claim 1 as its active ingredient.
Citation Information
Patent Citations
Five-gene-deleted streptococcus suis serotype 2 strain and application
CN105316252A
Streptococcus suis 2 (SS2) apuA gene knockout mutant strain and application thereof
CN109810933A