A nucleic acid nano-hybrid material, a preparation method and application thereof

CN120078899BActive Publication Date: 2026-09-04TIANJIN NORMAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510483561.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-17
Publication Date
2026-09-04
Estimated Expiration
2045-04-17

AI Technical Summary

Technical Problem

然而,纳米材料在通过高渗透长滞留效应(EPR)到达肿瘤部位后,很难再渗透到肿瘤的核心部位

Benefits of technology

[0046] (1) This invention uses a one-pot method to prepare nucleic acid nano-hybrid materials, wherein Au 3+ First, DNA phosphorylated by GSH, His, and thiophosphorylation is reduced to form AuCN-DNA, which emits NIR-I fluorescence. Then, two linker single strands are added, and the complementary strand of the X-DNA monomer is allowed to self-assemble into a DNA nanonucleus through programmed cooling. Next, the complementary strand of the Y-DNA monomer is added, and the Y-DNA monomer continues to grow on the surface of the nanonucleus through programmed cooling. The two linker single strands can form a double strand, connecting the X-DNA monomer and the Y-DNA monomer to form the final nanomaterial. Finally, hemin is added to form a stable and dense dendritic nucleic acid nanohybrid material, the particle size of which can be freely controlled.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120078899B_ABST
    Figure CN120078899B_ABST
Patent Text Reader

Abstract

The application provides a nucleic acid nano-hybrid material and a preparation method and application thereof, and belongs to the technical field of nano material preparation. 3+ First, the GSH, His and thiophosphorylated DNA are reduced to form AuCN-DNA, and NIR-I fluorescence is emitted, then two Linker single strands and X-DNA complementary strands are added, and the X-shaped DNA is self-assembled into a DNA nanocore through programmed cooling; then, Y-DNA complementary strands are added, and the Y-shaped DNA monomers continue to grow on the surface of the nanocore through programmed cooling; finally, hemin is added to form stable and dense dendritic nucleic acid nano-hybrid materials, and the particle size of the materials can be freely controlled. The material has the characteristics of H2O2 self-supply and GSH self-consumption, can target and penetrate into the core of a tumor, and can efficiently inhibit tumor growth through multi-mode catalytic reaction.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of medical material preparation technology, and in particular to a nucleic acid nano-hybrid material, its preparation method and application. Background Technology

[0002] Chemokinetic therapy (CDT) utilizes the Fenton reaction to catalyze the formation of highly toxic ·OH from H₂O₂, making it an effective in-situ cancer treatment strategy. Because H₂O₂ is overexpressed at the tumor site, ·OH is generated only in the tumor region, causing less damage to normal tissues; therefore, CDT exhibits high specificity and low invasiveness. However, the limited amount of H₂O₂ at the tumor site (100 × 10⁻⁶) is a significant concern. -6 M~1×10 -3 M) cannot achieve efficient CDT. Furthermore, the cells also contain high concentrations of the antioxidant GSH (10 × 10⁻⁶). -3 M) can scavenge ·OH, reducing the efficacy of CDT. Therefore, it is very important to develop nano-drug delivery systems that both supply H2O2 and eliminate GSH.

[0003] Chen et al. used copper peroxide nanodots as an activator to increase the H2O2 concentration in tumors to some extent through a Fenton-like reaction, but they could not achieve a continuous supply of H2O2. Glucose oxidase (GOx), as a natural oxidoreductase, can catalyze the in-situ generation of H2O2 from endogenous glucose, thereby promoting the conversion of Fenton's reagent and enhancing the generation of ·OH. However, the preparation cost of natural enzymes is high, their stability is low, and their catalytic activity is often affected by temperature, pH, and other factors.

[0004] Nanozymes are widely used in biological applications due to their simple preparation, low cost, high stability, and unique enzyme-like catalytic activity. However, after reaching the tumor site through the high-permeability long retention effect (EPR), nanomaterials struggle to penetrate the tumor core. This is because the nanoparticle size required for materials to reach tumor cells via blood circulation is approximately 100-200 nm, but this size makes deep penetration into the tumor core difficult. Only small-sized nanomaterials (<20 nm) can achieve deep penetration at the tumor site, but such small materials are then cleared from the bloodstream. Therefore, nanomaterials must also meet the following conditions: 1) the material aggregates at the tumor site through the EPR effect; 2) it decomposes into even smaller functional particles in the tumor microenvironment, allowing these small nanoparticles to penetrate the tumor core and achieve highly effective tumor treatment.

[0005] Therefore, constructing a nanotherapy system with Fenton activity and GOx-like co-delivery to achieve an enzyme-catalyzed / Fenton cascade catalytic reaction, thereby significantly improving the efficacy of CDT, is crucial for cancer treatment. Summary of the Invention

[0006] The purpose of this invention is to provide a nucleic acid nano-hybrid material, its preparation method and application. The nucleic acid nano-hybrid material has the characteristics of self-supply of H2O2 and self-consumption of GSH. It can activate the material morphology by responding to the pH value of the tumor microenvironment, and effectively inhibit tumor growth by targeting the tumor and using multi-mode catalytic reactions.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0008] This invention provides a nucleic acid nanohybrid material, wherein the concentrations of each raw material in the preparation process of the nucleic acid nanohybrid material are as follows:

[0009] HAuCl4:GSH:His:DNA:Linker:X-DNA monomer complementary strand:Y-DNA monomer complementary strand:hemin=140~145:20~25:10~15:0.645:1.127:0.161:0.242:0.403.

[0010] Preferably, the DNA sequence comprises two single-stranded X-DNA monomers, X2 and X4, and two single-stranded Y-DNA monomers, Y2 and Y3; the complementary strands of the X-DNA monomers comprise single strands X1 and X3; the complementary strand of the Y-DNA monomer is Y1, and the sequences of X1–X4 and Y1–Y3 are as follows:

[0011] X1-SEQ ID NO.1:

[0012] GGTGGTGGTGGTTGTGGTGGTGGTGGGGGGGTCACTGCATACCG GCTGCTCAGAACATACATACCCCCTTTTCCCCCTTG;

[0013] X2-SEQ ID NO.2:

[0014] A*AA*A*AA*AA*AA*ATTGGGGGTATGTATGTTCTGAGCTCGGACTCGCAAACGACCCCCTTTTCCCCCCTG;

[0015] X3-SEQ ID NO.3:

[0016] GGTGGTGGTGGTTGTGGTGGTGGTGGGGGGGTCGTTTGCGAGTCC GTCGTGTAAATGATGCGACCCCCTTTTCCCCCTTG;

[0017] X4-SEQ ID NO.4:

[0018] A*AA*A*AA*AA*AA*ATTGGGGGTCGCATCATTTACACGTGCCGGTATGCAGTGACCCCCTTTTCCCCCTTG;

[0019] The sequence of the Y-DNA monomer (comprising 3 single strands) is shown in SEQ ID NO.3:

[0020] Y1-SEQ ID NO.5:

[0021] GGTGGTGGTGGTTGTGGTGGTGGTGGGGGGGTGCTGTCCTAACCATGACCGTCGACCCCCTTTTCCCCCCTG;

[0022] Y2-SEQ ID NO.6:

[0023] A*AA*A*AA*AA*AA*ATTGGGGGTCGACGGTCATGTACTAGATCA GACCCCCTTTTCCCCCTTG;

[0024] Y3-SEQ ID NO.7:

[0025] A*AA*A*AA*AA*AA*ATTGGGGGTCTGATCTAGTAGTTAGGACAG CACCCCCTTTTCCCCCTTG;

[0026] The bases marked with * above are thiophosphorylated bases;

[0027] The Linker sequence is as follows:

[0028] Linker1-SEQ ID NO.8:

[0029] GTCCCGCCTGTGACATGCATTCAAGGGGGAAAT;

[0030] Linker-SEQ ID NO.9:

[0031] AATGCATGTCACAGGCGGGACCAAGGGGAAAT.

[0032] Preferably, the tail ends of the X-DNA and Y-DNA monomers are designed with thiophosphorylated bases, AS1411 aptamers, and cytosine-rich i-motifs.

[0033] Preferably, the AS1411 aptamer can form a G-quadruplex structure with the following sequence:

[0034] SEQ ID NO.10: GGTGGTGGTGGTTGTGGTGGTGGTGG;

[0035] The cytosine-rich i-motif can form a triplet structure.

[0036] This invention also provides a method for preparing nucleic acid nano-hybrid materials, comprising the following steps:

[0037] (1) Dissolve HAuCl4, GSH and His in ultrapure water, heat and stir to obtain a colorless GSH / His-Au aqueous solution; add NaOH solution to the GSH / His-Au aqueous solution, adjust the pH and then add DNA, continue stirring to obtain reaction solution A;

[0038] (2) Preparation of X-monomer hybrid DNA nanonuclei: The complementary strand of X-DNA monomer and the linker strand were added to reaction solution A, incubated, and rapidly cooled to form X-monomer hybrid DNA nanonuclei.

[0039] (3) Preparation of nucleic acid nanohybrid materials: The complementary strand of Y-DNA monomers was added to the DNA nanonucleus solution of X monomer hybridization, incubated, rapidly cooled, and incubated a second time to allow the Y-DNA monomers to further attach to the X-DNA nanonucleus to form Au-DNA HPs. Finally, hemin was added and allowed to stand to form nucleic acid nanohybrid materials.

[0040] Preferably, in step (1), the stirring temperature is 95°C and the stirring time is 2-5 min.

[0041] Preferably, in step (1), the pH is 8 to 9; the stirring time is 2 to 3 hours, and the temperature is 95°C.

[0042] Preferably, in step (2), the incubation temperature is 95°C, the incubation time is 15 min, the rapid cooling rate is 1-1.5°C / s, and the temperature is cooled to 64-66°C.

[0043] Preferably, in step (3), the incubation temperature is 64-66°C, the incubation time is 0.5-1.5h, the rapid cooling rate is 1-1.5°C / s, cooling to 35-38°C, the secondary incubation time is 2-4h, and the resting time is 6-12h.

[0044] This invention also provides a method for preparing nucleic acid nanohybrid materials and the application of the prepared nucleic acid nanohybrid materials in the preparation of cancer therapeutic drugs.

[0045] The nucleic acid nano-hybrid materials, their preparation methods, and applications provided by this invention offer the following advantages compared to existing technologies:

[0046] (1) This invention uses a one-pot method to prepare nucleic acid nano-hybrid materials, wherein Au 3+ First, DNA phosphorylated by GSH, His, and thiophosphorylation is reduced to form AuCN-DNA, which emits NIR-I fluorescence. Then, two linker single strands are added, and the complementary strand of the X-DNA monomer is allowed to self-assemble into a DNA nanonucleus through programmed cooling. Next, the complementary strand of the Y-DNA monomer is added, and the Y-DNA monomer continues to grow on the surface of the nanonucleus through programmed cooling. The two linker single strands can form a double strand, connecting the X-DNA monomer and the Y-DNA monomer to form the final nanomaterial. Finally, hemin is added to form a stable and dense dendritic nucleic acid nanohybrid material, the particle size of which can be freely controlled.

[0047] (2) The nucleic acid nanohybrid material of this invention possesses the characteristics of self-supply of H2O2 and self-consumption of GSH. It activates material morphology changes in response to the pH value of the tumor microenvironment, and effectively inhibits tumor growth through multi-mode catalytic reactions after targeting the tumor. This material decomposes into small, dendritic X / Y-DNA monomers with sticky ends in response to the acidic environment of the tumor microenvironment, exhibiting high stability and penetration ability. After targeting and entering cells, cell imaging is achieved using AuCNs emitted by NIR. Simultaneously, this material also possesses GOx-like catalytic activity, converting endogenous glucose into gluconic acid and H2O2. By consuming glucose, it cuts off the nutrient supply to tumor cells, achieving starvation therapy. Meanwhile, H2O2 is used for the Fenton reaction. The hemin (Fe) loaded on AS1411... 3+ It can be reduced to hemin (Fe) by consuming intracellular GSH. 2+ ), reacts with excess H2O2 in tumor tissue to generate ·OH. Meanwhile, hemin (Fe 2+ It is unstable and can be oxidized to hemin (Fe). 3+ During the cyclic reaction, GSH is continuously consumed, generating ·OH and significantly increasing intracellular ROS levels. Therefore, this process, in conjunction with starvation therapy, enhances CDT, ultimately inducing cancer cell apoptosis, and exhibits good tissue compatibility and biosafety.

[0048] (3) Each X-DNA and Y-DNA monomer of this invention is multifunctional. In addition to hybrid AuCNs, the tail of the monomer is also designed with an AS1411 aptamer and a cytosine-rich i-motif. Figure 1This gives it targeting and drug delivery capabilities. Furthermore, it exhibits the property of folding in response to pH. These features allow the material to fold and hide all the sticky ends of DNA upon stimulation, transforming it into a small, stable, highly penetrable, and targeted nucleic acid monomer. After penetrating into the tumor core, the nucleic acid monomer, under the action of AS1411, targets and enters tumor cells, enabling targeted tumor therapy. Attached Figure Description

[0049] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0050] Figure 1 The structure of the AS1411 aptamer and the cytosine-rich i-motif in the DNA nanoparticles of the X-monomer hybridization of the present invention is shown.

[0051] Figure 2 The flowchart and structure of AuDH HPs in Example 1 are shown.

[0052] Figure 3 Characterization of AuDH HPs, where A is a monodisperse AuCN-DNA TEM image; B is a HAADF image of the TEM of AuDH HPs that self-assembled to form AuDH HPs; C is the disassembly of AuDH HPs into X-DNA and Y-DNA monomers in response to pH; D is the DLS analysis of AuCN-DNA and AuDH HPs; E is the Au 4f spectrum in the XPS of AuDH HPs; F is the fluorescence and UV-vis spectra of AuCN-DNA.

[0053] Figure 4 The following are the Fenton catalytic performance test results of AuDH HPs prepared in Example 1 of Experimental Example 1 of this invention, where A is the reaction mechanism diagram of AuDH HPs; B is the UV-vis spectrum obtained by treating TMB aqueous solution with AuDH HPs, glucose and different concentrations of GSH; C is the fluorescence enhancement method of terephthalic acid to confirm the generation of ·OH; D is the ESR spectrum of the reaction system with DMPO as the capture agent; E is the Michaelis-Menten fitting curve of H2O2 concentration on the initial generation rate of ·OH; F is the Lineweaver-Burk fitting curve corresponding to E; G is the Michaelis-Menten fitting curve of the initial generation rate of ·OH on glucose concentration; H is the Lineweaver-Burk fitting curve corresponding to G.

[0054] Figure 5The images show the in vivo performance of AuDH HPs prepared in Example 1 of Experimental Example 2 of this invention. A represents AuDH HPs cell imaging; B represents CLSM images of tumor spheroids treated with AuDH HPs to study the material's penetration properties; C represents CLSM images of ROS generated by HeLa cells after incubation with different materials; D represents the cytotoxicity of HeLa cells after different treatments; E represents HeLa cells stained with Calcein AM / PI after different treatments; F represents JC-1 staining of HeLa cells after different treatments; and G represents flow cytometry analysis of HeLa cell apoptosis after different treatments.

[0055] Figure 6 The fluorescence results of tumor-bearing mice after administration of AuDH HPs prepared in Example 1 of Experiment 3 of this invention are shown in Figure 3. A is the fluorescence imaging of HeLa tumor-bearing mice after intravenous injection of AuDH HPs; B is the in vivo fluorescence image of the major organs of the mice; C is the in vivo fluorescence image of the tumor; D corresponds to the fluorescence intensity of B and C.

[0056] Figure 7 The image shows the treatment results of tumor-bearing mice with AuDH HPs prepared in Example 1 of Experiment 3 of this invention. A is a photograph of the mouse tumor after different treatments; B is the tumor volume of HeLa tumor-bearing mice after different treatments; C is the effect on mouse body weight; and D is the H&E photograph of tumor and tissue sections taken from mice after different treatments. Detailed Implementation

[0057] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0058] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0059] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0060] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0061] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0062] Example 1

[0063] Example 1 of this invention provides a method for preparing nucleic acid nano-hybrid materials, the preparation process and structure are as follows: Figure 2 As shown, the specific steps are as follows:

[0064] (1) Preparation of AuCN-DNA:

[0065] HAuCl4, GSH, and His were dissolved in ultrapure water to make final concentrations of 145 mM HAuCl4, 24 mM GSH, and 12 mM His, respectively. The solution was stirred vigorously in an oil bath at 95°C for 2 min to obtain a colorless GSH / His-Au aqueous solution.

[0066] Add 18 μL of NaOH (1.0 M) to the GSH / His-Au aqueous solution to adjust the pH of the mixed solution to 8.0, and then add DNA to make the final concentration 0.645 mM (where X2 0.0805 mM, X4 0.0805 mM, Y2 0.242 mM, and Y3 0.242 mM). Continue stirring at 95 °C for 2.5 h to obtain reaction solution A.

[0067] (2) Preparation of DNA nanoparticle solution for X-monomer hybridization:

[0068] Sequences that can form X-shaped monomers (X-DNA) (where X1 is 0.0805 mM and X3 is 0.0805 mM) were added to reaction solution A, and then linker was added to bring the final concentration to 1.127 mM. The mixture was incubated at 95°C for 15 min and then rapidly cooled to 65°C at a rate of 1 degree per second to form DNA nanoparticles hybridized with X-monomers.

[0069] (3) Preparation of nucleic acid nanohybrid materials: Single-stranded DNA (Y1 final concentration 0.242 mM) forming Y-shaped monomers (Y-DNA) was continuously added to the solution. After incubation at 65°C for 1 h, the sample was rapidly cooled to 37°C and incubated for 3 h to allow the Y-DNA monomers to further attach, forming Au-DNA HPs (AuD HPs). Finally, hemin was added to the reaction system to bring the final concentration to 0.403 mM, and the mixture was left to stand overnight to form nucleic acid nanohybrid materials AuDH HPs.

[0070] (4) The AuDH HPs were characterized, and the results are as follows: Figure 3 As shown.

[0071] Figure 3 As shown in image A, the synthesized AuCN-DNA is spherical with a uniform size distribution and distinct lattice fringes. High-angle annular dark-field image-scanning transmission electron imaging (HAADF) reveals that the self-assembled AuDH HPs have a particle size of approximately 110 nm, and the presence of AuCNs is clearly visible. Figure 3 (B) When pH = 6.5, the AuDH HPs nanoparticles disappear, disassembling into X-DNA and Y-DNA monomers (B). Figure 3 (C). The particle size of AuCN-DNA and AuDH HPs was further characterized using DLS. From... Figure 3 As shown in Figure D, the average particle sizes of AuCN-DNA and AuDH HPs are 2.3 nm and 116 nm, respectively, with relatively narrow particle size distributions. The sizes obtained by DLS are slightly larger than those measured by TEM, which is due to hydration of the materials in aqueous solution. X-ray photoelectron spectroscopy (XPS) analysis indicates that Au 4f in AuNC-DNA... 7 / 2 The binding energy is 84.5 eV, which is greater than that of Au. 0 (84.0 eV), and Au I The binding energies are the same (84.5 eV), which may be due to the protection of AuCNs by DNA after thiophosphate modification. Figure 3 (E). Then, spectral analysis was performed on the material. For example... Figure 1 As shown in Figure F, AuCN-DNA exhibits a narrow excitation peak at 427 nm and a strong NIR-I emission peak at 810 nm. Furthermore, it shows a distinct UV-Vis absorption peak at 258 nm.

[0072] Example 2

[0073] In Example 2 of this invention, a nucleic acid nano-hybrid material was prepared using the method of Example 1. The difference between Example 2 and Example 1 is that in step (1), the final concentrations of HAuCl4, GSH, and His are 140 mM HAuCl4, 25 mM GSH, and 15 mM His, respectively; in step (2), the rapid cooling rate is 1.5 °C / s, cooling to 66 °C; in step (3), the incubation temperature is 66 °C, the incubation time is 0.5 h, the rapid cooling rate is 1.5 °C / s, cooling to 38 °C, the secondary incubation time is 4 h, and the standing time is 10 h.

[0074] Example 3

[0075] In Example 3 of this invention, a nucleic acid nano-hybrid material was prepared using the method of Example 1. The difference between Example 3 and Example 1 is that the final concentrations of HAuCl4, GSH, and His in step (1) of Example 3 are 145 mM HAuCl4, 20 mM GSH, and 10 mM His, respectively.

[0076] Comparative Example 1

[0077] Comparative Example 1 of this invention prepared a nanomaterial AuDH HPs-Apt without AS1411 modification. The preparation method was the same as that of AuDH HPs, but the DNA sequence was slightly different. The difference was that the AS1411 sequence portion of the X1, X3, and Y1 sequences was removed, while the other sequences were the same.

[0078] Comparative Example 2

[0079] Comparative Example 2 of this invention prepared an AuDH HPs-pH, which differs from Example 1 in that...

[0080] The AuDH HPs-pH material does not respond to pH; the corresponding sequence is:

[0081] X1-SEQ ID NO.11:

[0082] GGTGGTGGTGGTTGTGGTGGTGGTGGTGG GGGGGT CACTGCATACCGGCTGCTCAGAACTACAT ACCCCC TTT T TTTTTTTG;

[0083] The underlined sequence is a cytosine-rich i-motif.

[0084] X2-SEQ ID NO.12:

[0085] A*AA*A*AA*AA*AA*ATTGGGGGTATGTATGTTCTGAGCTCGGACTCGCAAACGACCCCCTTTTTTTTTTTG;

[0086] X3-SEQ ID NO.13:

[0087] GGTGGTGGTGGTTGTGGTGGTGGTGGGGGGGTCGTTTGCGAGTCC GTCGTGTAAATGATGCGACCCCCTTTTTTTTTTTG;

[0088] X4-SEQ ID NO.14:

[0089] A*AA*A*AA*AA*AA*ATTGGGGGTCGCATCATTTACACGTGCCGGTATGCAGTGACCCCCTTTTTTTTTTTG;

[0090] Y-DNA translated (3-dimensional) in:

[0091] Y1-SEQ ID NO.15:

[0092] GGTGGTGGTGGTTGTGGTGGTGGTGGGGGGGTGCTGTCCTAACCATGACCGTCGACCCCCTTTTTTTTTTTG;

[0093] Y2-SEQ ID NO.16:

[0094] A*AA*A*AA*AA*AA*ATTGGGGGTCGACGGTCATGTACTAGATCA GACCCCCTTTTTTTTTTTG;

[0095] Y3-SEQ ID NO.17:

[0096] A*AA*A*AA*AA*AA*ATTGGGGGTCTGATCTAGTAGTTAGGACAG CACCCCCTTTTTTTTTTTG;

[0097] Linker:

[0098] Linker1-SEQ ID NO.18:

[0099] GTCCCGCCTGTGACATGCATTCAAAAAAAAAA;

[0100] Linker2-SEQ ID NO.19:

[0101] AATGCATGTCACAGGCGGGACCAAAAAAAAAAT.

[0102] Experimental Example 1

[0103] Experimental Example 1 of this invention tested the ability of AuDH HPs prepared in Example 1 to generate ·OH. The specific steps are as follows:

[0104] (1) Fenton catalytic performance test:

[0105] The AuDH HPs prepared in Example 1 were mixed with different concentrations of GSH and reacted for 30 min. Then, 3 mM glucose solution and TMB were added. After a few minutes, the oxidation of TMB induced by ·OH was measured by UV-Vis spectroscopy. To further determine the formation of ·OH, a mixed solution of glucose (1 mM), terephthalic acid (TA, 5 mM), and AuDH HP-GSH was prepared. After a few minutes, the fluorescence intensity of the solution was detected.

[0106] The formation of ·OH was detected using the TMB method, and the results are as follows: Figure 4 As shown.

[0107] TMB turns blue-green after being oxidized by ·OH, with maximum absorbance at 652 nm. Figure 4 It can be seen that when glucose is absent from the solution, the absorbance of TMB does not change significantly, indicating that glucose is a necessary condition for the formation of ·OH. When glucose is present in the solution but GSH is absent, TMB has a weak absorbance, indicating that the lack of Fe... 2+ Fenton's reagent is used, therefore no ·OH is generated. However, when the GSH concentration increases from 0 to 10 mM, the absorbance increases. This is because GSH has an effect on the hemin (Fe) in AuDH HPs. 3+ It has reducing power and triggers the Fenton reagent Fe 2+ The formation of TMB. However, when the GSH concentration was further increased to 20 mM, the absorbance of TMB decreased significantly due to the scavenging effect of excess GSH on ·OH.

[0108] (2) The test was performed using a TA probe (manufacturer Alfa), and the results are as follows: Figure 4 As shown in C.

[0109] Figure 4 As shown in Figure C, under a certain glucose concentration, GSH-treated AuDH HPs exhibit significant fluorescence enhancement, further confirming that AuDH HPs can effectively undergo the Fenton reaction.

[0110] Further electron spin resonance (ESR) spectroscopy was performed, and the results are as follows: Figure 4 As shown in D.

[0111] Figure 4 The results showed that using 5,5-dimethyl-1-pyrrolidone-n-oxide (DMPO) as the ·OH scavenger, a typical 1:2:2:1 peak intensity was observed, which increased with increasing glucose concentration, indicating the formation of ·OH. Next, the relationship between the ·OH formation rate and H₂O₂ concentration was analyzed using typical Michaelis-Menten kinetics, yielding the Michaelis-Menten constant (K0). M ) and maximum speed (V max The values ​​were 21.61 mM and 2.52 × 10⁻⁶ mM, respectively. -7 M / s( Figure 4 (E, F). Then, the relationship between the ·OH formation rate and glucose concentration was studied using Michaelis Menten kinetics ( Figure 4 (G, H), and calculated K. M and V max The values ​​were 11.69 mM and 2.29 × 10⁻⁶, respectively. -7 M / s. The results show that AuDH HPs have similar glucose affinity to the natural enzyme. Combined with Michaelis Menten kinetic results, the AuDH HPs nanomaterial significantly improves Fenton activity compared to currently reported materials.

[0112] Experimental Example 2

[0113] Experimental Example 2 of this invention tested the in vitro therapeutic effect of the AuDH HPs prepared in Example 1. The specific steps are as follows:

[0114] (1) Under acidic (pH 6.5) pathological conditions, AuDH HPs were co-incubated with HeLa cells. CLSM analysis showed that HeLa cells co-incubated with AS1411-modified AuDH HPs exhibited significantly higher fluorescence intensity than those without aptamer modification (AuDH HPs-Apt). Figure 5 (A). This is because AuDH HPs have high tumor permeability in response to acidic pH.

[0115] (2) Dissolve agarose in serum-free DMEM medium (1.5%, w / v), heat at 100℃ for 3 min, and then spread it onto a sterile 96-well plate. Next, add HeLa cells to each well (1000 cells / well) and culture in a humid environment at 37℃ and 5% CO2 for 10 days to form HeLa-MCTs. Replace the medium with fresh DMEM every 2 days during the culture process.

[0116] (3) Using AuDH HPs-pH as a control, the penetration ability of the nanomaterials was verified. AuDH HPs-pH treated with pH=6.5 medium was incubated with HeLa-MCSs for 4 h. Then, the medium was removed and the spheres were washed three times with PBS. Finally, the treated MCSs were imaged using CLSM.

[0117] like Figure 5 As shown in Figure B, AuDH HPs-pH does not disintegrate and has low penetration ability, while AuDH HPs disintegrate to generate smaller X / Y-DNA monomers with strong penetration ability. The results indicate that AuDH HPs materials can effectively deliver drugs to the core of the tumor after responding to pH in the tumor microenvironment.

[0118] Then, 2,7-dichlorodihydrofluorescein diacetate (DCFH-DA) was used as a ROS probe to detect the CDT effect of AuDH HPs. DCFH-DA is a non-fluorescent molecule that can be oxidized by ROS to generate 2,7-dichlorofluorescein (DCF), which has green fluorescence. Figure 5 As shown in Figure C, the cells treated with the control group showed no green fluorescence signal, while the fluorescence signal increased to some extent after treatment with AuDH HPs. Ultimately, the cells treated with AuDH HPs exhibited a bright green fluorescence signal, indicating that the material underwent an enzymatic / Fenton cascade catalytic reaction in the tumor cells, significantly increasing the generation of ·OH.

[0119] The MTT assay was used to verify the cytotoxicity of the material. Figure 5 As shown in Figure D, DNAHPs (excluding AuCNs and Hemin) exhibit excellent biocompatibility with cells. With increasing concentrations of AuD HPs or AuDH HPs, cell viability decreases, further demonstrating that AuCNs-induced glucose oxidation cuts off energy supply, starving cancer cells and synergistically killing tumor cells with continuously generated ·OH.

[0120] The therapeutic effect of AuDH HPs was further evaluated using cell live / dead staining. Cells were treated with different materials and then stained with Calcein AM / PI; live cells appeared green, and dead cells appeared red. Figure 5 As shown in Figure E, untreated cells grow well, AuD HPs treatment causes some damage to the cells, and most cells die after AuDH HPs treatment.

[0121] Mitochondrial dysfunction can also reflect cell apoptosis. This invention utilizes JC-1 staining to detect damage to the mitochondrial membrane caused by materials. Figure 5As shown in Figure F, the control group cells exhibited strong red fluorescence, indicating good mitochondrial condition; the AuDH HPs-treated cells showed some green fluorescence, indicating changes in mitochondrial membrane potential. When AuDH HPs were treated, the increased intracellular ROS significantly increased mitochondrial damage, resulting in a marked increase in the intensity of green fluorescence.

[0122] The apoptosis of HeLa cells after material treatment was verified using annexin V-FITC / PI double staining. Flow cytometry was used to detect (…). Figure 5 The results (G) showed that AuDH HPs had a significant killing effect on tumor cells, consistent with the detection results of AM / PI and JC-1. Therefore, based on its good targeting, deep penetration and enzyme-like activity, AuDH HP can be used as a nanotherapy agent to achieve synergistic tumor treatment.

[0123] Experimental Example 3

[0124] Experimental Example 3 of this invention tested the in vivo synergistic antitumor therapeutic effect of AuDH HPs prepared in Example 1. The specific steps are as follows:

[0125] (1) Tumor Targeting Effect Detection: HeLa cells were subcutaneously injected into male BALB / c nude mice to establish a tumor-bearing mouse model. Unmodified ControlAuDH HPs and AuDH HPs were injected via the tail vein at a dose of 30 nmol / kg. After 8 hours, the distribution of the materials in vivo was analyzed using tumor imaging technology. The results are as follows: Figure 6 As shown.

[0126] like Figure 6 As shown in Figure A, AuDH HPs exhibited a stronger fluorescence signal in the tumor region, indicating that the material has good targeting ability. Then, 24 hours after injection, the mice were euthanized, and their major organs and tumors were harvested for quantitative analysis using an IVIS spectral system. The distribution results obtained were consistent with in vivo imaging. Figure 6 (B, C, D)

[0127] (2) Synergistic therapeutic effect of AuDH HPs on HeLa tumor-bearing mice:

[0128] When the tumor volume in mice reaches 100-120 mm 3 Subsequently, nude mice were randomly divided into three groups, and administered PBS, AuD HPs, or AuDH HPs via tail vein, respectively, at a dose of 1.5 mg / kg. Results are as follows: Figure 7 As shown.

[0129] like Figure 7As shown in Figure A, after intravenous administration, compared with the control group PBS and AuDH HPs, tumor growth was significantly inhibited under the action of AuDH HPs. Figure 7 Figure B shows the changes in tumor size during administration, further indicating that AuDHHPs have a good synergistic antitumor effect. Furthermore, the mouse body weight changed very little during intravenous administration. Figure 7 The presence of C indicates that AuDH HPs did not produce adverse reactions in vivo.

[0130] After treatment, all mice were euthanized, and tumors and major organs (heart, liver, spleen, lungs, and kidneys) were dissected for H&E staining. Figure 7 As can be seen from Figure D, compared with the other two groups, mouse tumor sections stained with H&E showed higher levels of apoptosis and necrosis after treatment with AuDH HPs. However, no obvious damage or inflammation was observed in the H&E-stained images of major organs, indicating that AuDH HPs have good tissue compatibility and biosafety.

[0131] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A nucleic acid nanohybrid material, characterized in that, The concentrations of each raw material in the preparation process of the nucleic acid nano-hybrid material are as follows: HAuCl4:GSH:His:DNA:Linker:X-DNA monomer complementary strand:Y-DNA monomer complementary strand:hemin=140~145:20~25:10~15:0.645:1.127:0.161:0.242:0.403; The DNA sequence comprises two single-stranded X-DNA monomers, X2 and X4, and two single-stranded Y-DNA monomers, Y2 and Y3; the complementary strands of the X-DNA monomers comprise single-stranded X1 and X3; the complementary strand of the Y-DNA monomer is Y1, and the sequences of X1~X4 and Y1~Y3 are as follows: X1-SEQ ID NO.1: GGTGGTGGTGGTTGTGGTGGTGGTGGGGGGGTCACTGCATACCGGCTGTCAGAACATACATACCCCCTTTTCCCCCTTG; X2-SEQ ID NO.2: A*AA*A*AA*AA*AA*ATTGGGGGTATGTATGTTCTGAGCTCGGACTCGCAAACGACCCCCTTTTCCCCCTTG; X3-SEQ ID NO.3: GGTGGTGGTGGTTGTGGTGGTGGTGGGGGGGTCGTTTGCGAGTCCGTCGTGTAAATGATGCGACCCCCTTTTCCCCCCTG; X4-SEQ ID NO.4: A*AA*A*AA*AA*AA*ATTGGGGGTCGCATCATTTACACGTGCCGGTATGCAGTGACCCCCTTTTCCCCCTTG; Y1-SEQ ID NO.5: GGTGGTGGTGGTTGTGGTGGTGGTGGGGGGGTGCTGTCCTAACCATGACCGTCGACCCCCTTTTCCCCCCTG; Y2-SEQ ID NO.6: A*AA*A*AA*AA*AA*ATTGGGGGTCGACGGTCATGTACTAGATCAGACCCCCTTTTCCCCCTTG; Y3-SEQ ID NO.7: A*AA*A*AA*AA*AA*ATTGGGGGTCTGATCTAGTAGTTAGGACAGCACCCCCTTTTCCCCCTTG; The bases marked with * above are thiophosphorylated bases; The Linker sequence is as follows: Linker1-SEQ ID NO.8: GTCCCGCCTGTGACATGCATTCAAGGGGGAAAT; Linker2-SEQ ID NO.9: AATGCATGTCACAGGCGGGACCAAGGGGAAAT; The preparation method of the nucleic acid nanohybrid material includes the following steps: (1) Dissolve HAuCl4, GSH and His in ultrapure water, heat and stir to obtain a colorless GSH / His-Au aqueous solution; add NaOH solution to the GSH / His-Au aqueous solution, adjust the pH and then add DNA, continue stirring to obtain reaction solution A; (2) Preparation of X-monomer hybrid DNA nanonuclei: Add the complementary strand of X-DNA monomer and the linker strand to reaction solution A, incubate, and cool rapidly to form X-monomer hybrid DNA nanonuclei; (3) Preparation of nucleic acid nano-hybrid materials: The complementary strand of Y-DNA monomers is added to the DNA nanonucleus solution of X monomer hybridization, incubated, rapidly cooled, and incubated a second time to allow the Y-DNA monomers to further attach to the X-DNA nanonucleus to form Au-DNAHPs. Finally, hemin is added and left to stand to form nucleic acid nano-hybrid materials.

2. The nucleic acid nanohybrid material according to claim 1, characterized in that, The AS1411 aptamer in the sequence forms a G-quadruplex structure, the sequence of which is as follows: SEQ ID NO.10: GGTGGTGGTGGTTGTGGTGGTGGTGG; The cytosine-rich i-motifs in the sequence form a triplet structure.

3. A method for preparing the nucleic acid nanohybrid material according to any one of claims 1 to 2, characterized in that, Includes the following steps: (1) Dissolve HAuCl4, GSH and His in ultrapure water, heat and stir to obtain a colorless GSH / His-Au aqueous solution; add NaOH solution to the GSH / His-Au aqueous solution, adjust the pH and then add DNA, continue stirring to obtain reaction solution A; (2) Preparation of X-monomer hybrid DNA nanonuclei: Add the complementary strand of X-DNA monomer and the linker strand to reaction solution A, incubate, and cool rapidly to form X-monomer hybrid DNA nanonuclei; (3) Preparation of nucleic acid nano-hybrid materials: The complementary strand of Y-DNA monomers is added to the DNA nanonucleus solution of X monomer hybridization, incubated, rapidly cooled, and incubated a second time to allow the Y-DNA monomers to further attach to the X-DNA nanonucleus to form Au-DNAHPs. Finally, hemin is added and left to stand to form nucleic acid nano-hybrid materials.

4. The method for preparing the nucleic acid nanohybrid material according to claim 3, characterized in that, In step (1), the heating and stirring temperature is 95°C and the heating and stirring time is 2-5 min.

5. The method for preparing the nucleic acid nanohybrid material according to claim 3, characterized in that, In step (1), the pH is 8-9; the stirring time is 2-3 hours and the temperature is 95°C.

6. The method for preparing the nucleic acid nanohybrid material according to claim 3, characterized in that, In step (2), the incubation temperature is 95°C, the incubation time is 15 min, the rapid cooling rate is 1~1.5°C / s, and the temperature is cooled to 64~66°C.

7. The method for preparing the nucleic acid nanohybrid material according to claim 3, characterized in that, In step (3), the incubation temperature is 64~66℃, the incubation time is 0.5~1.5h, the rapid cooling rate is 1~1.5℃ / s, cooling to 35~38℃, the secondary incubation time is 2~4h, and the resting time is 6~12h.

8. The application of a nucleic acid nanohybrid material prepared by the method of any one of claims 3 to 7 in the preparation of a drug for treating cervical cancer.

Citation Information

Patent Citations

  • Photo-crosslinked nucleic acid hydrogels

    CN102171234A

  • Glutathione-responsive nanoprobe for tumor imaging and targeted collaborative treatment and construction method of glutathione-responsive nanoprobe

    CN113372904A