Use of HPCAL1 as a molecular marker in the preparation of a product for the early diagnosis or prognosis evaluation of acute myeloid leukemia

Abstract

The application belongs to the field of early diagnosis and treatment of diseases, and particularly relates to application of HPCAL1 as a molecular marker in preparation of an acute myeloid leukemia early diagnosis or prognosis evaluation product. The application provides application of high calcium binding protein 1 as a molecular marker in preparation of an acute myeloid leukemia early diagnosis or prognosis evaluation product. The application also provides application of high calcium binding protein 1 gene in preparation of an acute myeloid leukemia treatment drug. The application introduces HPCAL1 as a molecular marker of acute myeloid leukemia, significantly improves the early diagnosis rate and prognosis evaluation ability of acute myeloid leukemia. In addition, the detection method of HPCAL1 is relatively simple, suitable for popularization and application in primary hospitals, and reduces the clinical cost.

Description

Technical Field

[0001] This invention belongs to the field of early diagnosis and treatment of diseases, specifically involving the application of HPCA1 as a molecular marker in the preparation of products for early diagnosis or prognostic assessment of acute myeloid leukemia. Background Technology

[0002] Acute myeloid leukemia (AML) is a serious hematologic malignancy with an increasing incidence and poor prognosis. Current diagnostic methods for AML mainly rely on bone marrow cell morphology examination, immunophenotyping analysis, and molecular biological detection. However, these methods often have limitations in early diagnosis, especially in the early stages of the disease, where accurate identification is frequently difficult. Therefore, finding new biomarkers to improve the early diagnosis rate of AML has become a current research hotspot.

[0003] Currently, several biomarkers have been proposed for the diagnosis and prognostic assessment of AML, such as FLT3 and NPM1 mutations. However, the specificity and sensitivity of these biomarkers still need to be improved.

[0004] Although various molecular markers have been applied to AML research, the following major problems still exist:

[0005] (1) The sensitivity and specificity of existing markers are insufficient, resulting in a low early diagnosis rate and affecting the timing of treatment for patients.

[0006] (2) Existing detection methods are complex, cumbersome to operate, and have limited clinical applications.

[0007] (3) AML has complex biological characteristics, and there are large differences in marker expression among patients, and there is a lack of unified diagnostic criteria. Summary of the Invention

[0008] To address the shortcomings in the accuracy and sensitivity of early diagnosis of acute myeloid leukemia (AML), this invention introduces HPCAL1 as a novel molecular marker, aiming to improve the early diagnosis rate and prognostic assessment capabilities of AML, overcome the limitations of existing technologies, and provide effective guidance for clinical treatment.

[0009] Therefore, the present invention adopts the following technical solution:

[0010] First, by performing differential analysis on the GSE34184 and GSE24395 datasets in the GEO database, it was found that high calcium-binding protein 1 (HPCAL1) was significantly overexpressed in the acute myeloid leukemia group.

[0011] Secondly, bone marrow samples were collected from newly diagnosed AML patients and compared with samples from healthy controls. RNA was extracted and quantitative real-time PCR (qRT-PCR) analysis was performed to verify the expression of HPCAL1. The results showed that HPCAL1 was significantly highly expressed in the acute myeloid leukemia group.

[0012] Therefore, HPCAL1 can be used as a molecular marker in the preparation of early diagnostic products for acute myeloid leukemia. The cDNA sequence obtained by reverse transcription of HPCAL1 mRNA is shown in SEQ ID NO:1, and the amino acid sequence of the HPCAL1 protein is shown in SEQ ID NO:2.

[0013] Next, a short hairpin RNA (shRNA) expression vector for HPCAL1 was constructed using cell culture technology, and transfection experiments were performed to investigate the function of HPCAL1 in THP1 cells. Subsequently, Western blotting was used to detect the protein expression level of HPCAL1, and the effect of HPCAL1 on THP1 cells was evaluated through cell viability and proliferation assays. The results showed that HPCAL1 gene knockdown significantly inhibited the proliferation capacity of THP1 cells.

[0014] Therefore, reagents that knock down the HPCA1 gene can be used as active ingredients in the preparation of drugs for the treatment of acute myeloid leukemia.

[0015] Furthermore, transcriptome data were downloaded and processed, and survival analysis, ESTIMATE analysis, differential expression analysis, and gene function and pathway enrichment analysis were used to explore the role of HPCA1 in AML and its correlation with patient prognosis. The results showed that patients with high HPCA1 expression had significantly poorer prognoses.

[0016] Therefore, HPCA1 can be used as a molecular marker in the preparation of prognostic assessment products for acute myeloid leukemia.

[0017] Based on the above, the first aspect of the present invention provides the application of high calcium-binding protein 1 as a molecular marker in the preparation of products for early diagnosis or prognostic assessment of acute myeloid leukemia.

[0018] Secondly, it provides the application of a reagent for knocking down the high-calcium-binding protein 1 gene as an active ingredient in the preparation of drugs for treating acute myeloid leukemia, specifically by inhibiting the proliferation of acute myeloid leukemia cells through knocking down the high-calcium-binding protein 1 gene.

[0019] Thirdly, a product for early diagnosis or prognostic assessment of acute myeloid leukemia is provided, comprising a calcium-binding protein 1 (CBB1) detection reagent or a CBB1 gene detection reagent. The CBB1 gene detection reagent uses primers specifically for amplifying the CBB1 gene, and the nucleotide sequence of these primers is as follows:

[0020] Upstream primer: 5'-CCTTCAGCATGTACGACCTGGA-3';

[0021] Downstream primer: 5'-GATCTTGTCTGTGCGCTTCTCC-3'.

[0022] Fourthly, a drug for treating acute myeloid leukemia is provided, the active ingredient of which is a reagent for knocking down the high-calcium-binding protein 1 gene. The reagent is a shRNA sequence targeting HPCAL1, wherein the shRNA sequence is: 5'-GAACACGGAGTTCACCGACCA-3' or 5'-GCCGCTTGCACGTATAGATAC-3'.

[0023] The beneficial effects of this invention are as follows:

[0024] This invention significantly improves the early diagnosis rate and prognostic assessment of AML by introducing HPCAL1 as a molecular marker. Results show that HPCAL1 is significantly highly expressed in AML patients, and its expression level is significantly correlated with patient survival, effectively distinguishing between high-risk and low-risk patients. Furthermore, the detection method for HPCAL1 is relatively simple, suitable for widespread application in primary care hospitals, thus reducing clinical costs. Attached Figure Description

[0025] Figure 1 The expression, diagnostic value, and prognostic significance of HPCAL1 in acute myeloid leukemia (AML).

[0026] A: Comparison of HPCAL1 mRNA expression in AML and normal tissues: Analysis of the GSE34184 dataset from Gene Expression Omnibus (GEO) showed that the HPCAL1 mRNA level in AML tissues was significantly higher than that in normal tissues (*, P<0.05).

[0027] B: Comparison of HPCAL1 expression in leukemia stem cells (LSCs) and hematopoietic stem cells (HSCs): Data from the GSE24395 dataset showed that HPCAL1 mRNA expression was higher in LSCs than in HSCs (*, P<0.05).

[0028] C: Laboratory RT-qPCR analysis: RT-qPCR results from bone marrow samples from 24 AML patients and 24 healthy controls showed that HPCA1 mRNA expression was higher in AML samples (***, P<0.001).

[0029] D: ROC analysis of laboratory data: ROC curve analysis showed that HPCA1 mRNA expression could effectively distinguish cancerous and normal tissues, with an area under the curve (AUC) of 0.884 (95% CI: 0.782-0.985).

[0030] E: ROC analysis of TCGA_GTEx-LAML data: ROC curve analysis using the TCGA_GTEx-LAML dataset showed an AUC of 0.989 (95% CI: 0.979-0.999), further validating the diagnostic potential of HPCAL1.

[0031] F: Prognostic significance of HPCAL1 in AML: Kaplan-Meier survival analysis of the TCGA AML dataset showed that higher HPCAL1 mRNA expression was associated with poorer patient prognosis (P = 0.0075).

[0032] Figure 2 HPCA1 promotes the proliferation of THP1 cells.

[0033] A: qRT-PCR analysis showed changes in HPCAL1 protein levels in THP1 cells after infection with lentiviruses containing either independent shRNAs targeting HPCAL1 (shHPCAL1#1 and #2) or control shRNA (shNC). GAPDH was used as a loading control.

[0034] B: Western blotting analysis showed changes in HPCAL1 protein levels in THP1 cells after infection with lentiviruses containing either independent shRNAs targeting HPCAL1 (shHPCAL1#1 and #2) or control shRNA (shNC). GAPDH was used as a loading control.

[0035] C: CCK-8 assay results showed the effect of HPCA1 knockdown on THP1 cell growth. Cell viability was measured at 1, 2, 3, 4, and 5 days post-infection. Data are presented as mean ± standard deviation of three independent experiments (**, P < 0.01).

[0036] D: EdU assays demonstrate the effect of HPCA1 knockdown on DNA synthesis and proliferation in THP1 cells. Cells were fixed and stained after incubation with EdU for 2 hours. The percentage of EdU-positive cells was quantified and is shown as mean ± standard deviation of three independent experiments (**, P < 0.01; ***, P < 0.001). Detailed Implementation

[0037] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of the embodiments of this invention will be clearly described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0038] Example 1

[0039] First, differential analysis was performed on the GSE34184 and GSE24395 datasets in the GEO database (https: / / www.ncbi.nlm.nih.gov / geo / ), revealing that HPCAL1 was significantly highly expressed in the acute myeloid leukemia group. Figure 1 A), and compared to normal hematopoietic stem cells, the expression level of HPCAL1 in leukemia stem cells is significantly increased ( Figure 1 B).

[0040] We subsequently analyzed clinical acute myeloid leukemia (AML) samples, as detailed below:

[0041] 1. Patient sample preparation

[0042] The specific steps for sample collection and processing from patients with acute myeloid leukemia (AML) are as follows:

[0043] (1) Sample collection: Bone marrow samples were collected from newly diagnosed AML patients at Henan Provincial People's Hospital. All samples were diagnosed according to the World Health Organization (WHO) classification system. At the same time, normal bone marrow samples were collected from healthy controls with no history of hematologic disorders or other major diseases.

[0044] (2) Lymphocyte isolation: Lymphocytes were isolated by density gradient centrifugation using Ficoll Hypaque solution.

[0045] This step ensures that a high-purity lymphocyte sample is obtained for subsequent analysis.

[0046] Ethical compliance: All experiments involving human samples followed the ethical standards set by Henan Provincial People's Hospital and the National Research Council, and were approved by the Medical Ethics Committee of Henan Provincial People's Hospital (Approval No.: 2018-51).

[0047] 2. RNA extraction and qRT-PCR analysis

[0048] After isolating lymphocytes, RNA extraction and quantitative real-time PCR (qRT-PCR) analysis were performed to verify HPCA1 expression.

[0049] RNA extraction: Total RNA was extracted using Trizol reagent (Servicebio, Wuhan, China) according to the manufacturer's instructions. After extraction, RNA concentration was quantified using a Nanodrop instrument (Thermo Fisher Scientific, Waltham, MA, USA).

[0050] cDNA Synthesis: Complementary DNA (cDNA) templates were synthesized using cDNA synthesis buffer (Kermey, Zhengzhou, China). Specifically, the reaction solution required for reverse transcription was prepared in RNase-free centrifuge tubes according to the formula in Table 1. After brief centrifugation, the tubes were placed in a PCR instrument for reverse transcription. The reverse transcription reaction program was as follows: 37℃ for 2 min (random primer pairing with RNA template and removal of genomic DNA), 55℃ for 15 min (reverse transcription reaction and rapid inactivation of dsDNase), and 85℃ for 5 min (reverse transcriptase inactivation).

[0051] Table 1. Reverse transcription reaction system

[0052] reagents Usage Total RNA 1μg 5×Reaction Mix 2μL KREnzyme Mix 1.5μL Nuclease-Free Water Add to 10 μL

[0053] qRT-PCR reaction: in StepOne TM qRT-PCR reactions were performed using a real-time PCR system (Thermo Fisher Scientific, Waltham, MA, USA) and universal SYBR Green ultramix solution (Kermey, Zhengzhou, China). β-actin was used as an internal reference gene. The relative expression level of HPCAL1 in patients with acute myeloid leukemia and healthy controls was detected by Real-Time PCR to determine the expression difference between the two groups.

[0054] The nucleotide sequences of the specific amplification primers for HPCAL1 are as follows:

[0055] Upstream primer: 5'-CCTTCAGCATGTACGACCTGGA-3' (SEQ ID NO:3);

[0056] Downstream primer: 5'-GATCTTGTCTGTGCGCTTCTCC-3' (SEQ ID NO:4).

[0057] The nucleotide sequences of the primers for the specific amplification of β-actin are as follows:

[0058] Upstream primer: 5'-GACAGGATGCAGAAGGAGATTACT-3';

[0059] Downstream primer: 5'-TGATCCACATCTGCTGGAAGGT-3'.

[0060] The specific amplification primers for HPCAL1 and β-actin were designed and synthesized by General Biotechnology (Anhui) Co., Ltd.

[0061] Prepare the Real-time PCR reaction system (10 μL system) according to the proportions in Table 2.

[0062] Table 2. Real-time PCR reaction system

[0063] reagents Usage 2×SYBR Green qPCR Premix(Universal) 5μL 10μM forward primer 0.2μL 10μM reverse primer 0.2μL cDNA template 1μL Nuclease-Free Water Add to 10 μL

[0064] Real-Time PCR was performed using a two-step method, and melting curves were generated. The program settings are shown in Table 3.

[0065] Table 3. Two-step Real-Time PCR reaction procedure

[0066]

[0067] Bone marrow samples from 24 patients with acute myeloid leukemia and 24 healthy controls were collected, and the expression level of HPCAL1 was detected using quantitative real-time fluorescence. We found that HPCAL1 was significantly highly expressed in the acute myeloid leukemia group. Figure 1 C).

[0068] 3. Cell Culture and Transfection

[0069] This embodiment also included cell culture and the construction and transfection of a short hairpin RNA (shRNA) expression vector for HPCAL1.

[0070] THP1 cells are a human acute monocytic leukemia cell line, a type of AML cell line, widely used in immunology and inflammation research. We selected THP1 cells to study the effect of HPCAL1 knockdown on the survival of leukemia cells.

[0071] In this embodiment, the human monocytic leukemia cell line (THP1) and the human renal epithelial cell line (293T) were provided by Feng Hui Biotechnology Co., Ltd. (Hunan, China). THP1 cells were cultured in RPMI 1640 medium (Biological Industries, Beit Haemek, Israel), while HEK-293T cells were cultured in DMEM medium (Biological Industries, Beit Haemek, Israel), both supplemented with 10% fetal bovine serum (FBS).

[0072] The culture method for THP1 cells is as follows:

[0073] (1) THP1 cells were cultured in RPMI 1640 medium (containing L-glutamine), supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin mixture. They were then incubated statically in a 37°C, 5% CO2 incubator.

[0074] (2) Routine maintenance: Replace with fresh complete culture medium every 2-3 days to ensure that the cells are in good growth condition.

[0075] (3) Passage: When the cell density reaches approximately 1×10⁻⁶ 6 When the cell count is 1 / mL, subculturing is necessary. Discard the supernatant, add fresh complete culture medium, and seed the cells into new culture flasks at a ratio of 1:2 or 1:3. Incubate again at 37°C with 5% CO2.

[0076] 293T cells are a commonly used cell line, widely applied in gene transfection, viral packaging, and other molecular biology experiments. We selected 293T cells as the cell line for lentiviral packaging. The culture method for 293T cells is as follows:

[0077] (1) 293T cells were cultured in DMEM (Dulbecco's Modified Eagle Medium) medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin mixture. They were then incubated statically in a 37°C, 5% CO2 incubator.

[0078] (2) Routine maintenance: Replace with fresh complete culture medium every 2-3 days to ensure that the cells are in good growth condition.

[0079] (3) Passaging: When the cell confluence reaches approximately 80%-90%, passaging is necessary. Gently rinse the cell surface with PBS to remove residual culture medium. Add an appropriate amount of preheated trypsin-EDTA digestion solution and incubate at 37°C for 1-2 minutes until the cells become rounded and begin to detach. Add an equal volume of fresh complete culture medium to stop digestion and gently pipette to resuspend the cells evenly. Transfer the cell suspension to centrifuge tubes and centrifuge at 1200 rpm for 5 minutes. Discard the supernatant, add fresh complete culture medium, and seed the cells into new culture flasks at a ratio of 1:3 or 1:4. Re-incubate at 37°C in a 5% CO2 incubator.

[0080] Construction of HPCAL1 knockdown THP1 cell line:

[0081] (1) shRNA design: The shRNA sequences targeting HPCAL1 (shHPCAL1#1, shHPCAL1#2) and the negative control shRNA (shNC) were synthesized by General (Anhui) Biotechnology Co., Ltd. The sequences are shown in the table below:

[0082] Name Sequence(5'-3') shHPCAL1#1 GAACACGGAGTTCACCGACCA(SEQ ID NO:5) shHPCAL1#2 GCCGCTTGCACGTATAGATAC(SEQ ID NO:6) shNC CAACAAGATGAAGAGCACCAA

[0083] (2) Construction of shRNA vector:

[0084] ① Double enzyme digestion of the vector: Take 1 μg of pLKO.1 vector (Anhui General Biotechnology Co., Ltd.), add 1 μL each of restriction endonucleases AgeI and EcoRI, inactivate at 37℃ for 6 h, and heat at 80℃ for 20 min. Add the digested pLKO.1 vector to a 1% agarose gel, electrophoresis at 80V for 30 min, and then recover the cleaved vector by gel excision.

[0085] ② Annealing oligonucleotide fragments: Mix the corresponding sense and antisense strands of each pair of shRNAs according to the system in Table 4, and set the annealing program in the PCR instrument: 37℃ for 30 min, 95℃ for 5 min, 90℃ for 1 min, 85℃ for 1 min, and decrease the temperature by 5℃ every 1 min until it reaches 25℃, and perform annealing recombination.

[0086] Table 4. Annealing Oligonucleotide Fragment Reaction System

[0087] Positive oligonucleotide chain (F, 100 μM) 1μL Antisense oligonucleotide chain (R, 100 μM) 1μL <![CDATA[ddH2O]]> 8μL Total 10μL

[0088] ③ Ligation: Dilute the annealed shRNA 200 times with ddH2O. Prepare the ligation reaction solution according to Table 5 and ligate at room temperature for 4 hours.

[0089] Table 5. Connection Reaction System

[0090] EcoRI & AgeI digested pLKO.1 1 μL (300 ng / μL) oligo duplex 2μL T4 DNA ligase 0.5μL 10×T4 DNA ligase buffer 1μL <![CDATA[ddH2O]]> 5.5μL Total 10μL

[0091] ⑥ Transformation: Add the ligated shRNA to competent cells, incubate on ice for 30 min, heat shock at 42℃ for 50 s, add 500 μL LLB medium, culture on a shaker at 37℃ for 1 h, spread onto ampicillin-resistant LB culture plates, and incubate overnight at 37℃.

[0092] ⑦ Picking single clones: Pick single clones into 500 μL of LB liquid medium containing ampicillin resistance and incubate at 37°C in a shaker for 5 h.

[0093] ⑧ Sequencing Verification: Take a portion of the bacterial culture and send it to Qingke Biotechnology for sequencing. Compare the sequencing results to identify the correct clone.

[0094] ⑨ Extract the correctly cloned vector using a plasmid extraction kit; this is shRNA-pLKO.1. It can be used for subsequent lentivirus packaging.

[0095] (3) Lentiviral packaging

[0096] ① Seed 293T cells into 6-well plates, 0.5 × 10⁶ cells per well. 6 Each cell was cultured overnight, so that the cell density could reach approximately 70-80% the next day.

[0097] ② Before transfection, replace 2 mL of fresh culture medium in each well of a six-well plate containing cells.

[0098] ③ Prepare the lentiviral packaging systems for shNC, shHPCAL1#1, and shHPCAL1#2 according to Table 6. For each well of the six-well plate to be transfected, prepare solution A: 100 μL Medium, 1 μg shRNA-pLKO.1, 1 μg packaging plasmid psPAX2; 0.5 μg packaging plasmid VSVG2. Prepare solution B: 100 μL Medium, 5μL Lipo2000 TM Transfection reagent. After incubating solutions A and B at room temperature for 5 minutes, add solution A and solution B to mix, incubate at room temperature for 20 minutes, and then add evenly to the corresponding wells.

[0099] ④ After incubating at 37℃ and 5% CO2 for 24 hours, collect the culture supernatant and record it as virus P1. Add fresh culture medium and continue incubating for 24 hours. Collect the culture supernatant and record it as virus P2.

[0100] (4) Concentrate the virus: concentrate the virus solution by ultracentrifugation or polyethylene glycol precipitation to improve the infection efficiency.

[0101] (5) Lentiviral infection of THP1 cells

[0102] ① Cell preparation: Ensure the suspension cells are in good growth condition, free from contamination, and of good viability. Determine the cell density using a cell counting chamber or automated cell counter, and adjust to a suitable density for infection (usually 0.5-1 × 10⁻⁶). 6 (cells / mL)

[0103] ② Virus-cell mixing: Calculate the required virus volume based on the desired MOI (Multiple Infection Index) and add it to the cell suspension. Add Polybrene (final concentration 4-8 μg / mL) to increase the lentivirus's adsorption capacity to the cell membrane. Gently pipette to mix the cells and virus solution, avoiding vigorous handling to prevent cell damage.

[0104] ③ Centrifugation to enhance infection: Centrifuge the cell suspension containing the virus at a low speed (e.g., 1000-1200 rpm) for 1-2 hours, and then continue incubation overnight.

[0105] ④ Incubation: Place the centrifuged cell plates in a 37°C, 5% CO2 incubator and incubate overnight (16-24 hours).

[0106] ⑤ Change the culture medium: After the infection is over, gently remove and discard the old culture medium containing the virus, add an appropriate amount of fresh complete culture medium, and continue to culture the cells.

[0107] ⑥ Antibiotic screening: Add 2 μg / mL of puromycin starting 48-72 hours after infection to gradually eliminate uninfected cells.

[0108] (6) Detecting knockdown efficiency

[0109] ① Extract cellular RNA and perform quantitative real-time PCR to quantify the mRNA expression level of HPCA1. The specific steps are the same as above and will not be repeated.

[0110] ② Extract total cellular protein and perform Western blotting to detect changes in HPCA1 protein expression levels. The specific steps are the same as above and will not be repeated.

[0111] We successfully constructed HPCAL1 knockdown THP1 cells using a lentiviral system and analyzed the mRNA levels using qPCR and Western blotting. Figure 2 A) and protein levels ( Figure 2 B) The expression level of HPCAL1 was detected, and the expression level of HPCAL1 in the HPCAL1 knockdown group was significantly reduced.

[0112] 4. Cell viability and proliferation experiments

[0113] To evaluate the effects of HPCA1 on THP1 cells, cell viability and proliferation assays were performed. These included:

[0114] Cell viability was assessed using the CCK-8 assay: Cell viability was assessed using the Cell Counting Kit-8 (CCK-8, Targetmol, Boston, USA). HPCA1 knockdown THP1 cells were seeded at a density of 2000 cells / well in 96-well plates, 10 μL of CCK-8 reagent was added, and after incubation for 2 hours, absorbance was measured at 450 nm.

[0115] Edu detection of cell proliferation: using Click TM EdU-647 cell proliferation assay kit (Beyotime Biotechnology, Shanghai, China) was used for EdU experiments. HPCAL1 knockdown THP1 cells were plotted on poly-L-lysine-coated slides at a density of 3 × 10⁻⁶ cells / year. 5 Cells were seeded at a density of 10 cells / well, allowed to adhere for 2 hours, and then incubated with 10 μM Edu at 37°C for 2 hours. Cells were then fixed with 4% paraformaldehyde, permeabilized with 0.5% Triton X-100 for 10 minutes, washed with PBS, and incubated with Click-iT reaction mixture for 30 minutes. Finally, nuclear staining was performed with Hoechst 33342 (1 μg / mL), and cell analysis was performed using fluorescence microscopy.

[0116] Through CCK8 ( Figure 2 C) and Edu Figure 2 D) We examined the effect of HPCA1 on the proliferation of THP1 cells and found that HPCA1 knockdown significantly inhibited the proliferation of THP1 cells.

[0117] 5. Creating ROC curves

[0118] To further evaluate the performance of HPCAL1 gene expression as a diagnostic biomarker for AML, receiver operating characteristic (ROC) curves were plotted for analysis. We performed diagnostic value analysis based on qPCR data of HPCAL1 from collected clinical samples and TCGA-GTEx-LAML data, respectively.

[0119] (1) Data preparation: Prepare qPCR data of collected clinical samples; download RNAseq data in TPM format of TCGA and GTEx from the UCSC XENA platform (https: / / xenabrowser.net / datapages / ) and process them uniformly using the Toil workflow (Vivian J et al., 2017), and extract acute myeloid leukemia data (70 cases) from TCGA and corresponding normal tissue data (173 cases) from GTEx.

[0120] (2) Plotting ROC curves: Use the pROC[1.18.0] package to perform ROC analysis on the data, and visualize the results using ggplot2[3.4.4].

[0121] Diagnostic value analysis: Analysis of HPCAL1 expression levels in our collected samples revealed that HPCAL1 has significant diagnostic value for acute myeloid leukemia, with an AUC of 0.884. Figure 1 D). ROC analysis of acute myeloid leukemia data (70 cases) from TCGA and corresponding normal tissue data (173 cases) from GTEx also demonstrated that HPCAL1 has good diagnostic value for acute myeloid leukemia, with AUC = 0.989. Figure 1 E).

[0122] 6. Survival analysis and differential expression analysis

[0123] Survival and differential expression analyses were performed to assess the association between HPCA1 gene expression and prognosis in AML patients.

[0124] The specific steps are as follows:

[0125] TCGA Data Download and Processing: Download and organize RNAseq data from the STAR workflow of the TCGA-LAML (Acute Myeloid Leukemia) project from the TCGA database (https: / / portal.gdc.cancer.gov), and extract data in TPM format as well as clinical data.

[0126] Survival analysis preparation: Use R (version 4.2.2) and load the survival package (versions 3.5-5) and the survminer package (version 0.4.9). Ensure all necessary datasets are ready, including HPCAL1 gene expression levels and survival data for TCGA AML patients.

[0127] Grouping: Using functions in the survminer package, an optimal cutoff value was calculated based on the expression level of the HPCAL1 gene and survival data of TCGA AML patients. Patients were then divided into high-expression and low-expression groups based on the calculated optimal cutoff value.

[0128] Kaplan-Meier survival analysis: Kaplan-Meier survival analysis was performed separately for the high-expression and low-expression groups. Kaplan-Meier survival curves were generated using the survminer package, and necessary statistical information (such as p-value, hazard ratio, etc.) was added to assess the clinical significance of HPCAL1 gene expression in AML.

[0129] Prognostic value analysis: Kaplan-Meier survival analysis of acute myeloid leukemia data from high and low HPCAL1 expression groups revealed that patients with high HPCAL1 expression had a significantly worse prognosis. Figure 1 F).

[0130] In summary, this invention significantly improves the early diagnosis rate and prognostic assessment of acute myeloid leukemia (AML) by introducing HPCAL1 as a molecular marker. HPCAL1 is significantly highly expressed in AML patients, and its expression level is significantly correlated with patient survival, effectively distinguishing between high-risk and low-risk patients. Furthermore, the detection method for HPCAL1 is relatively simple and suitable for widespread application in primary care hospitals.

[0131] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of HPCAL1 detection reagent in the preparation of products for early diagnosis or prognostic assessment of acute myeloid leukemia.

2. The application according to claim 1, characterized in that, The HPCAL1 gene detection reagent is an HPCAL1 gene-specific amplification primer, the nucleotide sequence of which is as follows: Upstream primer: 5'-CCTTCAGCATGTACGACCTGGA-3'; Downstream primer: 5'-GATCTTGTCTGTGCGCTTCTCC-3'.

3. The application of a reagent for knocking down the HPCAL1 gene as an active ingredient in the preparation of drugs for treating acute myeloid leukemia; the reagent is an shRNA sequence targeting HPCAL1, and the shRNA sequence is as follows: 5'-GAACACGGAGTTCACCGACCA-3' or 5'-GCCGCTTGCACGTATAGATAC-3'.

Images