Mutant of alanine dehydrogenase and its use in production
Patent Information
- Application Number
- CN202510277849.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-10
- Publication Date
- 2026-09-08
- Estimated Expiration
- 2045-03-10
AI Technical Summary
丙酸氯化法是化学合成L-丙氨酸的常见方法,但是丙酸氯化法生产L-丙氨酸成本高,合成的产品质量差,还会造成环境污染,目前已基本被淘汰;提取法是通过酸水解或酶解玉米蛋白、绢丝或者明胶等L-丙氨酸含量高的物质,然后分离和手性拆分后得到L-丙氨酸
[0059] The *E. coli* strain constructed in this invention can obtain high levels of L-alanine using glucose as a substrate in a short time. The fermentation process of this strain is convenient, and in a 5L fermenter, the yield can reach 150.2 g/L after 48 hours of fermentation, with a production intensity of 3.12 g/L/h.
Smart Images

Figure CN120118871B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a mutant of alanine dehydrogenase and its application in production, belonging to the field of bioengineering technology. Background Technology
[0002] L-Alanine is a non-essential amino acid and one of the smallest chiral molecules. Also known as L-α-aminopropionic acid, it has the molecular formula CH3CH2(NH2)COOH, a molecular weight of 89.09, and a density of 1.432 g / cm³. 3 It has a melting point of 297℃, and its appearance is a colorless to white crystalline powder. It is soluble in water, slightly soluble in ethanol, and insoluble in ether and acetone. It is odorless and non-toxic, and has a savory and sweet taste, with the sweetness being 1.2 times that of sucrose.
[0003] L-alanine has a wide range of applications in the daily chemical, food, and pharmaceutical industries. In the daily chemical industry, amino acid surfactants are popular due to their high biocompatibility, excellent compatibility, and non-irritating properties to the skin. L-alanine can be used as a raw material for synthesizing amino acid surfactants. In the food industry, L-alanine is a flavor enhancer approved for use in my country. Compared with other flavor enhancers, L-alanine is sodium-free, making it safer to consume, and its flavor-enhancing effect on food is significant. L-alanine also has umami flavor; when added to fish sauce, it can sweeten, enhance freshness, and reduce fishy odors. In addition to umami, L-alanine also has a sweet flavor. It can replace L-phenylalanine in the synthesis of a new dipeptide sweetener, alitane, which is about 10 times sweeter than aspartame. Its sweetness characteristics are similar to sucrose, without the bitter or metallic aftertaste often found in other strong sweeteners. In the pharmaceutical industry, L-alanine is a major raw material for the synthesis of vitamin B6 and aminopropanol.
[0004] The main methods for producing L-alanine include chemical synthesis, extraction, enzymatic conversion, and fermentation. Propionic acid chlorination is a common method for the chemical synthesis of L-alanine, but it is costly, produces poor-quality products, and causes environmental pollution, and has been largely phased out. Extraction involves acid hydrolysis or enzymatic hydrolysis of substances with high L-alanine content, such as corn gluten, silk, or gelatin, followed by separation and chiral resolution to obtain L-alanine. This method is relatively expensive and unsuitable for large-scale and industrial production. Enzymatic conversion methods are divided into free whole-cell methods and immobilized cell methods. The raw material for enzymatic conversion is L-aspartic acid, which is catalyzed by microbial cells rich in L-aspartate-β-decarboxylase activity to obtain L-alanine. L-aspartic acid can be obtained by the efficient catalysis of fumarate by immobilized Escherichia coli. Enzymatic conversion is currently a commonly used industrial production method. However, the raw material aspartic acid is expensive, resulting in high production costs. Moreover, aspartic acid is usually produced from fumarate by enzymatic catalysis using aspartate ammonia-lyase, while fumarate is mainly obtained from petroleum. Petroleum-based products are non-renewable, environmentally unfriendly, and price-dependent. Fermentation methods use inexpensive glucose as a raw material, resulting in low production costs. The produced amino acid enantiomeric purity is high, reducing subsequent purification steps. Furthermore, the fermentation process is mild and can prevent further degradation of the product, showing broad research prospects. Summary of the Invention
[0005] This invention provides an alanine dehydrogenase mutant. The alanine dehydrogenase is derived from *Lysinibacillus sphaericus*, with the wild-type enzyme having GenBank accession number 48275818. It contains 372 amino acids, and the amino acid sequence of the wild-type alanine dehydrogenase is shown in SEQ ID NO.1, while the nucleotide sequence is shown in SEQ ID NO.10.
[0006] SEQ ID NO.1:
[0007] MKIGIPKEIKNNENRVAMTPAGVVSLTHAGHERLAIETGGGIGSSFTDAEYVAAGAAYRCIGKEAWAQEMILKVKEPVASEYDYFYEGQILFTYLHLAPRAELTQALIDKKVVGIAYETVQLANGSLPLLTPMSEVAGKMATQIGAQYLEKNHGGKGILLGGVSGVHARKVTVIGGGIAGTNAAKIAVGMGADVTVIDLSPERLRQLEDMFGRDVQTLMSNPYNIAESVKHSDLVVGAVLIPGAKAPKLVSEEMIQSMQPGSVVVDIAIDQGGIFATSDRVTTHDDPTYVKHGVVHYAVANMPGAVPRTSTIALTNNTIPYALQIANKGYKQACIDNPALKKGVNALEGHITYKAVAEAQGLPYVNVDELIQ
[0008] SEQ ID NO.10
[0009] atgaaaattggcattccgaaagaaatcaaaaacaacgaaaaccgcgtggctatgacgccggctggtgttgttagcctgacccacgctggtcatg
[0010] aacgcctggctattgaaaccggtggcggcattggttcctcctttaccgacgccgaatatgtggcagcgggcgcagcttaccgttgtatcggtaag
[0011] gaagcatgggcgcaggagatgatcctgaaagttaaagaaccggttgcaagcgaatacgattacttctacgagggccagatcctgttcacctatct
[0012] gcacctggcaccgcgtgctgaactgacccaagcactgatcgataaaaaagtcgttggtattgcttacgaaaccgtgcagctggcaaacggttct
[0013] ctgccgctgctgactccaatgtctgaagtggcgggcaaaatggctacccagatcggtgcccagtacctggagaaaaaccacggcggcaaagg
[0014] cattctgctgggtggtgtatctggtgtgcacgctcgcaaagttacggtgatcggtggcggtattgcaggcaccaacgctgcaaaaattgccgtag
[0015] gtatgggtgcagacgtaaccgtgattgacctgtccccggaacgtctgcgtcaactggaagatatgttcggtcgtgacgtgcagaccctgatgag
[0016] caacccgtataacatcgcggaaagcgttaaacactccgatctggttgttggcgcagtactgatcccgggcgctaaggcacctaaactggtgtcc
[0017] gaagaaatgatccaaagcatgcagccgggttctgtggttgtggacatcgcgattgatcaaggcggcatcttcgcaactagcgaccgtgtcacta
[0018] cccacgacgaccctacctatgttaaacacggtgtagtacactacgctgtagcgaaacatgcctggtgcagtgccacgtacgagcaccattgctctg
[0019] accaacaacaccattccgtatgctctgcagatcgcgaataaaggctataagcaggcgtgtatcgacaatccggcactgaaaaaaaggcgtgaatg
[0020] cgctgggaaggccacatcacttacaaagcggttgcggaagcccaaggcctgccgtacgttaacgttgatgaactgattcag
[0021] The mutant is obtained by mutating glutamic acid at position 76 of alanine dehydrogenase, as shown in SEQ ID NO.1, to arginine, and is named E76R.
[0022] Alternatively, the amino acid sequence of alanine dehydrogenase, as shown in SEQ ID NO.1, can be obtained by mutating glutamic acid at position 76 to arginine and simultaneously mutating aspartic acid at position 270 to glutamic acid, and named E76R / D270E.
[0023] Alternatively, the amino acid sequence of alanine dehydrogenase, as shown in SEQ ID NO.1, can be obtained by mutating glutamic acid at position 76 to arginine, aspartic acid at position 270 to glutamic acid, and alanine at position 300 to lysine, and named E76R / D270E / A300K.
[0024] In one embodiment of the present invention, the three mutants of alanine dehydrogenase contain the nucleotide sequences shown in SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9.
[0025] The present invention also provides a gene encoding the above-mentioned mutant or a recombinant vector carrying the gene.
[0026] The present invention also provides recombinant cells expressing the above-mentioned mutants or carrying the above-mentioned genes or the recombinant vectors.
[0027] In one embodiment of the present invention, the recombinant cells are expressed using bacteria or fungi as expression hosts.
[0028] The present invention also provides a recombinase catalyst containing the above-mentioned alanine dehydrogenase mutant sequence, wherein the recombinase catalyst is any one of the following forms:
[0029] (1) Culture the recombinant expression transformant and isolate the transformant cells containing the recombinase;
[0030] (2) Culture the recombinant expression transformant, isolate the transformant cells containing the recombinase, and break the transformant cells containing the recombinase to obtain the cell lysate;
[0031] (3) Cultivate recombinant expression transformants, isolate transformant cells containing the recombinant enzyme, break the transformant cells containing the recombinant enzyme, obtain cell lysate, and freeze-dry the cell lysate of the recombinant enzyme to obtain lyophilized enzyme powder.
[0032] The present invention also provides a method for improving the catalytic efficiency of alanine dehydrogenase for pyruvate, wherein the method involves mutating glutamic acid at position 76 of the alanine dehydrogenase, as shown in SEQ ID NO.1, to arginine.
[0033] Alternatively, the amino acid sequence of alanine dehydrogenase, as shown in SEQ ID NO.1, may be mutated from glutamic acid at position 76 to arginine, and the amino acid sequence of aspartic acid at position 270 may be mutated to glutamic acid.
[0034] Alternatively, the amino acid sequence of alanine dehydrogenase, as shown in SEQ ID NO.1, can be mutated from glutamic acid at position 76 to arginine, from aspartic acid at position 270 to glutamic acid, and from alanine at position 300 to lysine.
[0035] This invention provides a recombinant Escherichia coli strain with improved L-alanine production efficiency, using Escherichia coli W3110 as the starting strain, and has the following improvements:
[0036] The above-mentioned alanine dehydrogenase mutant, as well as alanine transporter, glucose-6-phosphate dehydrogenase, phosphoglucuronide dehydratase, and KDPG aldolase from E. coli, were overexpressed, while lactate dehydrogenase, alanine racemic enzyme, and pyruvate formate lyase were knocked out from the E. coli genome.
[0037] In one embodiment of the present invention, the recombinant strain is a heterologous introduction of an alanine dehydrogenase ald mutant from *Bacillus lysinensis*, knockout of lactate dehydrogenase ldhA, knockout of alanine racemase dadX, knockout of pyruvate-formate lyase pflB, overexpression of alanine transporter alaE, and the use of promoter P. tac Tandem overexpression of the genes encoding glucose-6-phosphate dehydrogenase zwf, phosphoglucuronide dehydratase edd, and KDPG aldolase eda in the ED pathway.
[0038] In one embodiment of the present invention, the alanine dehydrogenase encoding gene ald (Gene ID: 48275818) is integrated into the ldhA site (Gene ID: 946315).
[0039] In one embodiment of the present invention, the gene encoding the alanine efflux protein, alaE (Gene ID: 947147), is integrated into the dadX site (Gene ID: 945754).
[0040] In one embodiment of the present invention, the P tac The promoter sequence, the gene encoding glucose-6-phosphate dehydrogenase zwf, the gene encoding phosphoglucuronide dehydratase edd, and the gene encoding KDPG aldolase eda were integrated into the pflB site (Gene ID: 945514).
[0041] In one embodiment of the present invention, the nucleotide sequence of the alanine dehydrogenase encoding gene ald is shown in SEQ ID NO. 10; the nucleotide sequence of the alanine efflux protein encoding gene alaE is shown in SEQ ID NO. 2; and the P tac The nucleotide sequence of the promoter is shown in SEQ ID NO.3; the nucleotide sequence of the gene encoding glucose-6-phosphate dehydrogenase zwf is shown in SEQ ID NO.4; the nucleotide sequence of the gene encoding phosphogluconic acid dehydratase edd is shown in SEQ ID NO.5; and the nucleotide sequence of the gene encoding KDPG aldolase eda is shown in SEQ ID NO.6.
[0042] In one embodiment of the present invention, the recombinant Escherichia coli uses Escherichia coli (Escherichiacoli) as the expression host.
[0043] The present invention also provides a method for preparing L-alanine by fermentation, wherein the method comprises fermenting the above-mentioned recombinant Escherichia coli strain to prepare L-alanine;
[0044] In one embodiment of the present invention, the method is as follows: the recombinant Escherichia coli strain is inoculated into the fermentation medium at a volume ratio of 10%, and aerobic fermentation is carried out in the early stage at a temperature of 33-37°C and stirred at 300-400 rpm for 6-8 hours; anaerobic fermentation is carried out in the later stage at a temperature of 33-37°C and stirred at 100-200 rpm for 40-48 hours.
[0045] In one embodiment of the present invention, the above-mentioned recombinant Escherichia coli strain is inoculated into a seed culture medium and cultured with shaking at 37°C for 8 hours. Then, it is inoculated into a fermentation culture medium at an inoculation rate of 10-15%. In the early stage, aerobic fermentation is carried out at 37°C with an air volume of 1:1 and stirring at 300-400 rpm for 8 hours. In the later stage, anaerobic fermentation is carried out at 37°C with stirring at 100-200 rpm. Fermentation is stopped when the glucose consumption rate slows down.
[0046] In one embodiment of the present invention, the fermentation culture medium used contains: initial glucose 10-20 g / L, MgSO4·7H2O 1-2 g / L, yeast powder 4-6 g / L, (NH4)2SO4 1-3 g / L, K2HPO4 3-5 g / L, betaine 0.5-1 g / L, corn steep liquor 10-20 g / L, and trace elements 1-2 mL / L.
[0047] In one embodiment of the present invention, the trace element composition is: FeSO4·7H2O, 3-5 g / L, CaCl2, 0.5-1.0 g / L, ZnSO4·7H2O, 1-1.5 g / L, CuSO4·5H2O, 0.5-1.0 g / L, (NH4)6Mo7O 24 0.5-1.0 g / L of .4H2O, 0.5-1.0 g / L of Na2B4O7·10H2O, and 0.5-1.0 g / L of CoCl2·6H2O, diluted to 1 L with distilled water, and filtered for sterilization.
[0048] The present invention also provides a method for producing L-alanine using the recombinant Escherichia coli described above.
[0049] In one embodiment, the application is carried out by inoculating the fermenter with 10% of the inoculum at a temperature of 37°C.
[0050] In one embodiment, the application involves controlling the residual sugar level at 2–3 g / L during fermentation, aerating in the early stage and anaerobic in the later stage, maintaining the pH at 6.8–6.9 with concentrated ammonia, and fermenting for 48 hours.
[0051] This invention also provides a method for increasing the L-alanine production intensity of Escherichia coli, which involves the following improvements to Escherichia coli: employing the promoter P tac Tandem overexpression of the genes encoding glucose-6-phosphate dehydrogenase zwf, phosphoglucuronide dehydratase edd, and KDPG aldolase eda in the ED pathway.
[0052] The present invention also provides a method for increasing the production intensity of L-alanine by Escherichia coli, wherein the method comprises overexpressing the above-mentioned alanine dehydrogenase mutant, as well as alanine transporter, glucose-6-phosphate dehydrogenase, phosphoglucuronide dehydratase, and KDPG aldolase derived from Escherichia coli, while knocking out lactate dehydrogenase, alanine racemic enzyme, and pyruvate formate lyase in the Escherichia coli genome.
[0053] In one embodiment of the present invention, the P tac The promoter sequence, the gene encoding glucose-6-phosphate dehydrogenase zwf, the gene encoding phosphoglucuronide dehydratase edd, and the gene encoding KDPG aldolase eda are integrated into the pflB site.
[0054] In one embodiment of the present invention, the nucleotide sequence of the alanine dehydrogenase encoding gene ald is shown in SEQ ID NO. 10; the nucleotide sequence of the alanine efflux protein encoding gene alaE is shown in SEQ ID NO. 2; and the P tacThe nucleotide sequence of the promoter is shown in SEQ ID NO.3; the nucleotide sequence of the gene encoding glucose-6-phosphate dehydrogenase zwf is shown in SEQ ID NO.4; the nucleotide sequence of the gene encoding phosphogluconic acid dehydratase edd is shown in SEQ ID NO.5; and the nucleotide sequence of the gene encoding KDPG aldolase eda is shown in SEQ ID NO.6.
[0055] This invention provides a method for constructing the mutant. Based on homology modeling of alanine dehydrogenase from Bacillus lysine, the mutation site is determined through structural analysis. Mutation primers for site-directed mutagenesis are designed, and the pET28a vector carrying the alanine dehydrogenase gene is used as a template to construct mutant plasmids E76R-pET28a, E76R / D270E-pET28a, and E76R / D270E / A300K-pET28a, respectively. The mutated plasmids are transformed into Escherichia coli BL21(DE3) cells, and positive monoclonal mutants are obtained after selection and verification.
[0056] In one embodiment of the present invention, the method for constructing the mutant is based on homology modeling of alanine dehydrogenase in Lysinibacillus sphaericus, determining the mutation site through structural analysis; designing site-directed mutagenesis primers, and using the pET28a vector carrying the alanine dehydrogenase gene as a template to construct mutant plasmids E76R-pET28a, E76R / D270E-pET28a, and E76R / D270E / A300K-pET28a through site-directed mutagenesis. The mutated plasmids are then transformed into Escherichia coli BL21(DE3) cells, and positive single clones E76R, E76R / D270E, and E76R / D270E / A300K are obtained after selection and verification.
[0057] The present invention also provides the use of the above-mentioned alanine dehydrogenase mutant, or the above-mentioned gene, or the above-mentioned recombinant vector, or the above-mentioned recombinant cell, or the above-mentioned recombinant enzyme catalyst, or the above-mentioned recombinant Escherichia coli strain, or the above-mentioned method in the preparation of L-alanine or products containing L-alanine.
[0058] Beneficial effects
[0059] The *E. coli* strain constructed in this invention can obtain high levels of L-alanine using glucose as a substrate in a short time. The fermentation process of this strain is convenient, and in a 5L fermenter, the yield can reach 150.2 g / L after 48 hours of fermentation, with a production intensity of 3.12 g / L / h. Attached Figure Description
[0060] Figure 1 A diagram illustrating the Ala-1.6 modification strategy;
[0061] Figure 2 The results of fed-batch fermentation of engineered strains Ala-1.1, Ala-1.2, Ala-1.3, Ala-1.4, Ala-1.5, and Ala-1.6 in a 5L fermenter.
[0062] Figure 3 The diagram shows an example of the structure of an alanine dehydrogenase mutant; where A is the conformation diagram of wild-type alanine dehydrogenase residues bound to the substrate pyruvate; and B is the conformation diagram of the mutant bound to the substrate pyruvate. Detailed Implementation
[0063] The plasmids, strains, and primers involved in the following examples are shown in Tables 1-3:
[0064] Table 1: Plasmids used in this application
[0065]
[0066]
[0067] Table 2: Strains involved in this application
[0068]
[0069] Table 3: Primer sequences
[0070]
[0071]
[0072] The culture media involved in the following examples are as follows:
[0073] Primary seed culture medium: 10 g / L NaCl, 5 g / L yeast extract, 10 g / L peptone.
[0074] Secondary seed tank culture medium: initial glucose 10-20 g / L, MgSO4·7H2O 1-2 g / L, yeast extract 4-6 g / L, (NH4)2SO4 1-3 g / L, K2HPO4 3-5 g / L, betaine 0.5-1 g / L, corn steep liquor 10-20 g / L, trace elements 1-2 mL / L.
[0075] Fermentation medium: initial glucose 10-20 g / L, MgSO4·7H2O 1-2 g / L, yeast powder 4-6 g / L, (NH4)2SO4 1-3 g / L, K2HPO4 3-5 g / L, betaine 0.5-1 g / L, corn steep liquor 10-20 g / L, trace elements 1-2 mL / L.
[0076] The detection methods involved in the following embodiments are as follows:
[0077] Cell concentration assay:
[0078] Dilute an appropriate amount of fermentation broth and measure the OD using a UV spectrophotometer at a wavelength of 600 nm. 600 express.
[0079] Liquid chromatography method for L-alanine detection:
[0080] The fermentation broth was centrifuged at 12000 r / min for 10 min, and the supernatant was diluted a certain factor. The content of L-alanine was determined by high performance liquid chromatography (HPLC). The HPLC detection conditions were as follows: The chromatographic column was a Thermo C18 column, 5 μm, 4.6 × 250 mm column; the mobile phase was mobile phase A (sodium acetate-triethylamine): mobile phase B (methanol-acetonitrile); the flow rate was 0.8 mL / min; the column temperature was 40 ℃; and the detector was a UV detector with a wavelength of 338 nm.
[0081] Conversion rate = (yield × fermentation broth volume) / total sugar consumption during fermentation.
[0082] Production intensity: L-alanine yield per unit time, production intensity = yield (g / L) / fermentation time (h).
[0083] Example 1: Construction of an engineered strain Ala-1.1 with the ldhA gene knocked out and the ald gene from Bacillus lysinensis integrated.
[0084] Using *Escherichia coli* W3110 as the starting strain (hereinafter referred to as strain Ala-1.0), the lactate dehydrogenase ldhA gene (Gene ID: 946315) was knocked out, and the lysine-derived alanine dehydrogenase ald gene (Gene ID: 48275818) was integrated to construct the engineered strain Ala-1.1. All gene editing operations were performed using Cas9 gene editing technology.
[0085] The specific method is as follows:
[0086] (1) Using the genome of strain Ala-1.0 (W3110) as a template, the upper and lower homologous arms of the ldhA gene were amplified using primers P1 and P2, P3 and P4. Then, using the ald-pET28a plasmid as a template, the ald gene (SEQ ID NO.1) was amplified using primers P5 and P6. Then, the upper and lower arms and the ald gene were fused together using primers P1 and P4 to form a ldhA knockout and ald-integrated linear fragment. The ldhA knockout and ald-integrated linear fragment could be obtained by electrophoresis separation and gel recovery of the PCR product.
[0087] (2) The ldhA sequence of the gene to be knocked out was uploaded to the CRISPR / Cas9 gene editing website for analysis to obtain the N20 sequence of the gene to be knocked out. The N20 sequence with a high score that is close to the downstream homologous arm and has no self-ligation was selected and replaced with the 20bp plasmid gene sequence of the sgRNA in the pTargetF plasmid to obtain the constructed pTargetF-ldhA plasmid. The pTargetF-ldhA plasmid was amplified using primers P7 and P8 respectively. After purification, the template plasmid was removed using TaKaRa's DpnⅠ digestive enzyme. Then, it was transformed into E. coli Top10 competent cells and the obtained pTargetF-ldhA plasmid was extracted.
[0088] (3) The verified pTargetF-ldhA plasmid and the ldhA knockout and ald linearized fragment were electroporated into strain Ala-1.0. After electroporation, the plasmid was plated on LB+Kan (concentration: 50 mg / mL)+Spe (concentration: 50 mg / mL) plates and cultured at 30℃.
[0089] (4) Colony PCR was performed using validation primers P1 and P4, and positive clones were screened by sequencing;
[0090] (5) Positive strains were inoculated into LB+Kan liquid medium containing 100 mg / mL IPTG and cultured at 30°C and 200 r / min for about 12 h. After induction culture, the bacterial solution was serially diluted and spread onto LB+Kan plates and cultured at 30°C for about 12 h. One LB+Kan plate and one LB+Kan+Spe plate were taken, and small squares were drawn on the bottom of the plates with a marker and numbered. The single colonies on the plates were numbered, and the single colonies on the plates were inoculated onto the LB+Kan plate and LB+Kan+Spe plate in sequence according to the number using a sterilized toothpick or pipette tip. They were cultured at 30°C for about 12 h and the growth of colonies on the two plates was observed. The strains that grew on the LB+Kan plate and did not grow on the LB+Kan+Spe plate were the strains that eliminated the pTargetF plasmid.
[0091] (6) Inoculate the strain that eliminates pTargetF plasmid into LB liquid medium and incubate at 42℃ and 200r / min for about 12h. Then take an appropriate amount of bacterial solution, dilute it and spread it on LB plates. Incubate at 37℃ for 12h. Take one LB plate and one LB+Kan plate, draw small squares on the bottom of the plates with a marker and number the small squares. Use sterilized toothpicks to inoculate single colonies on the plates into the LB plate and LB+Kan plate in sequence according to the numbers. Incubate at 37℃ for 12h and observe the growth of colonies on the two plates. The strain that grows on the LB plate and does not grow on the LB+Kan plate is the strain that eliminates pCas plasmid.
[0092] (7) Finally, the strain with completely eliminated plasmids was inoculated into LB liquid medium and cultured at 37°C. 800 μL of bacterial culture was transferred to a preservation tube, and 800 μL of 30% (v / v) glycerol was added. The strain Ala-1.1 was then constructed.
[0093] Example 2: Construction of an engineered strain Ala-1.2 with the dadX gene knocked out and a gene from alaE (E. coli) integrated into its genome.
[0094] Using Ala-1.1 constructed in Example 1 as the starting strain, the alanine racemase dadX gene (Gene ID: 945754) was knocked out, and the alanine efflux protein alaE (Gene ID: 947147) was integrated to construct the engineered strain Ala-1.2. All gene editing operations were performed using Cas9 gene editing technology. The specific methods are as follows:
[0095] (1) Using the genome of strain Ala-1.1 as a template, the upper and lower homologous arms of the dadX gene were amplified using primers P9 and P10, P11 and P12. Then, using the genome of Escherichia coli W3110 as a template, the alaE gene (SEQ ID NO.2) was amplified using primers P13 and P14. Then, the upper and lower arms and the alaE gene were fused using primers P9 and P12 to form a linearized fragment with dadX knocked out and alaE integrated. The linear fragment with dadX knocked out and alaE integrated was obtained by electrophoresis separation and gel recovery of PCR products.
[0096] (2) The sequence of the gene to be knocked out, dadX, was uploaded to the CRISPR / Cas9 gene editing website for analysis to obtain the sequence of the gene to be knocked out, N20. The N20 sequence with a high score that is close to the downstream homologous arm and has no self-ligation was selected and replaced with the 20bp plasmid gene sequence of the sgRNA in the pTargetF plasmid to obtain the constructed pTargetF-dadX plasmid. The pTargetF-dadX plasmid was amplified by primers P15 and P16 respectively. After purification, the template plasmid was removed by TaKaRa's DpnⅠ digestive enzyme. Then, it was transformed into E. coli Top10 competent cells and the obtained pTargetF-dadX plasmid was extracted.
[0097] (3) The verified pTargetF-dadX plasmid and the linearized alaE fragment with dadX knocked out and integrated were electroporated into the Ala-1.1 strain. After electroporation, the plasmid was plated on LB+Kan (concentration: 50mg / mL)+Spe (concentration: 50mg / mL) plates and cultured at 30℃.
[0098] (4) Colony PCR was performed using validation primers P9 and P12, and positive clones were screened by sequencing;
[0099] (5) Positive strains were inoculated into LB+Kan liquid medium containing 100 mg / mL IPTG and cultured at 30°C and 200 r / min for about 12 h. After induction culture, the bacterial solution was serially diluted and spread onto LB+Kan plates and cultured at 30°C for about 12 h. One LB+Kan plate and one LB+Kan+Spe plate were taken, and small squares were drawn on the bottom of the plates with a marker and numbered. The single colonies on the plates were numbered, and the single colonies on the plates were inoculated onto the LB+Kan plate and LB+Kan+Spe plate in sequence according to the number using a sterilized toothpick or pipette tip. They were cultured at 30°C for about 12 h and the growth of colonies on the two plates was observed. The strains that grew on the LB+Kan plate and did not grow on the LB+Kan+Spe plate were the strains that eliminated the pTargetF plasmid.
[0100] (6) Inoculate the strain that eliminates pTargetF plasmid into LB liquid medium and incubate at 42℃ and 200r / min for about 12h. Then take an appropriate amount of bacterial solution, dilute it and spread it on LB plates. Incubate at 37℃ for 12h. Take one LB plate and one LB+Kan plate, draw small squares on the bottom of the plates with a marker and number the small squares. Use sterilized toothpicks to inoculate single colonies on the plates into the LB plate and LB+Kan plate in sequence according to the numbers. Incubate at 37℃ for 12h and observe the growth of colonies on the two plates. The strain that grows on the LB plate and does not grow on the LB+Kan plate is the strain that eliminates pCas plasmid.
[0101] (7) Finally, the strain with completely eliminated plasmids was inoculated into LB liquid medium and cultured at 37°C. 800 μL of bacterial culture was transferred to a preservation tube, 800 μL of 30% (v / v) glycerol was added, and the culture was stored at -80°C to complete the construction of strain Ala-1.2.
[0102] Example 3: Constructing a genome with the pflB gene knocked out and integrated with promoter P tac A genomic strain Ala-1.3 was constructed by tandem overexpression of the genes encoding glucose-6-phosphate dehydrogenase (zwf), phosphoglucuronide dehydratase (edd), and KDPG aldolase (eda) in the ED pathway.
[0103] Using Ala-1.2 constructed in Example 2 as the starting strain, the gene encoding pyruvate formate lyase pflB (Gene ID: 945514) was knocked out, and the promoter P was integrated. tacThe engineered strain Ala-1.3 was constructed by tandem overexpression of the genes encoding glucose-6-phosphate dehydrogenase (zwf, Gene ID: 946370), phosphoglucuronide dehydratase (edd, Gene ID: 946362), and KDPG aldolase (eda, Gene ID: 946367) in the ED pathway. All gene editing operations were performed using Cas9 gene editing technology.
[0104] The specific method is as follows:
[0105] (1) Using the genome of strain Ala-1.2 as a template, the upstream and downstream homologous arms of the pflB gene, including the promoter P, were amplified using primers P17 and P18, P19 and P20. tac (SEQ ID NO.3), the gene encoding glucose-6-phosphate dehydrogenase zwf was amplified using primers P21 and P22 (SEQ ID NO.4), the gene encoding phosphoglucuronide dehydratase edd was amplified using primers P23 and P24 (SEQ ID NO.5), and the gene encoding KDPG aldolase eda was amplified using primers P25 and P26 (SEQ ID NO.6). Then, primers P17 and P20 were used to amplify the upper and lower arms, P... tac The promoter, the gene encoding glucose-6-phosphate dehydrogenase zwf, phosphoglucuronide dehydratase edd, and the gene encoding KDPG aldolase eda were fused into a linearized fragment, and the linear sequence fragment could be obtained by electrophoresis separation and gel recovery of the PCR product.
[0106] (2) The pflB sequence of the gene to be knocked out was uploaded to the CRISPR / Cas9 gene editing website for analysis to obtain the N20 sequence of the gene to be knocked out. The N20 sequence with a high score that is close to the downstream homologous arm and has no self-ligation was selected and replaced with the 20bp plasmid gene sequence of the sgRNA in the pTargetF plasmid to obtain the constructed pTargetF-pflB plasmid. The pTargetF-pflB plasmid was amplified by primers P27 and P28 respectively. After purification, the template plasmid was removed by TaKaRa's DpnⅠ digestive enzyme. Then, it was transformed into E. coli Top10 competent cells and the obtained pTargetF-pflB plasmid was extracted.
[0107] (3) The verified pTargetF-pflB plasmid and the linearized fragment were electroporated into the Ala-1.2 strain. After electroporation, the plasmid was plated on LB+Kan (concentration: 50 mg / mL)+Spe (concentration: 50 mg / mL) plates and cultured at 30℃.
[0108] (4) Colony PCR was performed using validation primers P17 and P20, and positive clones were screened by sequencing;
[0109] (5) Positive strains were inoculated into LB+Kan liquid medium containing 100 mg / mL IPTG and cultured at 30°C and 200 r / min for about 12 h. After induction culture, the bacterial solution was serially diluted and spread onto LB+Kan plates, streaked in three zones, and cultured at 30°C for about 12 h. One LB+Kan plate and one LB+Kan+Spe plate were taken, and small squares were drawn on the bottom of the plates with a marker and numbered. The single colonies on the plates were numbered, and the single colonies on the plates were inoculated onto LB+Kan plates and LB+Kan+Spe plates in sequence according to their numbers using a sterilized toothpick or pipette tip. They were cultured at 30°C for about 12 h, and the growth of colonies on the two plates was observed. The strains that grew on LB+Kan plates but did not grow on LB+Kan+Spe plates were the strains that eliminated the pTargetF plasmid.
[0110] (6) Inoculate the strain that eliminates pTargetF plasmid into LB liquid medium and incubate at 42℃ and 200r / min for about 12h. Then take an appropriate amount of bacterial solution, dilute it and spread it on LB plates. Incubate at 37℃ for 12h. Take one LB plate and one LB+Kan plate, draw small squares on the bottom of the plates with a marker and number the small squares. Use sterilized toothpicks to inoculate single colonies on the plates into the LB plate and LB+Kan plate in sequence according to the numbers. Incubate at 37℃ for 12h and observe the growth of colonies on the two plates. The strain that grows on the LB plate and does not grow on the LB+Kan plate is the strain that eliminates pCas plasmid.
[0111] (7) Finally, the strain with completely eliminated plasmids was inoculated into LB liquid medium and cultured at 37°C. 800 μL of bacterial culture was transferred to a preservation tube, 800 μL of 30% (v / v) glycerol was added, and the culture was stored at -80°C to complete the construction of strain Ala-1.3.
[0112] Example 4: Construction and application of Escherichia coli alanine dehydrogenase mutant E76R
[0113] Using the Ala-1.3 strain constructed in Example 3 as the starting strain, the 76th amino acid of alanine dehydrogenase (ald) in the genome was mutated from E to R. E76R The nucleotide sequence is shown in SEQ ID NO.7. A high-yield L-alanine strain, Ala-1.4(ald), was constructed. E76R The integration of genes into *E. coli* was accomplished using Cas9 gene editing technology. An example diagram of the alanine dehydrogenase mutant structure is shown below. Figure 3 As shown.
[0114] The specific method is as follows:
[0115] 1. Construction and expression of mutants
[0116] (1) Using the pET28a plasmid (abbreviated as ald-pET28a) containing the ald gene (SEQ ID NO.10) encoded by Bacillus lysine alanine dehydrogenase as a template, the PCR product was obtained by PCR using the E76R mutant primer. The PCR product was then transformed into E. coli Top10 competent cells after being treated with DpnⅠ, and the transformants were selected for sequencing verification.
[0117] The mutation primers are shown below (the italicized and bolded parts are the mutation sites), E76R mutation primer pair:
[0118] E76R upstream: 5'-GTTAAACGCCCGGTTGCAAGC-3'
[0119] E76R downstream: 5'-AACCGGGCGTTTAACTTTCAG-3'
[0120] Sequencing results showed that no random mutations were found except for the required mutation sites, therefore the mutant plasmid E76R-pET28a was successfully constructed.
[0121] (2) Purification and enzyme activity of mutants
[0122] The mutant E76R-pET28a or ald-pET28a was transformed into E. coli BL21(DE3) cells, and transformants were selected for sequencing verification. The verified positive transformants were cultured overnight in LB medium at 37°C, and then inoculated into TB medium at a 2% (v / v) inoculum. When the OD600 reached approximately 0.6-0.8, IPTG was added to a final concentration of 0.04 mM / L, and induction was performed at 25°C for 12 h.
[0123] Fermentation broth was collected and centrifuged at 8000 rpm for 10 min at 4°C to collect cell cells. The collected cells were sonicated in a washing buffer (400 mM NaCl, 25 mM Tris, pH 8.0, 0.05% w / v Triton X-100, 20 mM imidazole). Cell lysates were centrifuged at 12000 rpm for 20 min. The supernatant was passed through a 0.45 μm membrane and then loaded onto a nickel chelate column (the nickel column was pre-equilibrated with washing buffer for 20 min). The column was then washed with 20 column volumes of washing buffer to remove impurities. The target protein was then eluted with 20 mL of elution buffer (400 mM NaCl, 25 mM Tris, pH 8.0, 500 mM imidazole). The eluted protein was further purified using a desalting column and then concentrated by centrifugation using a 30 kDa ultrafiltration tube to obtain purified alanine dehydrogenase mutant and wild-type alanine dehydrogenase.
[0124] The obtained 1 mM alanine dehydrogenase mutant and wild-type enzyme were added to the reaction system, which contained a reaction mixture (100 mM pyruvate, 10 mM NADH, and 2 M NH4Cl). The mixture was incubated at 37 °C and pH 7.0 for 10 minutes. The enzyme activity was then determined by measuring the absorbance at 340 nm using a spectrophotometer.
[0125] The results showed that the enzyme activity of the wild type was 94.18 U / mg, and the enzyme activity of E76R was 102.20 U / mg.
[0126] 2. Genetically engineered bacteria Ala-1.4 (ald E76R Construction of )
[0127] Using the Ala-1.3 strain constructed in Example 3 as the starting strain, the 76th amino acid of alanine dehydrogenase (ald) in the genome was mutated from E to R. E76R The nucleotide sequence is shown in SEQ ID NO.7. The specific steps are as follows:
[0128] (1) The E76R-pET28a plasmid was prepared according to the method in step 1;
[0129] (2) Using the E76R-pET28a plasmid as a template, the E76R alanine dehydrogenase mutant gene (ald) was amplified using primers P5 and P6. E76R Then, using the Ala-1.3 strain genome as a template, primers P1 and P4 were used to extend the upper and lower homologous arms, and the results were compared with those of ald. E76R Genes are fused into a linearized fragment (hereinafter abbreviated as ald) E76R The linear fragment can be obtained by electrophoresis separation and gel recovery of the PCR product;
[0130] (3) The ald sequence of the gene to be knocked out was uploaded to the CRISPR / Cas9 gene editing website for analysis to obtain the N20 sequence of the gene to be knocked out. The N20 sequence with a high score that is close to the downstream homologous arm and has no self-ligation was selected and replaced with the 20bp plasmid gene sequence of the sgRNA in the pTargetF plasmid to obtain the constructed pTargetF-ald plasmid. The pTargetF-ald plasmid was amplified by primers P29 and P30 respectively. After purification, the template plasmid was removed by TaKaRa's DpnⅠ digestive enzyme. Then, it was transformed into E. coli Top10 competent cells and the obtained pTargetF-ald plasmid was extracted.
[0131] (3) Verify the correct pTargetF-ald plasmid and ald E76RThe fragments were electroporated together into the Ala-1.3 strain, and then plated on LB+Kan (concentration: 50 mg / mL)+Spe (concentration: 50 mg / mL) plates and cultured at 30℃.
[0132] (4) Colony PCR was performed using validation primers P1 and P4, and positive clones were screened by sequencing;
[0133] (5) Positive strains were inoculated into LB+Kan liquid medium containing 100 mg / mL IPTG and cultured at 30°C and 200 r / min for about 12 h. After induction culture, the bacterial solution was serially diluted and spread onto LB+Kan plates and cultured at 30°C for about 12 h. One LB+Kan plate and one LB+Kan+Spe plate were taken, and small squares were drawn on the bottom of the plates with a marker and numbered. The single colonies on the plates were numbered, and the single colonies on the plates were inoculated onto the LB+Kan plate and LB+Kan+Spe plate in sequence according to the number using a sterilized toothpick or pipette tip. They were cultured at 30°C for about 12 h and the growth of colonies on the two plates was observed. The strains that grew on the LB+Kan plate and did not grow on the LB+Kan+Spe plate were the strains that eliminated the pTargetF plasmid.
[0134] (6) Inoculate the strain that eliminates pTargetF plasmid into LB liquid medium and incubate at 42℃ and 200r / min for about 12h. Then take an appropriate amount of bacterial solution, dilute it and spread it on LB plates. Incubate at 37℃ for 12h. Take one LB plate and one LB+Kan plate, draw small squares on the bottom of the plates with a marker and number the small squares. Use sterilized toothpicks to inoculate single colonies on the plates into the LB plate and LB+Kan plate in sequence according to the numbers. Incubate at 37℃ for 12h and observe the growth of colonies on the two plates. The strain that grows on the LB plate and does not grow on the LB+Kan plate is the strain that eliminates pCas plasmid.
[0135] (7) Finally, the strain with completely eliminated plasmids was inoculated into LB liquid medium and cultured at 37°C. 800 μL of bacterial culture was transferred to a preservation tube, and 800 μL of 30% (v / v) glycerol was added. The culture was then stored at -80°C to complete the construction of strain Ala-1.4.
[0136] Example 5: Construction and application of Escherichia coli alanine dehydrogenase mutant E76R / D270E
[0137] Using Ala-1.4, constructed in Example 4, as the starting strain, the 270th amino acid of alanine dehydrogenase (ald) in the genome was mutated from D to E to construct the high-yield L-alanine strain Ala-1.5 (ald E76R / D270E The integration of genes into E. coli was accomplished using Cas9 gene editing technology.
[0138] The specific method is as follows:
[0139] 1. Construction and expression of mutants
[0140] (1) Using the E76R-pET28a plasmid constructed in Implementation Case 4 as a template, PCR products were obtained by using D270E or V239L mutant primers. The PCR products were then transformed into E. coli Top10 competent cells after being treated with DpnI, and transformants were selected for sequencing verification.
[0141] The mutation primers are shown below (the italicized and bolded parts are the mutation sites): D270E mutation primer pair:
[0142] D270E upstream: 5'-GCGATTGAACAAGGCGGCATC-3'
[0143] D270E downstream: 5'-GCCTTGTTCAATCGCGATGTC-3'
[0144] V239L mutant primer pair:
[0145] V239L upstream: 5'-GGCGCACTGCTGATCCCGGGC-3'
[0146] V239L downstream: 5'-GATCAGCAGTGCGCCAACAAC-3'
[0147] Sequencing results showed that no random mutations were found except for the required mutation sites, therefore the mutant plasmids E76R / D270E-pET28a and E76R / V239L-pET28a were successfully constructed.
[0148] (2) Following steps (2) and (3) of step 1 in Example 4, enzyme activity was tested. The results showed that the enzyme activity of E76R / D270E was 118.50 U / mg, and the enzyme activity of E76R / V239L was 78.40 U / mg. It can be seen that the mutant E76R / D270E had the best effect, and this mutant was used to construct the strain in the future.
[0149] 2. Genetically engineered bacteria Ala-1.5 (ald E76R / D270E Construction of )
[0150] Using the Ala-1.4 strain constructed in Example 4 as the starting strain, or by mutating the 270th amino acid of alanine dehydrogenase (ald) in the genome from D to E (ald E76R / D270E The nucleotide sequence is shown in SEQ ID NO.8. The specific steps are as follows:
[0151] (1) The E76R / D270E-pET28a plasmid was prepared according to the method in step 1;
[0152] (2) Using the homologous arm obtained in Case 4, and the E76R / D270E-pET28a plasmid as a template, the E76R, D270E alanine dehydrogenase mutant gene (ald) was amplified using primers P5 and P6. E76R / D270E Then, primers P1 and P4 were used to connect the upper and lower homologous arms and ald. E76R / D270E Genes are fused into a linearized fragment (hereinafter abbreviated as ald) E76R / D270E The linear fragment can be obtained by electrophoretic separation and gel recovery of PCR products.
[0153] (3) The pTarget-ald plasmid and ald obtained from implementation case 4 E76R / D270E The linear fragment was electroporated into the Ala-1.4 strain, and then plated on LB+Kan (concentration: 50 mg / mL)+Spe (concentration: 50 mg / mL) plates and cultured at 30℃.
[0154] (4) Colony PCR was performed using validation primers P1 and P4, and positive clones were screened by sequencing;
[0155] (5) Positive strains were inoculated into LB+Kan liquid medium containing 100 mg / mL IPTG and cultured at 30°C and 200 r / min for about 12 h. After induction culture, the bacterial solution was serially diluted and spread onto LB+Kan plates and cultured at 30°C for about 12 h. One LB+Kan plate and one LB+Kan+Spe plate were taken, and small squares were drawn on the bottom of the plates with a marker and numbered. The single colonies on the plates were numbered, and the single colonies on the plates were inoculated onto the LB+Kan plate and LB+Kan+Spe plate in sequence according to the number using a sterilized toothpick or pipette tip. They were cultured at 30°C for about 12 h and the growth of colonies on the two plates was observed. The strains that grew on the LB+Kan plate and did not grow on the LB+Kan+Spe plate were the strains that eliminated the pTargetF plasmid.
[0156] (6) Inoculate the strain that eliminates pTargetF plasmid into LB liquid medium and incubate at 42℃ and 200r / min for about 12h. Then take an appropriate amount of bacterial solution, dilute it and spread it on LB plates. Incubate at 37℃ for 12h. Take one LB plate and one LB+Kan plate, draw small squares on the bottom of the plates with a marker and number the small squares. Use sterilized toothpicks to inoculate single colonies on the plates into the LB plate and LB+Kan plate in sequence according to the numbers. Incubate at 37℃ for 12h and observe the growth of colonies on the two plates. The strain that grows on the LB plate and does not grow on the LB+Kan plate is the strain that eliminates pCas plasmid.
[0157] (7) Finally, the strain with completely eliminated plasmids was inoculated into LB liquid medium and cultured at 37°C. 800 μL of bacterial culture was transferred to a preservation tube, 800 μL of 30% (v / v) glycerol was added, and the culture was stored at -80°C to complete the construction of strain Ala-1.5.
[0158] Example 6: Construction and application of Escherichia coli alanine dehydrogenase mutant E76R / D270E / A300K
[0159] Using Ala-1.5, constructed in Example 5, as the starting strain, the 300th amino acid of alanine dehydrogenase (ald) in the genome was mutated from A to K to construct the high-yield L-alanine strain Ala-1.6 (ald). E76R / D270E / A300K The integration of genes into E. coli was accomplished using Cas9 gene editing technology.
[0160] The specific method is as follows:
[0161] 1. Construction and expression of mutants
[0162] (1) Using the E76R / D270E-pET28a plasmid constructed in Implementation Case 5 as a template, the PCR product was obtained by PCR using the A300K mutant primer. The PCR product was then transformed into E. coli Top10 competent cells after being treated with DpnI, and the transformants were selected for sequencing verification.
[0163] The mutation primers are shown below (the italicized and bolded parts are the mutation sites): A300K mutation primer pair:
[0164] P35 A300K upstream: 5'-GGCGCACTGCTGATCCCGGGC-3'
[0165] P36 A300K downstream: 5'-GATCAGCAGTGCGCCAACAAC-3'
[0166] Sequencing results showed that no random mutations were found except for the required mutation sites, therefore the mutant plasmid E76R / D270E / A300K-pET28a was successfully constructed.
[0167] (2) Following step (2) of step 1 in Example 4, the enzyme activity was detected, and the results showed that the enzyme activity of E76R / D270E / A300K was 131.73 U / mg.
[0168] 2. Genetically engineered bacteria Ala-1.6 (ald E76R / D270E / A300K Construction of )
[0169] Using the Ala-1.5 strain constructed in Example 5 as the starting strain, the 300th amino acid of alanine dehydrogenase (ald) in the genome was mutated from A to K. E76R / D270E / A300K The nucleotide sequence is shown in SEQ ID NO.9. The specific steps are as follows:
[0170] (1) The plasmid E76R / D270E / A300K-pET28a was prepared according to the method in step 1;
[0171] (2) Using the homologous arm obtained in Case 4, and with the E76R / D270E / A300K-pET28a plasmid as a template, the E76R / D270E / A300K alanine dehydrogenase mutant gene (ald) was amplified using primers P5 and P6. E76R / D270E / A300K Then, primers P1 and P4 were used to connect the upper and lower arms and ald. E76R / D270E / A300K Genes are fused into a linearized fragment (hereinafter abbreviated as ald) E76R / D270E / A300K The linear fragment can be obtained by electrophoretic separation and gel recovery of PCR products.
[0172] (3) The pTarget-ald plasmid and ald obtained from implementation case 4 E76R / D270E / A300K The linear fragment was electroporated into the Ala-1.5 strain, and then plated on LB+Kan (concentration: 50 mg / mL)+Spe (concentration: 50 mg / mL) plates and cultured at 30℃.
[0173] (4) Colony PCR was performed using validation primers P1 and P4, and positive clones were screened by sequencing;
[0174] (5) Positive strains were inoculated into LB+Kan liquid medium containing 100 mg / mL IPTG and cultured at 30°C and 200 r / min for about 12 h. After induction culture, the bacterial solution was serially diluted and spread onto LB+Kan plates and cultured at 30°C for about 12 h. One LB+Kan plate and one LB+Kan+Spe plate were taken, and small squares were drawn on the bottom of the plates with a marker and numbered. The single colonies on the plates were numbered, and the single colonies on the plates were inoculated onto the LB+Kan plate and LB+Kan+Spe plate in sequence according to the number using a sterilized toothpick or pipette tip. They were cultured at 30°C for about 12 h and the growth of colonies on the two plates was observed. The strains that grew on the LB+Kan plate and did not grow on the LB+Kan+Spe plate were the strains that eliminated the pTargetF plasmid.
[0175] (6) Inoculate the strain that eliminates pTargetF plasmid into LB liquid medium and incubate at 42℃ and 200r / min for about 12h. Then take an appropriate amount of bacterial solution, dilute it and spread it on LB plates. Incubate at 37℃ for 12h. Take one LB plate and one LB+Kan plate, draw small squares on the bottom of the plates with a marker and number the small squares. Use sterilized toothpicks to inoculate single colonies on the plates into the LB plate and LB+Kan plate in sequence according to the numbers. Incubate at 37℃ for 12h and observe the growth of colonies on the two plates. The strain that grows on the LB plate and does not grow on the LB+Kan plate is the strain that eliminates pCas plasmid.
[0176] (7) Finally, the completely plasmid-free strain was inoculated into LB liquid medium and cultured at 37°C. 800 μL of the bacterial culture was transferred to a preservation tube, and 800 μL of 30% (v / v) glycerol was added. The strain Ala-1.6 was then constructed. Figure 1 ).
[0177] Example 7: Recombinant strains Ala-1.1, Ala-1.2, Ala-1.3, Ala-1.4, Ala-1.5, and Ala-1.6 were subjected to fed-batch fermentation in 5L fermenters.
[0178] The recombinant strains Ala-1.1, Ala-1.2, Ala-1.3, Ala-1.4, Ala-1.5 and Ala-1.6 prepared in Examples 1 to 6 were used for fermentation according to the following loading process: frozen glycerol tube → slant activation → primary shake flask seed → secondary seed tank → fermenter.
[0179] (1) Slant activation: The bacterial cells in the frozen glycerol tubes stored at -80℃ were streaked onto LB slant medium and incubated at 37℃ for about 12 hours.
[0180] (2) Primary shake-flask seed culture: Wash the bacterial growth off the slant culture medium with LB medium, and inoculate it into a 500mL Erlenmeyer flask containing 100mL of primary seed culture medium at an inoculation rate of 2% (v / v). Incubate at 37℃ for 4-5 hours at 180r / min. OD 600 The first-grade seed solution was obtained when the pH was between 3.0 and 4.0.
[0181] (3) Secondary seed tank culture: Inoculate the primary seed culture into a 2L secondary seed tank culture medium at an inoculation rate of 2-5% (v / v), and culture at 37℃ for 6-8 hours. Adjust the pH to approximately 6.8-6.9 with 25% ammonia water. OD 600 A secondary seed solution was obtained at a concentration between 20.0 and 25.0.
[0182] (4) 5L Dibier parallel reactor fermentation: The initial liquid volume of the fermenter is 2L. The secondary seed liquid is inoculated into the fermentation medium at an inoculation rate of 10% (v / v) of the total volume. The temperature is 37℃, the initial aeration rate is controlled at 2L / min, and ammonia water is added during the fermentation process to control the pH to 6.8~6.9. After 8 hours of aeration in the early stage, it is switched to anaerobic fermentation.
[0183] Fermentation medium: initial glucose 10-20 g / L, MgSO4·7H2O 1-2 g / L, yeast powder 4-6 g / L, (NH4)2SO4 1-3 g / L, K2HPO4 3-5 g / L, betaine 0.5-1 g / L, corn steep liquor 10-20 g / L, trace elements 1 mL / L.
[0184] The yield of L-alanine after 48 hours of fermentation was measured. The results showed that after 48 hours of fermentation, the yield of each strain ( Figure 2 )as follows:
[0185] The L-alanine yield of strain Ala-1.1 can reach 62.4 g / L;
[0186] The L-alanine production of strain Ala-1.2 can reach 87.8 g / L;
[0187] The L-alanine production of strain Ala-1.3 can reach 112.5 g / L;
[0188] The L-alanine production of strain Ala-1.4 can reach 133.8 g / L;
[0189] The L-alanine yield of strain Ala-1.5 can reach 139.7 g / L;
[0190] The L-alanine production of strain Ala-1.6 can reach 150.2 g / L.
[0191] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. An alanine dehydrogenase mutant, characterized in that, The mutant is: the glutamic acid at position 76 of the alanine dehydrogenase, as shown in SEQ ID NO.1, is mutated to arginine, and named E76R; Alternatively, the amino acid sequence of alanine dehydrogenase, as shown in SEQ ID NO.1, can be mutated from glutamic acid at position 76 to arginine, and the aspartic acid at position 270 can be mutated to glutamic acid, named E76R / D270E. Alternatively, the amino acid sequence of alanine dehydrogenase, as shown in SEQ ID NO.1, can be mutated from glutamic acid at position 76 to arginine, from aspartic acid at position 270 to glutamic acid, and from alanine at position 300 to lysine, and named E76R / D270E / A300K.
2. The gene encoding the mutant of claim 1.
3. A recombinant vector carrying the gene of claim 2.
4. A recombinant cell expressing the mutant of claim 1 or carrying the gene of claim 2 or the recombinant vector of claim 3.
5. The recombinant cell according to claim 4, characterized in that, The recombinant cells use bacteria or fungi as expression hosts.
6. A recombinant enzyme catalyst containing the alanine dehydrogenase mutant of claim 1, characterized in that, The recombinase catalyst is any one of the following forms: (1) Culture the recombinant expression transformant and isolate the transformant cells containing the recombinase; (2) Culture the recombinant expression transformant, isolate the transformant cells containing the recombinase, and break the transformant cells containing the recombinase to obtain the cell lysate; (3) Cultivate recombinant expression transformants, isolate transformant cells containing the recombinant enzyme, break the transformant cells containing the recombinant enzyme, obtain cell lysate, and freeze-dry the cell lysate of the recombinant enzyme to obtain lyophilized enzyme powder.
7. A method for improving the catalytic efficiency of alanine dehydrogenase for pyruvate, characterized in that, The method involves mutating glutamic acid at position 76 of alanine dehydrogenase, as shown in SEQ ID NO.1, to arginine. Alternatively, the amino acid sequence of alanine dehydrogenase, as shown in SEQ ID NO.1, may be mutated from glutamic acid at position 76 to arginine, and the amino acid sequence of aspartic acid at position 270 may be mutated to glutamic acid. Alternatively, the amino acid sequence of alanine dehydrogenase, as shown in SEQ ID NO.1, can be mutated from glutamic acid at position 76 to arginine, from aspartic acid at position 270 to glutamic acid, and from alanine at position 300 to lysine.
8. A recombinant Escherichia coli strain with enhanced L-alanine production intensity, characterized in that, The recombinant Escherichia coli overexpresses the alanine dehydrogenase mutant of claim 1, as well as alanine transporter, glucose-6-phosphate dehydrogenase, phosphoglucuronide dehydratase, and KDPG aldolase derived from Escherichia coli, while simultaneously knocking out lactate dehydrogenase, alanine racemic enzyme, and pyruvate formate lyase on the Escherichia coli genome.
9. The recombinant Escherichia coli strain according to claim 8, characterized in that, Using promoter P tac Tandem reinforcement of glucose-6-phosphate dehydrogenase, phosphoglucuronide dehydratase, and KDPG aldolase in the E. coli-derived ED pathway.
10. The recombinant Escherichia coli strain according to claim 9, characterized in that, The nucleotide sequence encoding the alanine transporter is shown in SEQ ID NO.2; the promoter P tac The nucleotide sequence is shown in SEQ ID NO.3; the nucleotide sequence encoding the glucose-6-phosphate dehydrogenase is shown in SEQ ID NO.4; the nucleotide sequence encoding the phosphogluconic acid dehydratase is shown in SEQ ID NO.5; and the nucleotide sequence encoding the KDPG aldolase is shown in SEQ ID NO.
6.
11. The recombinant Escherichia coli strain according to claim 10, characterized in that, The recombinant Escherichia coli is Escherichia coli (E. coli) Escherichia coli W3110 is the expression host.
12. The recombinant Escherichia coli strain according to claim 11, characterized in that, The recombinant *E. coli* strain is composed of a mutant strain with lactate dehydrogenase knocked out and alanine dehydrogenase integrated, alanine racemase knocked out and alanine transporter integrated, and pyruvate formate lyase knocked out and integrated with promoter P. tac Tandem reinforcement of glucose-6-phosphate dehydrogenase, phosphoglucuronide dehydratase, and KDPG aldolase in the E. coli-derived ED pathway.
13. A method for preparing L-alanine by fermentation, characterized in that, The method involves fermenting L-alanine using any one of the recombinant Escherichia coli strains described in claims 8 to 12.
14. The method according to claim 13, characterized in that, The method involves inoculating the recombinant Escherichia coli into a fermentation medium, performing aerobic fermentation in the early stage at a temperature of 33-37 ℃ and stirring at 300-400 rpm for 6-8 h; and performing anaerobic fermentation in the later stage at a temperature of 33-37 ℃ and stirring at 100-200 rpm for 40-48 h.
15. A method for increasing the production intensity of L-alanine by *Escherichia coli*, characterized in that, The *E. coli* strain overexpresses the alanine dehydrogenase mutant of claim 1, as well as alanine transporter, glucose-6-phosphate dehydrogenase, phosphoglucuronide dehydratase, and KDPG aldolase derived from *E. coli*, while simultaneously knocking out lactate dehydrogenase, alanine racemic enzyme, and pyruvate formate lyase from the *E. coli* genome.
16. The use of the alanine dehydrogenase mutant of claim 1, the gene of claim 2, the recombinant vector of claim 3, the recombinant cell of claim 4 or 5, the recombinase catalyst of claim 6, or the recombinant Escherichia coli strain of any one of claims 8 to 12 in the preparation of L-alanine or products containing L-alanine.
Citation Information
Patent Citations
L-alanine dehydrogenase as well as preparation method and application thereof
CN117384875A
Genetic engineering strain for improving de novo fermentation yield and conversion rate of L-theanine, method and application
CN117821356A