Chufa salt-tolerant gene and application thereof
By cloning and constructing an overexpression vector for the tiger nut salt tolerance gene CeMYB154, and transforming it into Arabidopsis thaliana, the problem of weak research on tiger nut salt tolerance was solved. This improved the salt tolerance and enhanced the antioxidant enzyme activity of Arabidopsis thaliana, promoting the application of tiger nut in saline soils.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF IND CROPS HENAN ACAD OF AGRI SCI
- Filing Date
- 2025-01-24
- Publication Date
- 2026-07-31
AI Technical Summary
The existing technology has a weak foundation in the research on salt tolerance of tiger nuts and lacks salt-tolerant crop varieties, which makes it impossible to effectively utilize saline soils. There is an urgent need to explore the salt tolerance genes of tiger nuts to promote molecular breeding and germplasm improvement.
We cloned and constructed an overexpression vector for the tiger nut salt tolerance gene CeMYB154, transformed it into Arabidopsis thaliana, and identified the salt tolerance of the transgenic Arabidopsis thaliana through PCR amplification and genetic transformation, thereby improving its ability to adapt to salt stress.
It significantly enhanced the salt tolerance of transgenic Arabidopsis thaliana, improved plant root length and growth status, reduced MDA and H2O2 content, and enhanced the activity of antioxidant enzymes CAT, POD and SOD, providing genetic resources for molecular breeding of salt-tolerant tiger nuts.
Smart Images

Figure CN120099020B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioengineering technology, and more specifically, to a salt-tolerant gene for tiger nuts and its application. Background Technology
[0002] Soil salinization has become a major abiotic stress affecting plant growth and agricultural production, and is one of the world's major environmental problems. Excessive salt content in saline soils causes salt damage, severely impacting crop growth and yield. Due to the lack of suitable salt-tolerant crop varieties, large areas of saline soil cannot be effectively utilized.
[0003] Tiger nuts are a novel economic crop, rich in oils, starch, dietary fiber, and trace elements, possessing significant economic value in grain, oil, livestock, and forage applications. Native to North Africa and the Mediterranean coast, tiger nuts are highly adaptable, tolerating drought, waterlogging, poor soil conditions, and salinity to a certain extent, making them a promising high-value crop for improving and utilizing saline-alkali soils. However, research on the salt tolerance of tiger nuts is relatively weak, and targeted breeding for salt tolerance is severely lagging. Therefore, identifying salt-tolerant functional genes in tiger nuts and elucidating the molecular mechanisms of salt tolerance in related genes is of great significance, providing a technical and molecular basis for the breeding and utilization of salt-tolerant tiger nut varieties in my country.
[0004] The MYB transcription factor family exists in all eukaryotes and is the largest known class of transcription factors in plants. It has diverse functions and plays an important role in various life activities such as resistance to stress, abiotic stress, growth and development, and regulation of secondary metabolism in eukaryotes.
[0005] Currently, research on salt tolerance in tiger nuts mainly focuses on evaluating the salt tolerance of tiger nut germplasm resources and the impact of salt stress on the growth, development, and physiological traits of tiger nuts. However, research on the molecular mechanisms of salt tolerance and key salt-tolerant genes is relatively limited. There is an urgent need to identify and discover salt-tolerant genes in tiger nuts to provide genetic resources and a theoretical basis for molecular-assisted breeding of tiger nuts. Summary of the Invention
[0006] (a) Technical problems to be solved The purpose of this invention is to provide a plant salt tolerance gene CeMYB154, its encoded protein, and its applications, to improve existing plant germplasm, thereby creating new salt-tolerant germplasm and promoting plant adaptation to soil salinization.
[0007] (II) Technical Solution To achieve the above objectives, the present invention provides the following technical solution: a salt-tolerant gene for tiger nuts, wherein the nucleotide sequence of the salt-tolerant gene for tiger nuts is SEQ ID No. 1, and the amino acid sequence of the salt-tolerant gene for tiger nuts is SEQ ID No. 2; the open reading frame of the salt-tolerant gene is 780 bp, encoding a total of 259 amino acids; The application of the tiger nut salt tolerance gene involved using tiger nut roots as plant material. The target fragment was amplified by PCR, and an overexpression vector of CeMYB154 was constructed for Arabidopsis genetic transformation. The salt tolerance of the transgenic Arabidopsis was analyzed and identified. The sequences of the primers CeMYB154-F and CeMYB154-R were ATGGAGGAAGTGGCATGGAG and CTAGTATAAAGCAAATTCTGCTGCTTGC, respectively. The treatment involved 34 cycles of pre-denaturation at 98 ℃ for 30 s, followed by denaturation at 98 ℃ for 10 s, annealing at 55 ℃ for 10 s, and annealing at 72 ℃ for 60 s, and finally extension at 72 ℃ for 10 min. The expression level of the tiger nut salt tolerance gene increased after salt stress treatment. This tiger nut salt tolerance gene can be used to improve the salt tolerance of transgenic Arabidopsis. Compared with the wild-type line, the CeMYB154 transgenic Arabidopsis line showed significantly increased root length and better growth.
[0008] The present invention also includes the application of the salt tolerance gene CeMYB154 in tiger nuts for the breeding of salt-tolerant tiger nut varieties.
[0009] The purpose of this invention is to provide a plant salt tolerance gene CeMYB154, its encoded protein, and its applications, to improve existing plant germplasm, thereby creating new salt-tolerant germplasm and promoting plant adaptation to soil salinization.
[0010] This invention provides a salt tolerance gene CeMYB154, the nucleotide sequence of which is shown in SEQ ID NO. 1.
[0011] The present invention also provides a protein encoded by the salt tolerance gene CeMYB154 described in the above technical solution, the amino acid sequence of which is shown in SEQ ID NO. 2.
[0012] This invention also provides primer pairs for amplifying the salt-tolerant gene CeMYB154 described in the above technical solution, characterized in that the primer pair includes an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is ATGGAGGAAGTGGCATGGAG; and the nucleotide sequence of the downstream primer is CTAGTATAAAGCAAATTCTGCTGCTTGC.
[0013] The present invention also provides a recombinant expression vector containing the above-mentioned coding gene.
[0014] The present invention also provides a recombinant strain containing the above-mentioned encoding gene.
[0015] The overexpressing recombinant strain was transformed into Arabidopsis thaliana, and the CeMYB154 transgenic Arabidopsis thaliana line was screened and obtained. The salt tolerance of Arabidopsis thaliana was analyzed and identified.
[0016] (III) Beneficial Effects Compared with the prior art, the present invention provides a salt-tolerant gene for tiger nuts and its application, which has the following beneficial effects: This invention screened a tiger nut gene, CeMYB154, whose expression level significantly increased under salt stress through preliminary transcriptome sequencing analysis. After understanding its basic information through bioinformatics analysis, the gene was cloned, an overexpression vector was constructed, and a recombinant strain was overexpressed. The gene was then transformed into Arabidopsis thaliana to obtain transgenic Arabidopsis plants CeMYB154-OE. It was confirmed that the growth status of Arabidopsis plants overexpressing CeMYB154 was less affected, the content of MDA and H2O2 was significantly lower, while the activities of antioxidant enzymes CAT, POD and SOD were significantly enhanced, showing stronger salt tolerance. This invention clarified the positive regulatory role of CeMYB154 in the salt stress response of tiger nut and can provide an important gene resource for molecular breeding of salt-tolerant tiger nut. Attached Figure Description
[0017] Figure 1 This shows the subcellular localization of the CeMYB154 protein; Figure 2 The results show the identification of the transcriptional activation activity of CeMYB154; Figure 3 The results show the identification of CeMYB154 transgenic Arabidopsis thaliana. A represents T1 transgenic seedlings screened by kanamycin, B represents PCR identification of T1 transgenic plants, M represents DL2000 marker, 1-10 represent transgenic plants, WT represents wild-type plants, and C represents the expression level of CeMYB154 in T2 transgenic Arabidopsis thaliana. Figure 4 This shows the salt tolerance assessment of the transgenic Arabidopsis thaliana; Figure 5 The results show the determination of different physiological indicators in wild-type and CeMYB154 transgenic Arabidopsis thaliana after salt stress. Detailed Implementation
[0018] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to the accompanying drawings and embodiments.
[0019] It should be noted that, unless otherwise specified, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0020] Experimental materials The tested plant materials were salt-tolerant tiger cultivar Yuyousha No. 2, wild-type Arabidopsis thaliana, and CeMYB154 overexpressing transgenic Arabidopsis thaliana.
[0021] Test strains: Escherichia coli DH5α strain, Agrobacterium GV3101 strain, and yeast AH109 strain.
[0022] Example 1: Cloning of the CeMYB154 gene and analysis of its encoded protein's transcription factor characteristics. Cloning the CeMYB154 gene cDNA extracted from the root samples of tiger nut seedlings subjected to 100 mmol / L NaCl stress for 24 hours was used as a template. PCR primer sequences were designed: forward primer: 5′-ATGGAGGAAGTGGCATGGAG-3′, reverse primer: 5′-CTAGTATAAAGCAAATTCTGCTGCTTGC-3′. RT-PCR amplification was performed, and the amplified products were electrophoresed, recovered, ligated into a T-vector, and transformed into E. coli DH-5α. Positive clones were screened and sequenced to obtain correctly sequenced cloned strains and plasmids, thus completing the cloning of the CeMYB154 gene.
[0023] CeMYB154 protein is located in the cell nucleus. A CeMYB154-EGFP fusion expression vector, 35S::EGFP-CeMYB154, was constructed. This vector and the control 35S::EGFP were transformed into Agrobacterium, and positive bacteria were obtained and cultured by shaking. After collection, the bacteria were injected into tobacco epidermal cells. After culturing for 40-48 hours after injection, the GFP fluorescence signal was observed using a laser confocal fluorescence microscope.
[0024] like Figure 1 As shown, green fluorescence was observed in both the nucleus and cell membrane of tobacco epidermal cells transformed with 35S::EGFP, while green fluorescence was only found in the nucleus of tobacco cells transformed with 35S::EGFP-CeMYB154, proving that the CeMYB154 protein is located in the nucleus.
[0025] CeMYB154 protein has transcriptional activation activity. The pGBKT7-CeMYB154 plasmid was constructed. pGADT7 / pGBKT7-CeMYB154, along with the negative control pGADT7-LargeT / pGBKT7-LaminC and the positive control pGADT7-LargeT / pGBKT7-p53, were transformed into competent yeast cells AH109, respectively. The yeast culture was plated on -Trp / -Leu yeast-deficient plates and incubated at 30℃ for 2-3 days. Then, single colonies were selected for yeast validation. The colonies were diluted 1, 10², and 10³ times with dd H₂O and spotted onto -Trp / -Leu / -His / -Ade yeast-deficient plates containing X-α-Gal. The plates were incubated upside down at 30℃ for 3-4 days, and yeast growth was observed.
[0026] like Figure 2 The results showed that yeast co-transformed with pGADT7-LargeT+pGBKT7-P53 in the positive control group and pGADT7+pGBKT7-CeMYB154 in the experimental group could grow normally and turn blue, while yeast co-transformed with pGADT7-LargeT+pGBKT7-LaminC in the negative control group could not grow, indicating that tiger nut CeMYB154 protein itself has transcriptional activation activity.
[0027] Therefore, the CeMYB154 protein of the present invention is a transcription factor located in the cell nucleus and possessing transcriptional activation activity.
[0028] Example 2: Identification of the salt tolerance of CeMYB154 Based on the overexpression vector pCMBIA2300 and the Sal I restriction enzyme single restriction site, homologous recombination primers for the CeMYB154 CDS sequence were designed, and the overexpression vector 35S::CeMYB154 was constructed using homologous recombination. The 35S::CeMYB154 vector plasmid was transformed into Columbia ecotype Arabidopsis thaliana (WT) using the Agrobacterium-mediated flower immersion method. Different transgenic Arabidopsis lines were identified, and the results are as follows: Figure 3 As shown. After identification, the cells were cultured to the T3 generation to obtain transgenic homozygous lines for the following experiments.
[0029] Arabidopsis seedlings that had germinated one week prior were transplanted into MS solid medium containing 0, 50, and 100 mmol / L NaCl, respectively, and cultured in horizontal and vertical positions in a light incubator. Plant morphological changes were observed after two weeks.
[0030] like Figure 4As shown, under salt stress treatment, compared with WT plants, the three transgenic lines grew better, with larger and greener leaves, and suffered less damage from salt stress, demonstrating better salt tolerance. Similarly, when cultured upright, under salt stress conditions, there were significant differences in root growth (especially length) between transgenic Arabidopsis and WT plants, indicating that transgenic Arabidopsis plants were able to resist salt stress effectively.
[0031] The results above indicate that, compared with WT, Arabidopsis plants overexpressing CeMYB154 showed a significant increase in salt tolerance, suggesting that CeMYB154 can positively regulate plant salt tolerance.
[0032] Example 3: Stress Resistance Mechanism of CeMYB154 Physiological indicators such as malondialdehyde, hydrogen peroxide, catalase, peroxidase, and superoxide dismutase were measured using leaves of transgenic and WT Arabidopsis thaliana plants subjected to salt stress for 24 h.
[0033] like Figure 5 As shown, the malondialdehyde and hydrogen peroxide contents of the three transgenic lines were significantly lower than those of the WT plants, while the activities of the three antioxidant enzymes (especially peroxidase) were significantly higher than those of the WT plants.
[0034] The above results indicate that CeMYB154 can positively regulate catalase, peroxidase, and superoxide dismutase in Arabidopsis thaliana, enhancing the reactive oxygen species scavenging capacity of transgenic Arabidopsis plants under salt stress, thereby improving the salt tolerance of Arabidopsis thaliana.
[0035] sequence list Institute of Economic Crops, Henan Academy of Agricultural Sciences A salt-tolerant gene for tiger nuts and its application 2 SIPOSequenceListing 1.0 1 780 DNA Tiger nuts (Cyperus esculentus) 1 atggaggaag tggcatggag gaagggtcca tggactgccc aagaggacaa gctgttgata 60 gattatgtga accagcatgg agaaggcaga tggaattctg ttgctaagat cacaggactc 120 agaagaagtg gaaagagctg cagactgaga tgggtcaact atctaagacc agacctcaaa 240. 240. 240. 240. 240. 240. 240. 240. 240. 240 aacaggtggt caaccattgc cagaagtctt ccgggcagaa ccgacaacga gataaagaac 360. tactggcgga cgcacttcaa gaaagcaag ccgtcgaaga gcatcgaacg ggcacgggcg cagttcctca cacagcgcga agagcgactg fathercagg agttgcagct acagcatcag ttgcatcagc gcagcagcag cagagcag owner gcatcacccg 480. ttgcatcagc ccgcacgtac agcaaacgtt cgatgcgaaa tacgtgatgt ctccaactcc aacggtggag 540 gatgcctcgc cggcggcgta caacatccag cacatggaac tgatgtacta ctcttacttg ccttatctac tccaagggga aggcaataat gctactacag caagctgttc ttcctccaac gaggggggat tcgtggagga agacggtact gcgtggggca cgctgtggaa cctcgacgac 720 tgcgacgtgg tgcatcgtgg cagctctcca atgcaagcag cagaatttgc tttatactag 2 259 PRT Cyperus esculentus (Cyperus esculentus) 2 Met Glu Glu Val Ala Trp Arg Lys Gly Pro Trp Thr Ala Gln Glu Asp Lys Leu Leu 1 5 10 15 Ile Asp Tyr Val Asn Gln His Gly Glu Gly Arg Trp Asn Ser Val Ala Lys Ile Thr 20 25 30 35 Gly Leu Arg Arg Ser Gly Lys Ser Cys Arg Leu Arg Trp Val Asn Tyr Leu Arg Pro 40 45 50 55 Asp Leu Lys Arg Gly Lys Ile Thr Pro Gln Glu Glu Ser Ile Ile Ile Glu Leu His 60 65 70 75 Ala Leu Phe Gly Asn Arg Trp Ser Thr Ile Ala Arg Ser Leu Pro Gly Arg Thr Asp 80 85 90 95 Asn Glu Ile Lys Asn Tyr Trp Arg Thr His Phe Lys Lys Ser Lys Pro Ser Lys Ser 100 105 110 Ile Glu Arg Ala Arg Ala Gln Phe Leu Arg Gln Arg Glu Glu Arg Leu Tyr Asn Gln 115 120 125 130 Glu Leu Gln Leu Gln His Gln Leu His Gln Gln Gln Gln Gln Gln Gln Lys Gln Lys 135 140 145 150 Gln Val Val Asp Glu His His Pro Pro His Val Gln Gln Thr Phe Asp Ala Lys Tyr 155 160 165 170 Val Met Ser Pro Thr Pro Thr Val Glu Asp Ala Ser Pro Ala Ala Tyr Asn Ile Gln 175 180 185 190 Asp Met Glu Leu Met Tyr Tyr Ser Tyr Leu Pro Tyr Leu Leu Gln Gly Glu Gly Asn 195 200 205 Asn Ala Thr Thr Ala Ser Cys Ser Ser Ser Asn Glu Gly Gly Phe Val Glu Glu Asp 210 215 220 225 Gly Thr Ala Trp Gly Thr Leu Trp Asn Leu Asp Asp Cys Asp Val Val His Arg Gly 230 235 240 245 Ser Ser Pro Met Gln Ala Ala Glu Phe Ala Leu Tyr 250 255.
[0036] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.
Claims
1. A salt-tolerant gene for tiger nuts, CeMYB154, characterized by: The nucleotide sequence of the gene is SEQ ID No. 1, and the amino acid sequence of the gene is SEQ ID No. 2; the open reading frame of the gene is 780 bp, encoding a total of 259 amino acids.
2. A method for constructing an overexpression vector containing the gene of claim 1, characterized in that: Using tiger pea root cDNA as a template, PCR amplification was performed with a primer pair consisting of the upstream primer sequence ATGGAGGAAGTGGCATGGAG and the downstream primer sequence CTAGTATAAAGCAAATTCTGCTGCTTGC. The target fragment was then ligated into an expression vector for Arabidopsis genetic transformation.
3. The method according to claim 2, characterized in that: The PCR reaction program was as follows: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 55℃ annealing for 10 s, 72℃ extension for 60 s, for 34 cycles; and 72℃ final extension for 10 min.
4. The application of the CeMYB154 salt-tolerant gene of tiger nuts as described in claim 1 in improving the salt tolerance of transgenic Arabidopsis thaliana.