Rice osklp protein and its coding gene in regulating plant growth and development

Abstract

The application discloses rice OsKLP protein and application of an encoding gene thereof in regulating plant growth and development. The application provides application of the OsKLP protein or the OsKLP gene in regulating plant fertility and / or plant height and / or tiller number. The application also provides application of the OsKLP protein or the OsKLP gene as a target for inhibition in plant breeding; the target of the plant breeding is to breed plants with reduced fertility and / or reduced plant height and / or reduced tiller number. The OsKLP protein is shown as SEQ ID NO:1. The application provides a new thought and a potential target for rice molecular breeding.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to the application of rice OsKLP protein and its encoding gene in regulating plant growth and development. Background Technology

[0002] Rice (Oryza sativa L.) is a staple food source for more than half of the world's population, and increasing its yield is crucial for global food security. Rice yield is influenced by a variety of factors, among which plant architecture and floral organ development are key factors.

[0003] Plant architecture is an important agronomic trait in rice, closely related to yield, quality, and stress resistance. Tillering is a crucial indicator in plant architecture research; it forms in the unelongated basal internodes and grows independently of the mother stem (stem) through its own adventitious roots. Tillering increases the number of leaves in the rice plant, thereby expanding the photosynthetic area. More leaves mean more photosynthetic products, which contributes to increased biomass and ultimately, yield. Although the morphology and histology of rice tillers, as well as some rice tiller mutants, have been well described, the molecular mechanisms of rice tillering remain to be elucidated. Tillering is the ability of a rice plant to produce new branches from the base of the main stem; these branches can form additional panicles, thus increasing yield.

[0004] Plant height is one of the important agronomic traits affecting rice plant architecture. Since the "Green Revolution," through research on the plant hormone gibberellin, scientists have successfully bred high-yielding rice with semi-dwarf trait, significantly increasing grain yield. Dwarfism and semi-dwarfism are key indicators for lodging resistance and high-yield breeding in rice. Therefore, identifying genes related to internode elongation in rice, analyzing their molecular mechanisms affecting internode elongation, and exploring their relationship with gibberellin regulatory pathways are of great significance for improving rice yield. Summary of the Invention

[0005] The purpose of this invention is to provide the application of rice OsKLP protein and its encoding gene in regulating plant growth and development.

[0006] This invention provides the application of OsKLP protein or OsKLP gene in regulating plant fertility and / or plant height and / or tiller number.

[0007] For fertility, the regulation is positive.

[0008] Increased OsKLP protein content enhances plant fertility.

[0009] Decreased OsKLP protein content reduces plant fertility.

[0010] Increased abundance of the OsKLP gene increases plant fertility.

[0011] Decreased abundance of the OsKLP gene reduces plant fertility.

[0012] The regulation is positive in terms of tiller quantity.

[0013] Increased OsKLP protein content leads to an increase in the number of plant tillers.

[0014] Decreased OsKLP protein content reduces the number of plant tillers.

[0015] Increased abundance of the OsKLP gene leads to an increase in the number of tillers in plants.

[0016] Decreased abundance of the OsKLP gene reduces the number of tillers in plants.

[0017] For plant height, the regulation described is positive.

[0018] Increased OsKLP protein content leads to increased plant height.

[0019] Decreased OsKLP protein content reduces plant height.

[0020] Increased abundance of the OsKLP gene leads to increased plant height.

[0021] Decreased abundance of the OsKLP gene reduces plant height.

[0022] This invention also provides the application of the OsKLP protein or OsKLP gene as a repressive target in plant breeding; the goal of the plant breeding is to cultivate plants with reduced fertility and / or reduced plant height and / or reduced tillering number. The plant is a plant possessing the OsKLP gene.

[0023] This invention also provides the application of substances that inhibit the OsKLP protein or the OsKLP gene in plant breeding; the goal of the plant breeding is to cultivate plants with reduced fertility and / or reduced plant height and / or reduced tillering number. The plant is a plant possessing the OsKLP gene. Inhibiting the OsKLP gene specifically involves inhibiting OsKLP gene expression. The substance that inhibits OsKLP gene expression specifically includes a gene editing vector targeting the OsKLP gene. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located in the OsKLP gene. Specifically, the targets of the sgRNA are: “TCACGGGCCGCCTCATGCCG” and “TATGCTGTCCCCGGATCGGG”.

[0024] This invention also provides a method for cultivating plants with reduced fertility and / or reduced plant height and / or reduced tillering number, comprising the following steps: deleting the following two segments of the OsKLP gene in the plant genomic DNA using homozygous mutations: "CTCATGCCGC" and "CCTCCCGATCCGGGGACA". The plant is a plant possessing the OsKLP gene. A homozygous mutation is defined as the identical mutation occurring on a pair of homologous chromosomes.

[0025] This invention also provides a method for cultivating plants with reduced fertility and / or reduced plant height and / or reduced tillering number, comprising the following steps: gene editing of the OsKLP gene in a recipient plant to obtain gene-edited plants; and screening from the gene-edited plants for plants with reduced fertility and / or reduced plant height and / or reduced tillering number relative to the recipient plant. The recipient plant is a plant possessing the OsKLP gene. The gene editing is achieved by introducing a gene-editing vector. The gene-editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located in the OsKLP gene. Specifically, the targets of the sgRNA are: “TCACGGGCCGCCTCATGCCG” and “TATGCTGTCCCCGGATCGGG”.

[0026] This invention also provides a method for cultivating plants with reduced fertility and / or reduced plant height and / or reduced tillering number, comprising the following steps: inhibiting the expression of the OsKLP gene in a recipient plant to obtain a plant with reduced fertility and / or reduced plant height and / or reduced tillering number relative to the recipient plant. The plant is a plant possessing the OsKLP gene. Inhibition of OsKLP gene expression in the recipient plant can be specifically achieved by introducing a substance that inhibits OsKLP gene expression into the recipient plant. The substance that inhibits OsKLP gene expression can specifically be a gene editing vector targeting the OsKLP gene. Inhibition of OsKLP gene expression in the recipient plant is specifically achieved by introducing a gene editing vector. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located in the OsKLP gene. Specifically, the targets of the sgRNA are: “TCACGGGCCGCCTCATGCCG” and “TATGCTGTCCCCGGATCGGG”.

[0027] This invention also provides a method for cultivating plants with reduced fertility and / or reduced plant height and / or reduced tillering number, comprising the following steps: reducing the content of OsKLP protein in the plant to reduce the plant's fertility and / or plant height and / or tillering number. The plant is a plant possessing the OsKLP gene.

[0028] Reducing rice fertility has important practical value in specific scenarios, especially in fields such as weed control, prevention of gene drift, optimization of hybrid seed production, and basic scientific research.

[0029] This invention also provides the application of OsKLP protein-related biomaterials in the cultivation of transgenic plants with increased fertility and / or increased plant height and / or increased tillering number. The plants in question are those that do not possess the OsKLP gene.

[0030] This invention also provides a method for cultivating plants with increased fertility and / or increased plant height and / or increased number of tillers, comprising the following steps: introducing the OsKLP gene into a recipient plant to obtain a plant with increased fertility and / or increased plant height and / or increased number of tillers relative to the recipient plant. The plant is a plant that does not possess the OsKLP gene.

[0031] The OsKLP protein mentioned above is (a1) or (a2) or (a3) ​​or (a4) as follows:

[0032] (a1) The protein shown in SEQ ID NO: 1;

[0033] (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0034] (a3) Proteins related to plant fertility and / or plant height and / or tiller number obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1).

[0035] (a4) is a protein derived from rice that shares more than 98% identity with (a1) and is associated with plant fertility and / or plant height and / or tiller number.

[0036] The specific labels are shown in Table 1.

[0037] Table 1: Label Sequence

[0038] Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL

[0039] The OsKLP gene mentioned above is the gene encoding the OsKLP protein.

[0040] The OsKLP gene is one of the following (b1) or (b2) or (b3) or (b4) or (b5):

[0041] (b1) A DNA molecule with a coding region as shown in SEQ ID NO: 2;

[0042] (b2) The DNA molecule shown at positions 180-10851 of SEQ ID NO: 3;

[0043] (b3) The DNA molecule shown in SEQ ID NO: 3;

[0044] (b4) A DNA molecule derived from rice that has more than 95% identity with (b1) or (b2) or (b3) and that encodes the protein thereon;

[0045] (b5) A DNA molecule that hybridizes under stringent conditions with a nucleotide sequence defined by (b1) or (b2) or (b3) and encodes the protein.

[0046] The above stringent conditions can be achieved by hybridization at 65°C and washing the membrane in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS during DNA or RNA hybridization experiments.

[0047] The OsKLP protein-related biomaterial is any one of the following (c1) to (c4):

[0048] (c1) Nucleic acid molecule encoding the OsKLP protein;

[0049] (c2) An expression cassette containing the nucleic acid molecule described in (c1);

[0050] (c3) A recombinant vector containing the nucleic acid molecule described in (c1) or a recombinant vector containing the expression cassette described in (c2);

[0051] (c4) A recombinant microorganism containing the nucleic acid molecule described in (c1), or a recombinant microorganism containing the expression cassette described in (c2), or a recombinant microorganism containing the recombinant vector described in (c3).

[0052] The specific nucleic acid molecule that encodes the OsKLP protein can be the OsKLP gene.

[0053] The recombinant vector may specifically be a recombinant expression vector.

[0054] Specifically, any of the recombinant expression vectors described above can be recombinant plasmids obtained by inserting the double-stranded DNA shown in SEQ ID NO: 4 into the multiple cloning site (e.g., KpnI and XbaI restriction sites) of the pCAMBIA2300 vector.

[0055] The fertility described above is reflected in the fruit setting rate. A decrease in fertility described above is reflected in a decrease in the fruit setting rate. An increase in fertility described above is reflected in an increase in the fruit setting rate.

[0056] Any of the above-mentioned plants can be monocotyledonous or dicotyledonous. Any of the above-mentioned plants can be plants of the Poaceae family. Any of the above-mentioned plants can be plants of the genus *Oryza*. Specifically, any of the above-mentioned plants can be rice. Specifically, any of the above-mentioned plants can be *Dongj* rice.

[0057] This invention provides new ideas and potential targets for molecular breeding of rice. Attached Figure Description

[0058] Figure 1 This is a schematic diagram of the components of the pCBSG032 carrier.

[0059] Figure 2 This is a graph showing the sequencing results of the osklp mutant strain.

[0060] Figure 3 These are photographs of the plant phenotype and stem node phenotype in Example 2.

[0061] Figure 4 This is a photograph of the pollen after staining in Example 2.

[0062] Figure 5 The results are for plant height, seed setting rate, and number of tillers in Example 2.

[0063] Figure 6 This is a schematic diagram of the components of the pCAMBIA2300 carrier.

[0064] Figure 7 This is a photograph of the plant phenotype in Example 4. Detailed Implementation

[0065] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0066] Unless otherwise specified, the experimental methods in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. Unless otherwise specified, the quantitative experiments in the following examples are all performed in triplicate, and the results are averaged. Seed setting rate = number of filled seeds ÷ (number of filled seeds + number of empty seeds) × 100%.

[0067] pCBSG032 carrier (see component schematic diagram) Figure 1): Weimi Biotechnology Co., Ltd. The pCBSG032 vector is described in the following literature: Tian Y, Zhong D, Li X, Shen R, Han H, Dai Y, Yao Q, Zhang X, Deng Q, Cao X, Zhu JK, Lu Y. High-throughput genome editing in rice with a virus-based surrogate system. J Integr Plant Biol. 2022 Oct 11. doi:10.1111 / jipb.13381. Epub ahead of print. PMID:36218268.

[0068] The vector pYLsgRNA-OsU3 is described in the following literature: Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. MolPlant. 2015 Aug;8(8):1274-84. doi:10.1016 / j.molp.2015.04.007. Epub 2015Apr24.PMID:25917172.

[0069] Rice Dongjin, belonging to the japonica rice variety (Oryza sativa L. subsp. japonica), is also known as japonica rice Dongjin and is an existing rice germplasm resource. In this example, the rice Dongjin plant is also referred to as a wild-type plant, denoted by WT. Sequencing verification showed that the genomic DNA of rice Dongjin contains the DNA segment shown in SEQ ID NO: 3, and the cDNA of rice Dongjin contains the DNA segment shown in SEQ ID NO: 2, encoding the OsKLP protein shown in SEQ ID NO: 1.

[0070] The formulation of N6 basic culture medium is shown in Table 2.

[0071] Table 2

[0072]

[0073] Callus induction medium (pH 5.8): Based on N6 basic medium, inositol (concentration of 100 mg / L), 2,4-D (concentration of 2 mg / L), proline (concentration of 2.878 g / L), enzymatically hydrolyzed casein (concentration of 300 mg / L), sucrose (concentration of 30 g / L), and plant gel (concentration of 2.6 g / L) were added.

[0074] Co-culture medium (pH 5.2): Based on N6 basic medium, add acetosyringone (to a concentration of 100 μM), glucose (to a concentration of 10 g / L), and plant gel (to a concentration of 2.6 g / L).

[0075] Screening medium (pH 5.8): Based on N6 basic medium, hydrolyzed casein (concentration in the medium is 500 mg / L), 2,4-D (concentration in the medium is 2 mg / L), proline (concentration in the medium is 2.8 g / L), sucrose (concentration in the medium is 30 g / L), G418 (concentration in the medium is 150 mg / L), cephalosporin (concentration in the medium is 500 mg / L), and plant gel (concentration in the medium is 2.6 g / L).

[0076] Differentiation medium (pH 5.8): Based on N6 basic medium, add kinetin (concentration of 2 mg / L), NAA (concentration of 0.02 mg / L), sucrose (concentration of 30 g / L), sorbitol (concentration of 30 g / L), acid-hydrolyzed casein (concentration of 2 g / L), and plant gel (concentration of 2.6 g / L).

[0077] Rooting medium (pH 5.8): contains 1 / 4 concentration of MS inorganic salts, 1× concentration of MS vitamins, 0.5 mg / L NAA, 1 mg / L paclobutrazol, 2.6 g / L plant gel, and the remainder is water.

[0078] The formulation of AAM infection solution (pH 5.2) is shown in Table 3.

[0079] Table 3

[0080]

[0081] Example 1: Preparation of mutant plants

[0082] I. Preparation of recombinant plasmids

[0083] 1. Using the vector pYLsgRNA-OsU3 as a template, PCR amplification was performed using primer pairs consisting of 10g36880-032double-F and 10g36880-032double-R, and the PCR amplification product (approximately 583bp) was recovered.

[0084] 10g36880-032double-F (upstream primer):

[0085] 5'-gatgGGTCTCATGTG TCACGGGCCGCCTCATGCCG GTTTTAGAGCTAGAAA-3';

[0086] 10g36880-032 double-R (downstream primer): 5'-CGCAAGCACCGAATTG TATGCTGTCCCCGGATCG GG GTTTAGAGACCCCAA-3'.

[0087] 2. Take the pCBSG032 vector, digest it with the restriction endonuclease BsaⅠ, and recover the digestion product (linearized vector backbone).

[0088] 3. Take the PCR amplification product obtained in step 1, digest it with restriction endonuclease BsaⅠ, and recover the digested product.

[0089] 4. Ligate the enzyme digestion products obtained in step 2 and step 3 to obtain the recombinant plasmid, which is the gene editing vector. The recombinant plasmid has been sequenced and verified. The recombinant plasmid contains two sgRNA expression cassettes, expressing two sgRNAs. One sgRNA targets “TCACGGGCCGCCTCATGCCG”, and the other sgRNA targets “TATGCTGTCCCCGGATCGGG”.

[0090] II. Preparation of mutant plants using CRSPR / Cas9 technology

[0091] 1. Callus induction and subculture

[0092] Mature seeds of rice (Dongjin) were taken, the glumes were removed, and the seeds were disinfected with 75% ethanol solution for 1 minute, then rinsed with sterile water, then disinfected with 30% sodium hypochlorite solution for 20 minutes, then thoroughly washed with sterile water, and the moisture on the seed surface was absorbed with sterile filter paper. The seeds were then transferred to callus induction medium for culture to obtain callus tissue for Agrobacterium infection.

[0093] 2. Preparation of Agrobacterium suspension

[0094] The gene-editing vector prepared in step one was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium. The recombinant Agrobacterium was cultured and the bacterial cells were collected, suspended in AAM infection solution, and OD was obtained. 600nm The value is 0.3-0.5 for Agrobacterium suspension.

[0095] 3. Agrobacterium infection

[0096] Take the callus tissue obtained in step 1, immerse it in the Agrobacterium suspension prepared in step 2, infect it at room temperature for 20 minutes (shaking it occasionally during the process), then take out the callus tissue, absorb the excess bacterial solution with sterile filter paper, and then transfer it to a co-culture medium covered with a layer of sterile filter paper, and incubate it in the dark at 26°C for 3 days.

[0097] 4. Screening and Cultivation

[0098] After completing step 3, take the callus tissue, rinse it twice with sterile water, then rinse it once with carbenicillin solution, remove excess water with a pipette, transfer it to sterile filter paper, air dry the surface moisture on a laminar flow hood, and then transfer it to a selection medium containing hygromycin. Incubate in the dark at 28-30℃ for 3-4 weeks. At this time, you can observe the growth of positive callus with a bright yellow color and a diameter of 1-2 mm.

[0099] 5. Differentiation and regeneration

[0100] Take the positive callus obtained in step 4, transfer it to differentiation medium, and culture it at 28-30℃ with alternating light and dark conditions (16h light / 8h darkness). After about 10 days of culture, green spots can be observed emerging from the callus, and seedlings will differentiate after another 10 days of culture. The differentiated seedlings will grow to a height of 2-3cm.

[0101] 6. Rooting

[0102] Take the seedlings obtained in step 5 and transfer them to rooting medium. Incubate them at 28-30℃ with alternating light and dark conditions (16h light / 8h darkness). The rooted seedlings are the T0 generation plants.

[0103] III. Identification of Mutation Types

[0104] The T0 generation plants obtained in step two are self-pollinated and their seeds are harvested. The seeds are then cultivated into plants, which are the T1 generation plants.

[0105] Leaves from T1 generation plants were collected, and genomic DNA was extracted. PCR amplification was performed using primers consisting of GP36880F and GP36880R. The amplified products were then recovered and sequenced. Mutant strains were screened based on the sequencing results.

[0106] GP36880F: TTCGGTTTCCGTGCGGGAT;

[0107] GP36880R:CGCACAAGCAACTGAAGCATA.

[0108] One homozygous mutant was screened from the T1 generation plants and named the osklp mutant.

[0109] Compared to the wild-type plant's genomic DNA, the coding region of the OsKLP gene in the osklp mutant strain has the following two segments deleted in a homozygous form (the same changes have occurred in both homologous chromosomes): "CTCATGCCG". C "and "CCTCCCGATCCG GGG "ACA", other sequences remained unchanged. Sequencing results are shown below. Figure 2 .

[0110] Example 2, Phenotypic Comparison

[0111] Seeds used in the test: seeds of wild-type plants and seeds obtained by self-pollination of the osklp mutant obtained in Example 1.

[0112] The tested seeds were sown and cultured until germination, and then transferred to a field in the suburbs of Beijing for normal cultivation and management.

[0113] Phenotypic photos of plants at the jointing stage can be found Figure 3 The left image. A photo of the stem segment can be found in [the image]. Figure 3 The image on the right.

[0114] During the flowering period, pollen-bearing florets were collected, and the anthers were dissected under a stereomicroscope. I2-KI solution (I2-KI solution: 0.5g KI dissolved in 1.25mL deionized water, 0.25g iodine tablets added, then diluted to 75mL, stored away from light) was added, and the anthers were quickly crushed to release pollen. The pollen was then observed under a microscope. See photos below. Figure 4 .

[0115] At maturity, plant height was measured, and the seed setting rate and number of tillers were recorded. The results for plant height, seed setting rate, and number of tillers are shown below. Figure 5 (The sample size for each tested plant was 10 plants).

[0116] During the seedling stage, there were no significant differences in morphology among the plants. At the jointing stage, the growth rate of the offspring plants of the mutant was significantly lower than that of the wild-type plants. At maturity, the plant height of the offspring plants of the mutant was significantly shorter than that of the wild-type plants, which were approximately 115.7 cm tall, while the mutant plants were only 85 cm tall. Compared with the wild-type plants, the seed setting rate of the offspring plants of the mutant was significantly lower, with the wild-type plants having a seed setting rate of 93.86%, while the mutant plants had a seed setting rate of 33.27%. Compared with the wild-type plants, the number of tillers in the offspring plants of the mutant was significantly lower, with the wild-type plants averaging 19.1 effective tillers, while the mutant plants averaged 12.1 effective tillers. Observation of stem nodes revealed that about half of the offspring plants of the mutant plants had one less visible elongated stem node than the wild-type plants, and the internodes of the offspring plants of the mutant plants were significantly shorter than those of the wild-type plants.

[0117] Example 3: Preparation of replanted plants

[0118] I. Preparation of recombinant plasmids

[0119] The double-stranded DNA shown in SEQ ID NO: 4 was inserted into the pCAMBIA2300 vector (see schematic diagram of the pCAMBIA2300 vector). Figure 6 The recombinant plasmid was obtained by cutting the KpnI and XbaI restriction sites between the enzymes. The recombinant plasmid has been verified by sequencing.

[0120] II. Preparation of Replenished Plants

[0121] The mature seeds of rice Dongjin were replaced by mature seeds obtained by self-pollination of the osklp mutant strain obtained in Example 1, the gene editing vector was replaced by the recombinant plasmid prepared in step one, and the selection medium containing kanamycin was replaced by the selection medium containing hygromycin. The rest was the same as step two of Example 1.

[0122] III. Screening for homozygous transgenic plants

[0123] The T0 generation plants obtained in step two are self-pollinated and their seeds are harvested. The seeds are then cultivated into plants, which are the T1 generation plants.

[0124] Transgenic plants are selected from T1 generation plants and are called T1 generation transgenic plants.

[0125] The T1 generation transgenic plants were self-pollinated and the seeds were harvested. The seeds were then cultivated into plants, which are the T2 generation plants.

[0126] For a given T1 generation transgenic plant, if all T2 generation plants obtained through self-pollination are transgenic plants, then the T1 generation transgenic plant is a homozygous transgenic plant, and all its self-pollinated offspring are homozygous transgenic plants.

[0127] Methods for screening or identifying transgenic plants: Take leaves from the plant, extract genomic DNA, and perform PCR amplification using a primer pair consisting of GP2300KanF and GP2300KanR (the primers target the kanamycin resistance gene on the vector, with a target fragment of 328bp). If the amplified product of the expected size is obtained, the plant is a transgenic plant.

[0128] GP2300KanF: TGTCATACCACTTGTCCGCC;

[0129] GP2300KanR: ATCGAGCTGTATGCGGAGTG.

[0130] Example 4: Phenotypic Comparison

[0131] Seeds tested: seeds of wild-type plants, seeds obtained by self-pollination of the osklp mutant obtained in Example 1, and seeds obtained by self-pollination of the T1 generation homozygous transgenic plants obtained in Example 3.

[0132] The tested seeds were sown and cultured until germination, and then transferred to a field in the suburbs of Beijing for normal cultivation and management.

[0133] Phenotypic photos of plants at the jointing stage can be found Figure 7 . Figure 7 In this context, WT represents the wild-type plant, osklp represents the self-crossed progeny of the osklp mutant, and OsKLP... OE / osklp represents the self-pollinated progeny of the T1 generation homozygous transgenic plant obtained in Example 3.

[0134] At maturity, plant height was measured, and the seed setting rate and number of tillers were recorded. The results for plant height are shown in Table 4 (the sample size for each tested plant was 10 plants, i.e., 10 biological replicates). The results for the number of tillers are shown in Table 5 (the sample size for each tested plant was 10 plants, i.e., 10 biological replicates).

[0135] Compared with wild-type plants, the progeny of the osklp mutant showed significantly reduced plant height, tiller number, and seed setting rate. Compared with wild-type plants, there were no significant differences in plant height, tiller number, or seed setting rate among the transgenic plants. These results indicate that the mutant phenotype is due to the inactivation of the OsKLP gene.

[0136] Table 4

[0137]

[0138]

[0139] Table 5

[0140] 1 18 13 22 2 25 13 18 3 16 8 17 4 22 14 14 5 17 12 20 6 20 17 18 7 15 10 17 8 17 12 19 9 21 13 18 10 20 9 17

[0141] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. OsKLP protein or OsKLP The application of genes in regulating plant fertility and / or plant height and / or tiller number; The OsKLP protein is either (a1) or (a2) as follows: (a1) The protein shown in SEQ ID NO: 1; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); The OsKLP The gene is the gene encoding the OsKLP protein; The regulation is positive regulation; the decrease in OsKLP protein content reduces plant fertility and / or reduces the number of tillers and / or reduces plant height; OsKLP Decreased gene abundance reduces plant fertility and / or reduces the number of tillers and / or reduces plant height; The plant in question is rice.

2. The application as described in claim 1, characterized in that: The OsKLP The genes are as follows (b1) or (b2) or (b3): (b1) A DNA molecule with a coding region as shown in SEQ ID NO: 2; (b2) The DNA molecule shown at positions 180-10851 of SEQ ID NO: 3; (b3) The DNA molecule shown in SEQ ID NO:

3.

3. OsKLP protein or OsKLP The application of genes as repressive targets in plant breeding; the goal of the plant breeding is to cultivate plants with reduced fertility and / or reduced plant height and / or reduced tillering number; the OsKLP protein is the OsKLP protein as described in claim 1; OsKLP The gene is as described in claim 1 or 2 OsKLP Genes; the plant in question is rice.

4. A method for cultivating plants with reduced fertility and / or reduced plant height and / or reduced tiller number, comprising the following steps: using homozygous mutations to introduce a homozygous mutation into the plant's genomic DNA... OsKLP The following two segments of the gene are deleted: "CTCATGCCGC" and "CCTCCCGATCCGGGGACA"; OsKLP The gene is as described in claim 1 or 2 OsKLP Genes; the plant in question is rice.

5. A method for cultivating plants with reduced fertility and / or reduced plant height and / or reduced tiller number, comprising the following steps: inhibiting the growth of certain plants in the recipient plant. OsKLP Gene expression yields plants with reduced fertility and / or reduced plant height and / or reduced tiller number relative to the recipient plant; OsKLP The gene is as described in claim 1 or 2 OsKLP Genes; the plant in question is rice.

6. A method for cultivating plants with reduced fertility and / or reduced plant height and / or reduced tiller number, comprising the following steps: reducing the content of OsKLP protein in the plant to reduce the fertility and / or plant height and / or tiller number; wherein the OsKLP protein is the OsKLP protein as described in claim 1; and wherein the plant is rice.

Images