Saccharomyces cerevisiae strain for efficiently synthesizing cordycepin, construction method and application thereof

Abstract

The present application relates to a kind of high-efficiency synthesis of cordycepin saccharomyces cerevisiae strain and its construction method and application, belong to the field of microbial genetic engineering technology.The construction method involved in the present application includes: the heterologous codon-optimized 2'-carbonyl-3'-deoxyadenosine reductase gene and 3'-adenosine monophosphate phosphohydrolase gene are expressed by multiple copy genome integration, increase the dose of key enzyme;And the defect gene of engineering strain is back-supplemented, and the saccharomyces cerevisiae strain B5U3 of high-yield cordycepin is obtained.The high-efficiency synthesis of cordycepin saccharomyces cerevisiae strain obtained in the present application, after shake flask fermentation, cordycepin yield reaches 2.92g / L, and after fermentation tank fermentation, the yield of cordycepin reaches 7.5g / L, which lays a foundation for more safe and reliable industrial production of cordycepin.

Description

Technical Field

[0001] This invention relates to a high-cordycepin-producing Saccharomyces cerevisiae strain, its construction method, and its application, belonging to the field of microbial genetic engineering technology. Background Technology

[0002] Cordycepin is a nucleoside compound with broad biological activity, exhibiting various pharmacological effects such as antitumor, antiviral, and immunomodulatory properties. In recent years, the demand for cordycepin in pharmaceuticals, health products, and food additives has been continuously increasing. However, the natural sources of cordycepin are limited, mainly relying on extraction from natural fungi such as Cordyceps sinensis. This extraction process is costly and yields low, making it difficult to meet market demand. In recent years, with the development of synthetic biology and metabolic engineering, the biosynthesis of cordycepin using microorganisms has become a research hotspot. Specifically, in *Yarrowia lipolytica*, a yield of 4.36 g / L was achieved through metabolic engineering modifications (such as optimizing the glycolysis and pentose phosphate pathways) and culture medium optimization. In *Pichia pastoris*, a record high of 19.5 g / L was achieved in a 10L tank by enhancing methanol metabolism and cofactor balance. *Saccharomyces cerevisiae*, as a recognized safe microorganism (GRAS status), has a longer history of application and more reliable safety in food and pharmaceutical production, making it a more ideal substrate cell for cordycepin biosynthesis. However, the current yield of cordycepin synthesized in Saccharomyces cerevisiae remains low. Therefore, the production of cordycepin in Saccharomyces cerevisiae is of great significance. Summary of the Invention

[0003] Purpose of the invention: The technical problem to be solved by the present invention is to provide a high cordycepin-producing yeast strain, its construction method and application, in order to address the shortcomings of the prior art.

[0004] To address the aforementioned technical problems, this invention discloses a high-cordycepin-producing *Saccharomyces cerevisiae* strain, its construction method, and its applications. The specific technical solution is as follows:

[0005] A highly efficient Saccharomyces cerevisiae strain for synthesizing cordycepin, wherein the genome of the Saccharomyces cerevisiae strain integrates and expresses multiple copies of cordycepin synthesis-related enzyme genes.

[0006] The cordycepin synthesis-related enzyme genes include the 2'-carbonyl-3'-deoxyadenosine reductase gene and the 3'-adenosine monophosphate phosphate hydrolase gene; the multicopy integration site has an integration region length ≥1kb from the nearest essential gene. Preferably, the integration site includes any one or more combinations of the following genomes from *Saccharomyces cerevisiae*: 1622b, 416d, 911b, 208a, 308a, 1309a, YPRCδ15c, 1021b, 1014a, HIS3b, YOLCd1b, SAP155b, CAN1y, SAP155c, 1114a, 720a, 1414a, 511b, X-2, X-3, XI-2, XI-3, XII-1, and XII-5. Preferably, any one or more combinations of 1622b, 416d, 911b, 208a, 308a, 1309a, 720a, 1414a, and 511b are preferred. More preferably, a combination of 1622b, 416d, 911b, 208a, and 308a is preferred.

[0007] The number of copies is 2-30. Preferably, it is 3-15 copies, and more preferably, it is 5 copies.

[0008] The 2'-carbonyl-3'-deoxyadenosine reductase and 3'-adenosine monophosphate phosphate hydrolase are derived from any one of Aspergillus hiratsukae, Penicillium fimorum, Aspergillus terricola var. indicus, Aspergillus similis, Aspergillus varians, Aspergillus nidulans, Aspergillus stetrazonus, Aspergillus nidulans var. acristatus, Emericellopsis atlantica, and Cordyceps militaris, preferably both 2'-carbonyl-3'-deoxyadenosine reductase and 3'-adenosine monophosphate phosphate hydrolase are derived from Cordyceps militaris, with NCBI accession numbers XP_006669647 and XP_006669648, respectively. More preferably, the nucleotide sequences of the 2'-carbonyl-3'-deoxyadenosine reduction gene and the 3'-adenosine monophosphate phosphate hydrolase gene are shown in SEQ ID No. 1 to 2, respectively.

[0009] The 2'-carbonyl-3'-deoxyadenosine reductase gene and the 3'-adenosine monophosphate phosphate hydrolase gene are both driven by any one of the promoters PGK1, TEF1, GPD, TPI1, ADH1, TDH3, CYC1, HXT1, GAL1, GAL7, GAL10, CUP1, or MET25. Preferably, any one of TPI1, TDH3, and TEF1 is used; more preferably, the 2'-carbonyl-3'-deoxyadenosine reductase gene is driven by the promoter TPI1, and the 3'-adenosine monophosphate phosphate hydrolase gene is driven by TEF1.

[0010] The starting strain is any one of Saccharomyces cerevisiae BY4742, BY4741, W303-1A, or CEN.PK2-1C. Preferably, the starting strain is Saccharomyces cerevisiae BY4742 or BY4741, and more preferably, the starting strain is Saccharomyces cerevisiae BY4742.

[0011] The genome of the *Saccharomyces cerevisiae* strain integrates and expresses any one or a combination of several of the following genes: orotidine-5'-phosphate decarboxylase (URA3), imidazole glycerol phosphate dehydrogenase (HIS3), 3-isopropylmalate dehydrogenase (LEU2), and L-aminoadipate-semialdehyde dehydrogenase (LYS2); the NCBI accession numbers for orotidine-5'-phosphate decarboxylase, imidazole glycerol phosphate dehydrogenase, 3-isopropylmalate dehydrogenase, and L-aminoadipate-semialdehyde dehydrogenase are NP_010893.3, NP_014845.1, NP_009911.2, and NP_009673.1, respectively. Preferably, the integration sites of orotidine-5'-phosphate decarboxylase, imidazole glycerol phosphate dehydrogenase, 3-isopropylmalate dehydrogenase and L-aminoadipic acid-semialdehyde dehydrogenase include, but are not limited to, 1622b, 416d, 911b, 208a, 308a, 1309a, YPRCδ15c, 1021b, 1014a, HIS3b, YOLCd1b, SAP155b, CAN1y, SAP155c, 1114a, 720a, 1414a, 511b, X-2, X-3, XI-2, XI-3, XII-1 and XII-5. More preferably, the genome of the *Saccharomyces cerevisiae* strain integrates and expresses the genes of orotidine-5'-phosphate decarboxylase (URA3), imidazole glycerol phosphate dehydrogenase (HIS3), 3-isopropylmalate dehydrogenase (LEU2), and L-aminoadipic acid-semialdehyde dehydrogenase (LYS2).

[0012] In a second aspect, the present invention provides a method for constructing a highly efficient Saccharomyces cerevisiae strain for synthesizing cordycepin as described in the first aspect, comprising the following steps:

[0013] (1) Amplify the gene expression cassette of cordycepin synthesis-related enzymes; the gene expression cassette of cordycepin synthesis-related enzymes includes the gene expression cassette of 2'-carbonyl-3'-deoxyadenosine reductase and the gene expression cassette of 3'-adenosine monophosphate phosphate hydrolase.

[0014] (2) Using CRISPR / Cas9 technology, the cordycepin synthesis-related enzyme gene expression cassette described in step (1) is integrated into one or more integration sites in the genome of the starting strain of *Saccharomyces cerevisiae* for multi-copy expression, thereby obtaining a *Saccharomyces cerevisiae* strain that efficiently synthesizes cordycepin. Preferably, the multi-copy expression can be achieved in one or more rounds.

[0015] In step (1), the 2'-carbonyl-3'-deoxyadenosine reductase gene expression cassette includes a promoter, a 2'-carbonyl-3'-deoxyadenosine reductase gene, and a terminator, and the 3'-adenosine monophosphate phosphate hydrolase gene expression cassette includes a promoter, a 3'-adenosine monophosphate phosphate hydrolase gene, and a terminator.

[0016] More preferably, the construction method further includes step (3), wherein step (3) is to amplify the auxotrophic gene expression cassette and integrate it into the genome of the Saccharomyces cerevisiae obtained in step (2) using CRISPR / Cas9 technology; wherein the auxotrophic gene expression cassette includes any one or a combination of several of the URA3 gene expression cassette, HIS3 gene expression cassette, LEU2 gene expression cassette and LYS2 gene expression cassette.

[0017] Thirdly, this invention provides the application of the highly efficient cordycepin-synthesizing Saccharomyces cerevisiae strain described in the first aspect in the production of cordycepin. Specifically, the highly efficient cordycepin-synthesizing Saccharomyces cerevisiae strain is inoculated into a fermentation medium and fermented at 20–40°C for 96–144 hours to obtain cordycepin. The fermentation medium comprises 10–100 g / L of carbon source, 10–50 g / L of nitrogen source, and 0.1–15 g / L of adenine. The preferred carbon source is glucose, and the preferred nitrogen source is yeast extract and / or peptone. Preferably, the fermentation is carried out at 30°C for 144 hours, and the fermentation medium comprises 50 g / L glucose, 10 g / L yeast extract, 20 g / L peptone, and 3 g / L adenine, wherein adenine is a precursor.

[0018] Preferably, the method for synthesizing cordycepin is as follows: The highly efficient cordycepin-synthesizing yeast strain is activated and cultured, then inoculated into a 5L fermenter containing fermentation medium. The fermenter parameters are controlled as follows: temperature 28–30℃, stirring speed 400–600 rpm, aeration rate 6, liquid volume 2L, pH 5.5 ± 0.1, and dissolved oxygen maintained at approximately 30%. After 13 hours of fermentation, feed is added, during which the glucose concentration in the fermenter is controlled below 1.0 g / L, and fermentation continues for 144 hours. More preferably, the feed medium used is 400 g / L glucose.

[0019] Beneficial effects:

[0020] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0021] (1) By integrating multiple copies of the gene related to the synthesis of cordycepin, the expression level of key enzymes was improved, and the ability of cordycepin synthesis was enhanced. The cordycepin production of the engineered strain with multi-copy integration reached 0.93 g / L.

[0022] (2) Genome integration expression of any one or more of oroside-5'-phosphate decarboxylase (URA3), imidazole glycerol phosphate dehydrogenase (HIS3), 3-isopropylmalate dehydrogenase (LEU2) and L-aminoadipic acid-semialdehyde dehydrogenase (LYS2) improved the growth performance of the strain and increased the yield of cordycepin. The yield of cordycepin in shake flask reached 2.92 g / L and the yield of cordycepin in fermenter reached 7.5 g / L. Attached Figure Description

[0023] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.

[0024] Figure 1 The image shows the pCas9-Hyg plasmid pattern from Example 1.

[0025] Figure 2 This is the cns expression box in Example 2.

[0026] Figure 3 The figure represents the cordycepin yield of different chassis brewer's yeast strains in Example 2, where COR represents cordycepin.

[0027] Figure 4 The image shows the liquid chromatogram of the cordycepin standard in Example 2.

[0028] Figure 5 The image shows the liquid chromatogram of the recombinant bacteria B1 sample from Example 2.

[0029] Figure 6This is the standard quality spectrum of cordycepin in Example 2.

[0030] Figure 7 This is the mass spectrum of the recombinant strain B1 sample from Example 2.

[0031] Figure 8 OD of the 1-15 copy recombinant strain constructed in this invention 600 And cordycepin production.

[0032] Figure 9 Cordycepin yield at different integration sites in Example 4.

[0033] Figure 10 This is a schematic diagram of the integration site of the multi-copy strain B6 in Example 6.

[0034] Figure 11 This is a schematic diagram of the integration site of the multi-copy strain B11 in Example 7.

[0035] Figure 12 Cordycepin yield optimized for glucose concentration in Example 8.

[0036] Figure 13 Cordycepin yield optimized for adenine concentration in Example 9.

[0037] Figure 14 The OD values ​​of recombinant strains B5U, B5U1, B5U2, and B5U3 in Example 10 are... 600 And cordycepin production.

[0038] Figure 15 The cordycepin yield after fed-batch fermentation of recombinant strain B5U3 in a 5L fermenter, as described in Example 12. Detailed Implementation

[0039] The present invention can be better understood from the following embodiments. However, those skilled in the art will readily understand that the descriptions in the embodiments are for illustrative purposes only and should not, and will not, limit the invention as detailed in the claims.

[0040] Example 1: Construction of CRISPR / Cas9 tool plasmids

[0041] The plasmid pCas9-Hyg was used as a template [kindly provided by Professor Yang Sheng of the Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences], see [link / reference]. Figure 1 The vector was digested with the restriction endonuclease BsaI, reacted at 37°C for 2 h, and then subjected to agarose gel electrophoresis. After gel excision, the pCas9-Hyg linear vector was purified and recovered using a recovery kit.

[0042] The following genomic sites that do not affect the growth of the *Saccharomyces cerevisiae* strain were selected: 1622b, 416d, 911b, 208a, 308a, 1309a, XI-3, and XII-1. Their N20 sequences correspond to the following: GTCACGTTCCTGAGGTTACT; TAGTGCACTTACCCCACGTT; GTAATATTGTCTTGTTTCCC; GTCCGCTAAACAAAAGATCT; CACTTGTCAAACAGAATATA; CCTGTGGTGACTACGTATCC; GATATGTCTCTAATTTTGGA; GTGGAGCAAATAATGAGCAC. The N20 primers were designed as follows: 1622b-F / 1622b-R, 416d-F / 416d-R, 911b-F / 911b-R, 208a-F / 208a-R, 308a-F / 308a-R, 1309a-F / 1309a-R, XI-3-F / XI-3-R, and XII-1-F / XII-1-R. The primer sequences are shown in Table 1. Annealing amplification was performed using the corresponding primers as templates. The system composition was: F 1 μL, R 1 μL, 1 10×Ligase Buffer 1 μL, ddH2O 7 μL. The PCR program was 94℃ for 5 min.

[0043] After annealing and amplification, the system was diluted 10-fold to obtain the N20 fragment. The N20 fragment was then ligated overnight with the linear vector fragment pCas9-Hyg using Novizan's T4 ligase. The ligation product was heat-shocked into competent Trans1T1 cells, cultured overnight, and transformants were selected for sequencing. The resulting plasmids were pCas9-Hyg-1622b, pCas9-Hyg-416d, pCas9-Hyg-911b, pCas9-Hyg-208a, pCas9-Hyg-308a, pCas9-Hyg-1309a, pCas9-Hyg-XI-3, and pCas9-Hyg-XII-1.

[0044] Example 2 Construction and fermentation of single-copy strains

[0045] Design and synthesize CNS expression cassettes for cordycepin synthesis-related enzyme genes. The CNS expression cassettes include a 2'-carbonyl-3'-deoxyadenosine reductase CNS1 gene expression cassette and a 3'-adenosine monophosphate phosphate hydrolase CNS2 gene expression cassette. The CNS1 gene was obtained by codon optimization of the amino acid sequence shown in XP_006669647 from *Saccharomyces cerevisiae*, and its nucleotide sequence is shown in SEQ ID No. 1. The CNS2 gene was obtained by codon optimization of the amino acid sequence shown in XP_006669648 from *Saccharomyces cerevisiae*, and its nucleotide sequence is shown in SEQ ID No. 2. The CNS expression cassettes, as shown in... Figure 2 As shown, the expression cassette consists of a cns1 expression cassette and a cns2 expression cassette connected back-to-back. The cns1 expression cassette comprises the promoter TPI1, cns1, and the terminator ADH1t, while the cns2 expression cassette comprises the promoter TEF1, cns2, and the terminator GAL2t. In the back-to-back connection, the 3' end of the TPI1 promoter in the cns1 expression cassette is connected to the cns1 gene, and the 5' end is connected to the 5' end of the TEF1 promoter in the cns2 expression cassette.

[0046] The construction process of the cns expression cassette is as follows: The optimized sequences of cns1 and cns2 are located on the default vector provided by the company. Using the genome of strain BY4742 as a template, TPI1p is amplified using TPI1p-F / TPI1p-R primers. Using the default vector as a template, PCR is performed using primers cns1-F / cns1-R to amplify the optimized sequence of cns1. Using the genome of strain BY4742 as a template, ADH1t is amplified using primers ADH1t-F / ADH1t-R to obtain ADH1t. Then, using primers TPI1p-F / ADH1t-R, the fragment obtained above is used as a template for overlap to obtain the cns1 expression cassette. Using the genome of strain BY4742 as a template, TEF1p was amplified using primers TEF1p-F / TEF1p-R. Using the default vector as a template, PCR was performed using primers cns2-F / cns2-R to amplify the optimized cns2 sequence. Using the genome of strain BY4742 as a template, GAL2t was amplified using primers GAL2t-F / GAL2t-R, and then overlapped using primers TEF1p-F / GAL2t-R as a template to obtain the cns2 expression cassette. Primer sequences are shown in Table 1. The empty vector pG418 (kindly provided by Professor Liu Zihe of Beijing University of Chemical Technology) was digested with restriction endonucleases EcoRI and BamHI. After incubation at 37℃ for 2 hours, the mixture was subjected to agarose gel electrophoresis. The pG418 linear vector was purified using a recovery kit after gel digestion. The pG418 linear vector was ligated to the cns1 expression cassette using a one-step cloning enzyme. The reaction mixture consisted of 4 μL of 5×CE II Buffer, 2 μL of Exnase II, 200 ng of the target fragment, 200 ng of the vector fragment, and ddH2O to 20 μL. The ligated product was heat-shocked into Trans1T1 competent cells, cultured overnight, and transformants were selected for verification and sequencing to obtain the plasmid pG418(cns1). The pG418(cns1) plasmid was digested with restriction endonucleases SaCI and SalI, incubated at 37°C for 2 h, and then subjected to agarose gel electrophoresis. After gel excision, the pG418(cns1) linear vector was purified using a recovery kit. The pG418(cns1) linearized vector was then ligated to the cns2 expression cassette using a one-step cloning enzyme. The ligated product was heat-shocked into Trans1T1 competent cells, cultured overnight, and transformants were selected for verification and sequencing to obtain the plasmid pG418(cns).

[0047] The nucleotide sequences of the promoter TPI1, terminator ADH1t, promoter TEF1, and terminator GAL2t are respectively shown in SEQ ID No. 3 to 6.

[0048] The 1622b site and pCas9-Hyg-1622b plasmid from Example 1 were selected. Using plasmid pG418(cns) as a template, the cns expression cassette was amplified using primers 1622b-cns-F / 1622b-cns-R. Using the genome of strain BY4742 as a template, the upper homologous arm of the 1622b site was amplified using primers 1622b-up-F / 1622b-up-cns-R; using the genome of strain BY4742 as a template, the lower homologous arm of the 1622b site was amplified using primers 1622b-down-cns-F / 1622b-down-R. After amplification, the corresponding gene fragments were purified using a DNA fragment recovery kit. Then, the three fragments were overlapped using primers 1622b-up-F / 1622b-down-R to obtain a cns expression cassette containing homologous fragments from the 1622b site. The primer sequences are shown in Table 1. The gene fragments were amplified by PCR and purified using a DNA fragment recovery kit to obtain the corresponding gene fragments.

[0049] Saccharomyces cerevisiae chassis strains BY4742, BY4741, W303-1A, and CEN.PK2-1 were cultured at 30℃ for 48 hours. Single colonies were picked and activated to prepare competent cells. The pCas9-Hyg-1622b plasmid and a CNS expression cassette containing a homologous fragment at the 1622b site were transformed using electroporation at a mass ratio of 300 ng: 1500 ng. Transformants were screened using YPD solid medium containing 400 mg / L hygromycin (HygR), and the transformants were verified by PCR. The verified strains were inoculated into fermentation medium for fermentation. The cordycepin yield of the four chassis strains was as follows: Figure 3 As shown, the optimal chassis strain was BY4742, which was named B1, with a cordycepin yield of 0.25 g / L. Subsequent experiments used BY4742 as the chassis strain. The fermentation medium consisted of: glucose 20-100 g / L, yeast extract 10 g / L, peptone 20 g / L, and adenine 0.5-5 g / L. Preferably, the mixture contained 50 g / L glucose, 10 g / L yeast extract, 20 g / L peptone, and 3 g / L adenine. The culture was carried out at 28-30℃ and 200-220 rpm for 144 h, preferably at 30℃ and 220 rpm.

[0050] The production status of cordycepin was detected using high-performance liquid chromatography (HPLC). The method for analyzing cordycepin was as follows: Cordycepin in the fermentation broth supernatant was separated and quantitatively determined using an Agilent 1260 Infinity II HPLC system equipped with a UV detector (VWD). The chromatographic column was a ZORBAX SB-Aq, the mobile phase was 2% acetonitrile and 98% 0.3‰ trifluoroacetic acid, the flow rate was 0.8 mL / min, the column temperature was set to 40℃, and the absorbance was 260 nm. The sample was centrifuged at 13000 rpm for 5 min, and the supernatant was filtered through a 0.22 μm membrane to remove impurities before analysis.

[0051] The chromatogram of cordycepin standard is shown below. Figure 4 As shown, the chromatogram of the fermentation sample of recombinant strain B1 is as follows. Figure 5 As shown. Qualitative analysis was also performed simultaneously using LC-MS. The mass spectra of the standard and the fermentation sample of recombinant strain B1 are shown below. Figure 6 and Figure 7 As shown.

[0052] Example 3 Construction and fermentation of 2-5 copy strains

[0053] Based on recombinant strain B1 from Example 2, CNS expression frames were sequentially superimposed at sites 416d, 911b, 208a, and 308a to obtain recombinant strains B2, B3, B4, and B5, as follows:

[0054] Using plasmid pG418(cns) as a template, the CNS expression cassette was amplified using primers 416d-cns-F / 416d-cns-R. Using the genome of strain BY4742 as a template, the upper homologous arm of the 416d site was amplified using primers 416d-up-F / 416d-up-cns-R; using the genome of strain BY4742 as a template, the lower homologous arm of the 416d site was amplified using primers 416d-down-cns-F / 416d-down-R. After amplification, the corresponding gene fragments were purified using a DNA fragment recovery kit. The three fragments were then overlapped using primers 416d-up-F / 416d-down-R to obtain the CNS expression cassette containing the homologous fragment of the 416d site.

[0055] Using plasmid pG418(cns) as a template, the CNS expression cassette was amplified using primers 911b-cns-F / 911b-cns-R. Using the genome of strain BY4742 as a template, the upper homologous arm of the 911b site was amplified using primers 911b-up-F / 911b-up-cns-R; and using the genome of strain BY4742 as a template, the lower homologous arm of the 911b site was amplified using primers 911b-down-cns-F / 911b-down-R. After amplification, the corresponding gene fragments were purified using a DNA fragment recovery kit. The three fragments were then overlapped using primers 911b-up-F / 911b-down-R to obtain a CNS expression cassette including homologous fragments from the 911b site.

[0056] Using plasmid pG418(cns) as a template, the CNS expression cassette was amplified using primers 208a-cns-F / 208a-cns-R. Using the genome of strain BY4742 as a template, the upper homologous arm of the 208a locus was amplified using primers 208a-up-F / 208a-up-cns-R; and using the genome of strain BY4742 as a template, the lower homologous arm of the 208a locus was amplified using primers 208a-down-cns-F / 208a-down-R. After amplification, the corresponding gene fragments were purified using a DNA fragment recovery kit. The three fragments were then overlapped using primers 208a-up-F / 208a-down-R to obtain a CNS expression cassette including the homologous fragment at the 208a locus.

[0057] Using plasmid pG418(cns) as a template, the CNS expression cassette was amplified using primers 308a-cns-F / 308a-cns-R. Using the genome of strain BY4742 as a template, the upper homologous arm of the 308a site was amplified using primers 308a-up-F / 308a-up-cns-R; using the genome of strain BY4742 as a template, the lower homologous arm of the 308a site was amplified using primers 308a-down-cns-F / 308a-down-R. After amplification, the corresponding gene fragments were purified using a DNA fragment recovery kit. The three fragments were then overlapped using primers 308a-up-F / 308a-down-R to obtain a CNS expression cassette including the homologous fragment at the 308a site.

[0058] After 3-4 passages, strain B1 from Example 2 was plated. Spotting was performed simultaneously on YPD plates containing 400 mg / L hygromycin (HygR) and on antibiotic-free YPD plates. No single colonies grew on the antibiotic-containing plate, while single colonies grew on the antibiotic-free plate, indicating that the CRISPR / Cas9 tool plasmid had been lost. The corresponding single colonies were activated and integrated into the CNS expression frame to the 416d site according to the method described in Example 2, yielding recombinant strain B2. Subsequently, recombinant strains B3, B4, and B5 were obtained sequentially. Using the same fermentation and detection methods as in Example 2, the cordycepin yields of recombinant strains B2, B3, B4, and B5 were 0.47 g / L, 0.68 g / L, 0.86 g / L, and 0.93 g / L, respectively (results are shown in Figure 2). Figure 8 (As shown).

[0059] Example 4: Effect of different integration sites on cordycepin production

[0060] In addition to conducting Example 3, the effects of different integration sites on cordycepin were also verified. Five sites with high integration and expression efficiencies were selected for verification: 1622b, 416d, 911b, 208a, 308a, and 106a. The results are as follows: Figure 9 As shown.

[0061] The single-copy strains were integrated into these 6 sites respectively, and the results showed that the integration into site 1622b yielded the best results. Among them, the single-copy strains were transformed multiple times at site 106a, but no transformants were produced. This may be because the length of the CDC19 spacer region (806bp) at site 106a is less than 1000bp.

[0062] The two-copy strain was integrated at sites 416d, 911b, 208a, 308a, and 106a, respectively, based on site 1622b. The results showed that the yield was optimal at site 416d.

[0063] The 3-copy strain was constructed at sites 1622b and 416d, and then integrated into sites 911b, 208a, 308a, and 106a, respectively. The results showed that the yield was optimal at site 911b. The 3-copy strain was also constructed at site 106a and transformed multiple times, but no transformants were produced.

[0064] The 4-copy strain was constructed at sites 1622b, 416d, and 911b, and then integrated into sites 208a, 308a, and 106a, respectively. The results showed that the yield was best at site 208a. The 4-copy strain was also constructed at site 106a and transformed multiple times, but no transformants were produced.

[0065] The 5-copy strain was integrated into the 308a and 106a sites based on the 1622b, 416d, 911b and 208a sites, respectively. The results showed that the yield was optimal at the 308a site.

[0066] Example 5: One-round integration of multiple copies of 2'-carbonyl-3'-deoxyadenosine reductase and 3'-adenosine monophosphate phosphohydrolase

[0067] To facilitate the construction of multi-copy strains, a CRISPR / Cas9 plasmid with multiple N20 target sites was used to integrate multiple copies in one round. For initial validation, a 5-copy strain was constructed, where the CRISPR / Cas9 plasmid contained N20 sequences at five sites. These were integrated into sites 1622b, 416d, 911b, 208a, and 308a in one round. The N20 sequences were as described in Example 1. The multi-target CRISPR / Cas9 plasmid and the five homologous fragments were simultaneously transformed into competent cells of *Saccharomyces cerevisiae* using electroporation. The transformation mass ratio of plasmid to the five homologous fragments was 300 ng: 1500 ng: 1500 ng: 1500 ng: 1500 ng. For validation, a single colony was validated using primers at each of the five sites, and a total of five colony PCRs were performed. The correctly validated strain was then tested using the fermentation and detection methods described in Example 2. The results showed that the recombinant strain produced 0.95 g / L of cordycepin.

[0068] Example 6: Construction and fermentation of 6-10 copy strains

[0069] Using the one-round integration method in Example 5, taking a 6-copy strain as an example, a schematic diagram of strain B6 is shown below. Figure 10As shown, the construction method is as follows: CRISPR / Cas9 plasmids with N20 sequences at sites 1622b, 416d, 911b, 208a, and 308a, along with homologous fragments corresponding to the five sites, are simultaneously transformed into competent cells of Saccharomyces cerevisiae. Site 1622b contains two sets of CNS expression frames, constructed as follows: The upper and lower homologous arms of site 1622b are obtained as described in Example 2. Using plasmid pG418(cns) as a template, primers 1622b-cns-F / cns-1-R are used to amplify CNS expression frame 1. Using plasmid pG418(cns) as a template, primers cns-2-F / 1622b-cns-R are used to amplify CNS expression frame 2. Then, primers 1622b-up-F / 1622b-down-R are used, with the four fragments serving as templates for overlap, resulting in two sets of CNS expression frames containing homologous fragments at site 1622b. The homologous fragments with dual expression frames at the other four sites were also as described above. Copies 7, 8, 9, and 10 of the strain used homologous fragments with two sets of CNS expression frames at sites 416d, 911b, 208a, and 308a, respectively. Using the same fermentation and detection methods as in Example 2, the cordycepin yields of the recombinant strains were 1.03 g / L, 1.12 g / L, 1.17 g / L, 1.26 g / L, and 1.35 g / L, respectively (results are shown in Figure 2). Figure 8 (As shown).

[0070] Example 7 Construction and fermentation of strains with 11-15 copies

[0071] Using the one-round integration method in Example 5, taking an 11-copy strain as an example, a schematic diagram of strain B11 is shown below. Figure 11As shown, the construction method is as follows: CRISPR / Cas9 plasmids with N20 sequences at sites 1622b, 416d, 911b, 208a and 308a, along with homologous fragments corresponding to the five sites, are simultaneously transformed into competent cells of Saccharomyces cerevisiae. Among them, site 1622b has three sets of CNS expression frames, and the remaining five sites each have two sets of CNS expression frames. The construction method of the three sets of CNS expression frames at the 1622b site is as follows: The upper and lower homologous arms of the 1622b site were obtained as described in Example 2. Using plasmid pG418(cns) as a template, CNS expression frame 1 was amplified using primers 1622b-cns-F / cns-1-R. Using plasmid pG418(cns) as a template, CNS expression frame 2 was amplified using primers cns-2-F / cns-1-R. CNS expression frame 3 was amplified using primers cns-2-F / 1622b-cns-R. Then, using primers 1622b-up-F / 1622b-down-R, the five fragments were overlapped to obtain three sets of CNS expression frames containing homologous fragments of the 1622b site. The homologous fragments of the other four site dual expression frames were obtained in the same way. Strains of copies 12, 13, 14, and 15 were sequentially loaded with homologous fragments containing three sets of CNS expression frames at sites 416d, 911b, 208a, and 308a. Strains B11, B12, B13, B14, and B15 (copies 11-15) were obtained. Using the same fermentation and detection methods as in Example 2, the cordycepin yields of the recombinant strains were 1.27 g / L, 1.38 g / L, 1.32 g / L, 1.43 g / L, and 1.49 g / L, respectively (results are shown in Figure 1). Figure 8 (As shown).

[0072] Example 8: Optimization of glucose concentration in fermentation medium

[0073] according to Figure 8 As shown, the integration of more than 5 copies of the gene for synthesizing cordycepin affected the growth of the strain. Therefore, subsequent related experiments were all conducted using the recombinant strain B5 from Example 3. The glucose concentration of the fermentation medium described in Example 2 was optimized. The fermentation medium was used with glucose concentrations of 10 g / L, 20 g / L, 40 g / L, 50 g / L, 80 g / L, and 100 g / L, respectively. The results showed that using 50 g / L glucose had the best effect (results are shown in Figure 1). Figure 12 (As shown).

[0074] Example 9: Optimization of adenine concentration in fermentation medium

[0075] The concentration of precursor adenine in the fermentation medium obtained in Example 8 was optimized using the recombinant strain B5 from Example 3. The fermentation medium was used with adenine concentrations of 0.1 g / L, 0.5 g / L, 1 g / L, 1.5 g / L, 2 g / L, 3 g / L, and 5 g / L, respectively. The results showed that using 3 g / L adenine yielded the best effect (results are shown in Figure 8). Figure 13 (As shown).

[0076] Example 10: Recombinant strain B5 replenishes defective genes in chassis strains

[0077] The recombinant strain B5 from Example 3 integrated and expressed any one or a combination of several of the following: orotidine-5'-phosphate decarboxylase (URA3), imidazole glycerol phosphate dehydrogenase (HIS3), 3-isopropylmalate dehydrogenase (LEU2), and L-aminoadipic acid-semialdehyde dehydrogenase (LYS2). URA3 was backfilled to the 1309a site, LYS2 to the XI-3 site, and his3 and leu2 to the XII-1 site. All four genes were amplified using the genome of strain CEN.PK530-1C (a generous gift from Professor Huang Mingtao of South China University of Technology) as a template.

[0078] The ura3 expression cassette was amplified using primers 1309a-URA3-F / 1309a-URA3-R. The upper homologous arm at the 1309a site was amplified using primers 1309a-up-F / 1309a-up-R, and the lower homologous arm at the 1309a site was amplified using primers 1309a-down-F / 1309a-down-R. Then, the ura3 expression cassette including the homologous fragment at the 1309a site was obtained by overlapping primers 1309a-up-F / 1309a-down-R.

[0079] The lys2 expression cassette was amplified using primers XI-3-LYS2-F / XI-3-LYS2-R. The upper homologous arm at the XI-3 site was amplified using primers XI-3-up-F / XI-3-up-R, and the lower homologous arm at the XI-3 site was amplified using primers XI-3-down-F / XI-3-down-R. Then, the lys2 expression cassette including the homologous fragment at the XI-3 site was obtained by overlapping with primers XI-3-up-F / XI-3-down-R.

[0080] The his3 expression cassette was amplified using primers HIS3-F / HIS3-R, the leu2 expression cassette was amplified using primers LEU2-F / LEU2-R, the upper homologous arm at the XII-1 site was amplified using primers XII-1-up-F / XII-1-up-R, and the lower homologous arm at the XII-1 site was amplified using primers XII-1-down-F / XII-1-down-R. Then, the his3 and leu2 expression cassettes, which included homologous fragments at the XII-1 site, were overlapped using primers XII-1-up-F / XII-1-down-R.

[0081] Then, using the plasmid from Example 1 and the method from Example 2, recombinant strains B5U (ura3 filled to the 1309a site), B5U1 (ura3 filled to the 1309a site, lys2 filled to the XI-3 site), B5U2 (ura3 filled to the 1309a site, lys2 filled to the XI-3 site, his3 filled to the XII-1 site), and B5U3 (ura3 filled to the 1309a site, lys2 filled to the XI-3 site, his3 and leu2 filled to the XII-1 site) were obtained sequentially. Following the same fermentation and detection methods as in Example 3, the cordycepin yields of recombinant strains B5U, B5U1, B5U2, and B5U3 were 2.61, 2.72, 2.79, and 2.92 g / L, respectively (results are shown in Figure 2). Figure 14 (As shown).

[0082] Table 1 Primer sequences

[0083]

[0084]

[0085]

[0086] Example 11 Stability verification of strain B5U3

[0087] This invention utilizes multiple copies of cordycepin synthesis-related enzyme genes, including the 2'-carbonyl-3'-deoxyadenosine reductase gene and the 3'-adenosine monophosphate phosphate hydrolase gene. To increase the stability of the strain, the multiple-copy integration method involves integrating the genes at a spacer length ≥1 kb from the nearest essential gene. Therefore, to verify the stability of the recombinant strain B5U3, in a simulated fermenter environment, the strain was passaged every 24 hours for 10 generations before fermentation. The yield decreased slightly to 2.68 g / L, demonstrating the effectiveness of this integration strategy in increasing strain stability.

[0088] Example 12: Fermentation of Cordycepin by Engineered Saccharomyces cerevisiae in a 5L Fermentation Tank

[0089] Fermentation was carried out in a 5L fermenter using recombinant strain B5U3. Single colonies were picked and inoculated into 5mL of YPD liquid medium, and cultured at 30℃ and 220rpm for 18h. The culture was then transferred to 200mL of YPD liquid medium at a 5% v / v inoculation ratio and cultured at 30℃ and 220rpm for 16h. Finally, the culture was transferred to 2L of fermentation medium, which consisted of 50g / L glucose, 10g / L yeast extract, 20g / L peptone, and 3g / L adenine. The fermenter parameters were controlled as follows: temperature 28–30℃, stirring speed 400–600rpm, aeration rate 6, liquid volume 2L, pH 5.5±0.1, and dissolved oxygen maintained at approximately 30%. After 13h of fermentation, a feed was added, maintaining the glucose concentration in the fermenter below 1.0g / L throughout the fermentation process, for a total fermentation time of 144h. The feed medium was 400g / L glucose. The results showed that the engineered strain produced 7.5 g / L of cordycepin in a 5L fermenter (results are shown in the figure). Figure 15 (As shown).

[0090] This invention provides a high-cordycepin-producing engineered yeast strain, its construction method, and its application. Many methods and approaches exist for implementing this technical solution; the above description is merely a preferred embodiment. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.

Claims

1. A highly efficient Saccharomyces cerevisiae strain for synthesizing cordycepin, characterized in that, The genome of the *Saccharomyces cerevisiae* strain contains multiple copies of an integrated expression of a cordycepin synthesis-related enzyme gene; the originating strain of the *Saccharomyces cerevisiae* strain is *Saccharomyces cerevisiae*. Saccharomyces cerevisiae BY4742; Among them, the cordycepin synthesis-related enzyme genes include 2'-carbonyl-3'-deoxyadenosine reductase gene and 3'-adenosine monophosphate phosphate hydrolase gene; The aforementioned multicopy integration refers to an integration site that is ≥1kb in length from the nearest essential gene; The multiple copies are 5 copies, and the integration sites are a combination of 1622b, 416d, 911b, 208a, and 308a; 2'-carbonyl-3'-deoxyadenosine reductase and 3'-adenosine monophosphate phosphohydrolase are both derived from Cordyceps militaris The NCBI login numbers are XP_006669647 and XP_006669648 respectively; The genome of the *Saccharomyces cerevisiae* strain integrates and expresses auxotrophic genes; these auxotrophic genes include a combination of orotidine-5'-phosphate decarboxylase gene, imidazole glycerol phosphate dehydratase gene, 3-isopropylmalate dehydrogenase gene, and L-aminoadipic acid-semialdehyde dehydrogenase gene; wherein the NCBI accession numbers for orotidine-5'-phosphate decarboxylase, imidazole glycerol phosphate dehydratase, 3-isopropylmalate dehydrogenase, and L-aminoadipic acid-semialdehyde dehydrogenase are NP_010893.3, NP_014845.1, NP_009911.2, and NP_009673.1, respectively. The method for constructing the *Saccharomyces cerevisiae* strain includes the following steps: (1) Amplify the gene expression cassette of cordycepin synthesis-related enzymes, which includes the gene expression cassette of 2'-carbonyl-3'-deoxyadenosine reductase and the gene expression cassette of 3'-adenosine monophosphate phosphate hydrolase. (2) Using CRISPR / Cas9 technology, the cordycepin synthesis-related enzyme gene expression cassette described in step (1) is integrated into multiple integration sites in the genome of the starting strain of Saccharomyces cerevisiae for multi-copy expression.

2. The *Saccharomyces cerevisiae* strain according to claim 1, characterized in that, The 2'-carbonyl-3'-deoxyadenosine reductase gene and the 3'-adenosine monophosphate phosphate hydrolase gene are both driven by any one of the promoters PGK1, TEF1, GPD, TPI1, ADH1, TDH3, CYC1, HXT1, GAL1, GAL7, GAL10, CUP1, or MET25.

3. The *Saccharomyces cerevisiae* strain according to claim 1, characterized in that, The method for constructing the Saccharomyces cerevisiae strain includes step (3), wherein step (3) is to amplify the auxotrophic gene expression cassette and integrate it into the genome of the Saccharomyces cerevisiae obtained in step (2) using CRISPR / Cas9 technology; the auxotrophic gene expression cassette includes a combination of orotidine-5'-phosphate decarboxylase gene expression cassette, imidazole glycerol phosphate dehydratase gene expression cassette, 3-isopropylmalate dehydrogenase gene expression cassette and L-aminoadipic acid-semialdehyde dehydrogenase gene expression cassette.

4. The application of the highly efficient cordycepin-synthesizing yeast strain according to any one of claims 1 to 2 in the production of cordycepin.

5. The application according to claim 4, characterized in that, The highly efficient cordycepin-synthesizing yeast strain was inoculated into a fermentation medium and fermented at 20-40°C for 96-144 h. The fermentation medium comprises 10-100 g / L carbon source, 10-50 g / L nitrogen source, and 0.1-15 g / L adenine.

Images