Microglial cell for expressing IDUA gene as well as construction method and application of microglial cell

Abstract

The invention relates to a microglial cell for expressing an IDUA gene as well as a construction method and application thereof. The construction method comprises the following steps: S1, constructing and culturing a lentivirus containing the IDUA gene; lin-bone marrow stem cells are sorted from the bone marrow cells through a magnetic bead sorting method; s2, transfecting the lentivirus containing the IDUA gene obtained in the step S1 to Lin-bone marrow stem cells through a centrifugal infection method to obtain Lin-bone marrow stem cells containing the IDUA gene; and S3, differentiating the Lin-bone marrow stem cells containing the IDUA gene obtained in the step S2 to obtain the microglial cells expressing the IDUA gene. Compared with the prior art, the method has the advantages that the Lin-bone marrow stem cells with differentiation potential are subjected to in-vitro gene editing and are differentiated into the microglia for expressing the target gene, and the in-vivo expression efficiency of the target gene is improved while the survival ability of the microglia is improved.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a microglia expressing the IDUA gene, its construction method, and its application. Background Technology

[0002] Microglia are important immune cells in the central nervous system (CNS), and genetic defects they carry can cause or accelerate CNS lesions. Related studies have shown that replacing native microglia in the CNS with exogenous normal cells can slow the progression of CNS lesions, thereby achieving a therapeutic effect.

[0003] However, conventional microglia replacement still has certain limitations in supplementing the original cell function for some genetic diseases caused by gene mutations or deletions (such as mucopolysaccharidosis). For example, (1) constructing a microglia population overexpressing the target gene has the disadvantage that the existing construction methods are not yet mature and the construction is difficult; (2) constructing a lentiviral vector to directly infect primary microglia has the disadvantage that the passage replacement efficiency is low and insufficient to achieve the purpose of treating the disease.

[0004] Therefore, developing a method for constructing microglia that is simple, targeted, and highly efficient in replacement has significant research and application value. Summary of the Invention

[0005] The purpose of this invention is to overcome the problems of high technical difficulty and low efficiency in replacing native microglia in the CNS by providing a microglia expressing the IDUA gene, its construction method and application.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] The technical solution of the present invention is to provide a method for constructing microglia expressing the IDUA gene, comprising the following steps:

[0008] S1. Construct and culture lentiviruses containing the IDUA gene; isolate Lin from bone marrow cells using magnetic bead sorting. - Bone marrow stem cells (Lin-BMC);

[0009] S2. The lentivirus containing the IDUA gene obtained in step S1 is transfected into Lin via centrifugation. - BMC, to obtain Lin containing the IDUA gene - BMC;

[0010] S3. Take the Lin containing the IDUA gene obtained in step S2. - BMC differentiation yields microglia expressing the IDUA gene.

[0011] In some specific embodiments, the specific steps for constructing and culturing a lentivirus containing the IDUA gene in step S1 are as follows: the IDUA gene with a nucleotide sequence as shown in SEQ ID NO.1 is used to construct a plenti-CAG-IDUA-EGFP recombinant plasmid with the lentiviral vector plenti-CAG-EGFP; the plenti-CAG-IDUA-EGFP recombinant plasmid, PxpAx2 plasmid, and PMD2g plasmid are mixed with DMEM medium and labeled as solution A; the transfection reagent is mixed with DMEM medium and labeled as solution B; solution B is added dropwise to solution A and mixed, and then added dropwise to HEK 293FT cells for transfection culture to obtain a lentivirus containing the IDUA gene.

[0012] In some specific implementations, the mass ratio of plenti-CAG-IDUA-EGFP recombinant plasmid, PxpAx2 plasmid, and PMD2g plasmid is 4:3:1.

[0013] In some specific embodiments, the ratio of the total mass of the plenti-CAG-IDUA-EGFP recombinant plasmid, PxpAx2 plasmid, and PMD2g plasmid to the DMEM culture medium is 20 μg: 500 μL;

[0014] The transfection reagent has a concentration of 1 μg / mL, and the ratio of 1 μg / mL transfection reagent to DMEM medium is 60 μg: 500 μL.

[0015] Preferably, the transfection reagent is polyethyleneimine (PEI) reagent.

[0016] In some specific embodiments, the specific steps of magnetic bead sorting in step S1 are as follows: Bone marrow cells are resuspended in buffer solution, then a biotinylated antibody mixture is added, mixed, and incubated. After terminating the reaction, antibiotin microbeads are added, mixed, and incubated again. The cell particles are washed and resuspended, and the resuspended cell particles are dropped into a separation column placed in a magnetic field. The cells flowing out of the separation column are collected by centrifugation, which are the Lin cells. - Bone marrow stem cells.

[0017] In some specific embodiments, the concentration of resuspended bone marrow cells is 10. 7 Cell count / mL, the volume ratio of resuspended bone marrow cells, biotinylated antibody mixture, and antibiotin beads was 50:1:2.

[0018] In some specific embodiments, the antibody molecules in the biotinylated antibody mixture include CD5 antibody, CD45R (B220) antibody, CD11b antibody, Anti-Gr-1 (Ly-6G / C) antibody, Ly-6B.2 (7 / 4) antibody, and Ter-119 antibody.

[0019] Preferably, the buffer solution is a mixture of PBS solution and bovine serum albumin (BSA) at a final concentration of 0.5%.

[0020] In some specific embodiments, in step S2, the specific steps of the centrifugal infection method are as follows: Lin... - Bone marrow stem cells were cultured in SFEM2 basal medium supplemented with helper factors, and lentivirus containing the IDUA gene and polybrene were added. After centrifugation at room temperature, the culture was placed in a CO2 incubator.

[0021] In some specific embodiments, the cofactors include mouse stem cell factor (mSCF), thrombopoietin (TPO), and recombinant human Flt3 ligand (FLt3L), each added at an amount of 100 ng / mL.

[0022] In some specific implementations, lentiviruses containing the IDUA gene and Lin - The MOI of bone marrow stem cells was 20, and the working concentration of polybrene added to the SFEM2 basal medium was 10 μg / mL.

[0023] Preferably, the centrifugation speed at room temperature is 2,400 × g, and the centrifugation time at room temperature is 1.5 h.

[0024] The second technical solution of the present invention is to provide a microglia expressing the IDUA gene, which is prepared based on the method for constructing microglia expressing the IDUA gene described in one of the above technical solutions.

[0025] The third technical solution of the present invention is to provide the application of microglia expressing the IDUA gene as described in the second technical solution above in the preparation of products for treating mucopolysaccharidosis.

[0026] This invention constructs a Lin gene overexpressing the IDUA gene by first performing in vitro gene editing on bone marrow stem cells. - Bone marrow stem cells, which in turn enable gene-edited Lin - BMCs differentiate into microglia that continuously express specific gene functions in order to replace the original diseased microglia.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] (1) This invention targets specific gene mutations or gene defects, achieving precise breakthroughs at the gene level. Simultaneously, this invention utilizes in vitro gene editing of Lin, a gene with differentiation potential. - BMCs are differentiated into microglia expressing the target gene, which improves the survival ability of microglia and the expression efficiency of the target gene in vivo.

[0029] (2) This invention uses in vitro gene editing of bone marrow stem cells to enable the gene-edited bone marrow stem cells to be transplanted into the body to differentiate into microglia expressing the corresponding gene functions, so as to replace the original diseased microglia, which is expected to be used to accurately locate and correct genetic defects of specific diseases.

[0030] (3) The method of the present invention is simple to operate, the materials involved, such as cells, are widely available, and the bone marrow stem cells purified by lentivirus centrifugation infection significantly improve the efficiency of in vitro stem cell gene editing, which is helpful for clinical application.

[0031] (4) This invention is not limited to the single disease of mucopolysaccharidosis, but is expected to be applied to diseases involving microglia dysfunction, including neurodegenerative diseases, and provides the potential for long-term curative solutions. Attached Figure Description

[0032] Figure 1 This invention relates to a plasmid spectrum, wherein... Figure 1 A is the Plenti-CAG-EGFP (CAG-EGFP) plasmid. Figure 1 B is the Plenti-CAG-IDUA-EGFP (IDUA-EGFP) recombinant plasmid. Figure 1 C is the PxpAx2 plasmid. Figure 1 D is the PMD2g plasmid.

[0033] Figure 2 This is a schematic diagram illustrating a method for diluting virus concentration.

[0034] Figure 3 This is a fluorescence image of HEK 293FT cells transfected with lentivirus, in which... Figure 3 A is the control group. Figure 3 B is the experimental group.

[0035] Figure 4 The expression efficiency of IDUA after lentiviral transfection of HEK 293FT cells, among which Figure 4 A is the fluorescence image. Figure 4 B represents the expression level of IDUA mRNA.

[0036] Figure 5 Lentiviral transfection of Lin -The infection efficiency of BMC, among which Figure 5 A is the fluorescence image. Figure 5 B represents the fluorescence percentage data.

[0037] Figure 6 The results show the IDUA enzyme activity efficiency after lentiviral transfection of cells. Figure 6 A represents HEK 293T cells transfected. Figure 6 B represents transfected BMC. Figure 6 C represents transfected Lin - BMC.

[0038] Figure 7 Lentiviral transfection of Lin - Microglial cell differentiation in the brain of mice after BMC transplantation, including Figure 7 A is the fluorescence image. Figure 7 B represents the microglia replacement efficiency.

[0039] Figure 8 Lentiviral transfection of Lin - A schematic diagram and results of grip strength testing in mice after BMC transplantation. Figure 8 A is a schematic diagram of a mouse forelimb strength test. Figure 8 B is a schematic diagram of the mouse limb strength test. Figure 8 C represents the maximum gripping force of the mouse's forelimb and the latency to reach that maximum gripping force. Figure 8 D represents the maximum gripping force of the mouse's limbs and the latency period to reach the maximum gripping force. Detailed Implementation

[0040] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. These embodiments are based on the technical solution of the present invention and provide detailed implementation methods and specific operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments.

[0041] Unless otherwise specified, the raw materials or processing techniques used in the following embodiments and comparative examples are all conventional commercially available raw materials or conventional processing techniques in the art.

[0042] (1) Cell RNA extraction kit: FastPure Cell / Tissue Total RNA Isolation Kit V2, brand: Vazyme, catalog number: RC112-01;

[0043] (2) Reverse transcription kit: PrimerScript™ RT reagent Kit with gDNA Eraser, brand name: TAKARA, catalog number: RR047A;

[0044] (3) Red blood cell lysis buffer: ThermoFisher, catalog number: 00-4300-54;

[0045] (4) Lineage Cell Depletion Kit for mouse: Brand Miltenyi Biotec, Catalog No.: 130-090-858, contains a mixture of biotinylated antibodies and antibiotin microbeads.

[0046] (5) DMEM / F12 culture medium: brand name Gibco, catalog number: 11330-032.

[0047] (6) 4-Methylumbelliferyl-α-L-Iduronide (4-MU-I): Brand: ApexBio, Product No.: C5206.

[0048] (7) Sodium formate buffer: brand name: aladdin, catalog number: P299404-500mL.

[0049] Example 1:

[0050] This embodiment provides a method for constructing microglia expressing the IDUA gene, including the following steps:

[0051] S1. Construct and culture lentiviruses containing the IDUA gene; isolate Lin from bone marrow cells using magnetic bead sorting. - BMC;

[0052] Specifically:

[0053] S1-1. Construct and culture lentiviruses containing the IDUA gene.

[0054] S1-1-1, Culture HEK 293FT cells, quantity: 1×10⁻⁶ 6 / 10cm dish, HEK 293FT cells have a confluence of approximately 60%-70%.

[0055] S1-1-2, Amplification of the IDUA gene: PCR was performed using mouse spleen tissue cDNA as a template, following the instructions of the cell RNA extraction kit. The entire experimental procedure was RNase-free, and the concentration of the extracted RNA was finally determined using a Nano Drop One instrument.

[0056] Reverse transcription was performed according to the instructions of the PrimerScript™ RT reagent Kit with gDNA Eraser.

[0057] IDUA was amplified using the primers IDUA-F / R for the target gene IDUA. The nucleotide sequences of IDUA-F / R are shown in SEQ IDNO.2 / 3, respectively.

[0058] IDUA-F (SEQ ID NO.2): CTGGTGGTGAAGGTCATTGC;

[0059] IDUA-R (SEQ ID NO. 3): GCTCAGGAAGGCATTGTCATT.

[0060] The nucleotide sequence of the amplified IDUA gene is shown in SEQ ID NO.1:

[0061]

[0062] The ends of the amplified IDUA gene were modified with an EcoR I restriction cloning site, an internal ribosome entry site (IRES), a green fluorescent label (EGFP), and a Kpn I restriction cloning site, respectively. The nucleotide sequence is shown in SEQ ID NO. 4.

[0063] GAATTCGCCACCATGCGACCCCCGCGTCCCTCCTCAGCTATGCTGACGTTTTTTGCTGCGTTCTTGGCCGCGCCCTTGGCGCTGGCTGAGTCACCGTACCTGGTGCGTGGACGCAGCCCGCCCGCTGAGGCCTGTTGCCCTTCTGGAGGAGCACCGGCTTCTGCCCCCCACTGCCTCACGACCAGGCT

[0064] GACCAGTACGACCTTAGTTGGGACCAGCAACTGAACCTTGCCTACATAGGTGCCGTACCTCACAG

[0065] TGGCATTGAGCAGGTCCGGATACACTGGCTGCTGGATCTCATCACAGCCAGGAAGTCACCTGGGC

[0066] AGGGACTTATGTACAACTTCACCCACTTGGATGCATTCTTGGACCTTCTCATGGAGAACCAGCTTC

[0067] TCCCTGGATTTGAGCTCATGGGCAGTCCTTCTGGGTACTTCACGGACTTTGATGACAAGCAGCAG

[0068] GTGTTTGAATGGAAGGACCTGGTTTCTCTCTTGGCCAGGAGATACATTGGTAGGTATGGGCTGAC

[0069] ACACGTTTCCAAGTGGAACTTTGAGACTTGGAATGAACCAGACCACCATGACTTTGACAACGTG

[0070] TCCATGACCACACAAGGCTTCCTGAATTACTATGATGCCTGCTCTGAGGGGCTGCGCATTGCCAG

[0071] CCCCACTTTGAAGTTGGGTGGTCCTGGGGATTCCTTCCACCCCCTGCCAAGGTCACCAATGTGCT

[0072] GGAGCCTCCTGGGTCACTGTGCCAATGGAACCAACTTCTTCACTGGCGAGGTGGGCGTGCGTCT

[0073] GGATTACATCTCCCTGCACAAGAAGGGTGCAGGTAGCTCCATCGCCATCCTGGAGCAGGAGATGG

[0074] CAGTTGTGGAGCAGGTCCAGCAGCTCTTCCCTGAGTTCAAGGATACCCCTATTTACAATGACGAG

[0075] GCAGACCCTCTGGTGGGCTGGTCCCTGCCACAACCTTGGAGAGCTGATGTGACTTATGCGGCCCT

[0076] GGTGGTGAAGGTCATTGCACAGCACCAGAACCTGCTGTTTGCCAACAGCAGTTCCTCCATGCGCT

[0077] ATGTGCTCCTCAGCAATGACAATGCCTTCCTGAGCTACCACCCGTACCCTTTCTCCCAGCGCACA

[0078] CTTACTGCTCGATTCCAGGTCAACAATACTCACCCACCCCACGTGCAGTTGCTGCGAAAGCCAGT

[0079] ACTCACAGTCATGGGGCTCATGGCCCTGTTGGATGGAGAACAACTCTGGGCAGAGGTCTCAAAG

[0080] GCTGGGGCTGTGTTGGACAGCAATCATACAGTGGGTGTCCTGGCCAGCACCCATCACCCTGAAG

[0081] GCTCCGCAGCGGCCTGGAGTACCACAGTCCTCATCTACACTAGTGATGACACCCACGCACACCCC

[0082] AACCACAGTATCCCTGTGACTCTTCGCCTGCGTGGGGTACCTCCTGGCTTGGATCTTGTCTACATA

[0083] GTACTCTACTTAGACAATCAACTCAGCAGCCCCTACAGTGCGTGGCAGCACATGGGCCAGCCAGT

[0084] CTTCCCCTCTGCAGAGCAGTTCCGACGTATGCGCATGGTGGAGGACCCCGTGGCTGAGGCACCA

[0085] CGCCCCTTTCCTGCTAGGGGCCGCCTGACCCTACACCGGAAGCTTCCGGTGCCATCACTCCTGCT

[0086] GGTGCATGTATGCACACGCCCCTTGAAGCCACCTGGGCAGGTCAGCCGGCTCCGTGCACTGCCC

[0087] CTGACACATGGACAGCTGATTTTGGTCTGGTCAGATGAGCGTGTGGGCTCCAAGTGCCTGTGGAC

[0088] ATATGAGATCCAGTTTTCCCAGAAAGGTGAAGAGTATGCCCCAATCAACAGGAGGCCGTCTACTT

[0089] TTAACCTCTTTGTGTTCAGCCCAGACACAGCTGTGGTCTCTGGCTCCTACCGAGTTCGAGCATTG

[0090] GATTACTGGGCCCGGCCAGGCCCCTTCTCCGACCCTGTGACTTACCTGGATGTCCCTGCCTCATG

[0091] AACCGGTGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCG

[0092] GTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAA

[0093] CCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGG

[0094] TCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTA

[0095] GCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCA

[0096] CGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGT

[0097] GGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTA

[0098] CCCCATTGTATGGGATCTGATCTGGGGCCTCGGTACACATGCTTTACATGTGTTTAGTCGAGGTTA

[0099] AAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATA

[0100] TGGCCACAACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGA

[0101] GCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCAC

[0102] CTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACC

[0103] CTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGC

[0104] ACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGAC

[0105] GACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATC

[0106] GAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAAC

[0107] TACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCA

[0108] AGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCC

[0109] CATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGC

[0110] AAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAGGTACC.

[0111] S1-1-2, Triple plasmid transfection: The IDUA gene modified with restriction enzyme sites is transfected with the lentiviral vector plenti-CAG-EGFP (e.g., ...). Figure 1 The conventional plasmid numbered H15391 shown in figure a, with CAG as the promoter and EGFP as the green fluorescent label, was used to construct the plenti-CAG-IDUA-EGFP recombinant plasmid (as shown in figure a). Figure 1 b, H15385), plenti-CAG-IDUA-EGFP recombinant plasmid, PxpAx2 plasmid (e.g. Figure 1 c) PMD2g plasmid (e.g.) Figure 1 d) Mix them in a mass ratio of 4:3:1 to form the experimental group, with a total mass of 20 μg. Simultaneously, the plenti-CAG-EGFP plasmid and the PxpAx2 plasmid (e.g., ...) were added. Figure 1 c) PMD2g plasmid (e.g.) Figure 1d) Mixed in a mass ratio of 4:3:1 as a control group, with a total mass of 20 μg.

[0112] Mix 20 μg of the mixed plasmid with 500 μL of DMEM / F12 medium, and pipette repeatedly 20 times to ensure thorough mixing; this is labeled as solution A. Add 60 μg of 1 μg / mL polyethyleneimine (PEI) transfection reagent to 500 μL of DMEM / F12 medium (without serum and antibiotics), and pipette repeatedly 20 times to ensure thorough mixing; this is labeled as solution B. Add solution B dropwise to solution A, and gently mix 15 times with a pipette, then incubate at room temperature for 15 min. Slowly add the combined solutions A and B dropwise to HEK 293FT cells, and incubate in a cell culture incubator at 37°C and 5% CO2.

[0113] S1-1-3. 6-8 h after transfection, replace the supernatant containing the transfection reagent with 10 mL of DMEM complete medium.

[0114] S1-1-4. The peak period of virus production is 24-72 hours after transfection. Supernatant was collected at 24h, 48h, and 72h after transfection for experiments.

[0115] S1-1-5. Collect the virus in a 50mL centrifuge tube, centrifuge at 500g for 5min to remove cell debris and impurities, and collect the supernatant. Then filter the supernatant using a syringe and a 0.22μm bacterial filter, and collect the viral supernatant for subsequent experimental procedures.

[0116] S1-1-6. Virus concentration was performed using polyethylene glycol (PEG) 8000. The supernatant of the centrifuged virus was mixed with 40% PEG 8000 solution to achieve a PEG 8000 concentration of 10%. The mixture was placed on ice for 3-6 hours, followed by centrifugation at 2000×g for 30 minutes. The supernatant was discarded, and the precipitate was resuspended in PBS buffer at 1 / 20 of the original sample volume. The resuspended virus sample was transferred to an ultracentrifuge (Optima XPN-100) and centrifuged at 100,000×g for 90 minutes. The supernatant was discarded, and the precipitate was the virus particles. The virus particles were resuspended in PBS buffer, and all samples were pooled into a single centrifuge tube. The pooled virus sample was aliquoted and stored at -80°C for later use.

[0117] S1-1-7, Viral titer detection. Using the fluorescent reporter gene assay, HEK 293FT cells were first passaged and seeded in 96-well plates. Eight gradient wells (10⁻⁶ m²) were set up for each lentivirus. -1 -10 -8The diluted virus concentration was added to the corresponding wells of HEK293FT cells, followed by the addition of polybrene to a final concentration of 2 μg / mL. The cells were then incubated at 37°C in a 5% CO2 incubator for 24 hours. Virus titer results were as follows: Figure 3 As shown.

[0118] like Figure 2 The method for diluting the viral concentration shown was used to infect HEK 293FT cells with lentivirus for 24 hours. The number of fluorescent cells in each well was observed under a fluorescence microscope. It was assumed that 10... -6 Two fluorescent cells were observed in the well of μL virus solution, indicating that at least two virus particles in the well infected the cell, and the titer was 2 / (10). -6 ) = 2 × 10 6 The unit is TU / μL, which is 2×10 9 The unit is TU / mL.

[0119] like Figure 3 The image shown is a fluorescence image of HEK 293FT cells transfected with lentivirus. The lentivirus concentration is LV-CAG-EGFP (control group, representing lentivirus without the target gene). Figure 3 a) 1.50×10 6 TU / mL; LV-IDUA-EGFP (experimental group, representing lentivirus containing the target gene, Figure 3 b) : 2.00×10 6 TU / mL.

[0120] Further analysis of IDUA expression efficiency in the experimental group yielded the following results: Figure 4 As shown, when HEK 293FT cells were infected with LV-IDUA-EGFP, the level of IDUA gene mRNA was significantly increased compared with the control group.

[0121] S1-2, Lin was isolated from bone marrow cells using a magnetic bead sorting method. - BMC.

[0122] S1-2-1. Prepare bone marrow stem cells. Rinse the medullary axis with PBS buffer using a 20mL syringe and a 1mL syringe needle. Collect mouse bone marrow cells from the femur (and tibia). Gently disperse large tissue fragments to separate the cells.

[0123] S1-2-2: Remove cell clumps that may clog the chromatographic column by passing the filter through a 70μm membrane.

[0124] S1-2-3. Add PBS buffer to wash cells, centrifuge at 300×g for 10 min, 4℃, and completely aspirate the supernatant.

[0125] S1-2-4. Resuspend the cell particles in PBS buffer, and count the samples using a cell counting chamber (approximately 10). 7 Cell count / mL).

[0126] All of the above experimental steps were carried out on ice or at 4°C.

[0127] S1-2-5. Perform red blood cell lysis using RBC Lysis buffer according to the instructions.

[0128] S1-2-6, Magnetic bead sorting Lin - BMC. The operation is performed according to the Lineage Cell Depletion Kit mouse instruction manual, specifically as follows:

[0129] 500uL of bone marrow stem cells (10 7 Centrifuge at 300×g for 10 min (cell count / mL), and aspirate the supernatant. Resuspend the cell particles in 40 μL of buffer (PBS + 0.5% BSA). Then add 10 μL of biotinylated antibody mixture (Biotin-Antibody Cocktail), mix well, and incubate at 4-8℃ for 10 min. Add another 30 μL of buffer (PBS + 0.5% BSA) to terminate the reaction. Next, add 20 μL of anti-Biotin microbeads, mix well, and incubate at 4-8℃ for another 15 min. Wash the cell particles with 1-2 mL of buffer (PBS + 0.5% BSA), centrifuge at 300×g for 10 min, and completely aspirate the supernatant. Resuspend in 500 μL of buffer (PBS + 0.5% BSA).

[0130] S1-2-7. Sorting the cell population using a MACS separator. Place the test tube containing the magnetically labeled cells prepared in S1-2-6 into a MACS separator. First, rinse the column with 500 μL of buffer (PBS + 0.5% BSA). Then, add the cell suspension to the column, allowing the cells to slowly flow down. Collect the unadsorbed cell population, then rinse the column with 500 μL of buffer (PBS + 0.5% BSA), centrifuge at 300 × g for 10 min, repeating this process three times. Collect the cell population that flows down; this is the Lin. - BMC. The cell population adsorbed into the column is Lin. + BMC collected both cell populations and used fluorescence microscopy to observe and detect cell purity.

[0131] S2. The lentivirus containing the IDUA gene obtained in step S1 is transfected into Lin via centrifugation. -BMC, to obtain Lin containing the IDUA gene - BMC;

[0132] Specifically:

[0133] S2-1. The sorted Lin - BMCs were cultured in SFEM2 basal medium supplemented with mouse stem cell growth factor (mSCF), thrombopoietin (TPO), and recombinant human Flt3 ligand (FLt3L), and placed in a cell culture incubator at 37°C and 5% CO2 for 24 hours.

[0134] S2-2, Add virus particles with an MOI of 20 and polybrane to achieve a working concentration of 10 μg / mL. This helps the virus to better infect Lin. - BMC cells, due to Lin - BMCs are suspension cells, and commonly used viral infection methods are inefficient. Therefore, a centrifugal infection method was used. The 24-well plate was centrifuged at room temperature (2,400 × g) for 1.5 h, then placed in a cell culture incubator at 37°C and 5% CO2 for 6 h. Subsequently, 700 μL of culture medium was added, and the fluorescence percentage was observed after 2 days. The experimental results are as follows: Figure 5 As shown, the fluorescence percentage reached 50.93%.

[0135] S2-3 and α-l-idurosidase (enzyme encoded by the IDUA gene) activity assay

[0136] S2-3-1, Using 10 7 The ratio of cells / 1 mL PBS buffer in Lin containing the IDUA gene - Add PBS buffer to BMC cells and mix.

[0137] S2-3-2. Freeze the above mixture with liquid nitrogen, and thaw it three times in a 37°C water bath, using a vortex after each thawing.

[0138] S2-3-3, Centrifuge at 13,000×g, 4℃ for 5 min, collect the supernatant for subsequent experimental operations.

[0139] S2-3-4. Prepare a 96-well plate and add the following reagents to each well: 10 μL sample (tissue homogenate or culture medium), 10 μL 4-Methylumbelliferyl-α-L-Iduronide (4-MU-I), and 40 μL sodium formate buffer (0.2 M, pH 2.8). Incubate at 37°C for 1 h.

[0140] Preparation of S2-3-5 and 4-MU standard curves. Standard samples were prepared at concentrations of 64 μM, 32 μM, 16 μM, 8 μM, 4 μM, 2 μM, 1 μM, 0.5 μM, 0.25 μM, and 0.125 μM. Each concentration was tested three times and incubated at 37 °C for 1 h.

[0141] S2-3-6. Add 175 μL of termination buffer (0.5 M glycine-NaOH, pH 10.3) to terminate the reaction.

[0142] The fluorescence of the S2-3-7 and 4-MU products was excited and emitted at 365 and 455 nm, respectively.

[0143] S2-3-8. Determine the equation from the 4-MU standard curve: y = kx + b, r 2 ≈1.00 (usually >0.95). The activity of α-l-idurosidase was calculated using the following formula, expressed in U (nmol substrate / h / mg protein).

[0144] Note the units of each variable: b is a constant obtained from the standard curve above, y (μM), t (h), and C (sample protein concentration, mg / L). In this experiment, the enzyme activity efficiency of lentivirus overexpressing IDUA infected with Lin-BMC was detected as follows: Figure 6 As shown.

[0145] like Figure 6 As shown, HEK 293FT cells were infected with a control group (CAG-EGFP, representing a lentivirus without the target gene) and an experimental group (ldua-EGFP, representing a lentivirus containing the target gene). Figure 6 A) BMCs cells ( Figure 6 B) and Lin - BMC cells ( Figure 6 C), all statistical data are mean ± standard deviation (SD). The results show that all experimental groups exhibited high enzyme activity after cell infection, but the experimental group infected with Lin... - BMC cells have the highest enzyme activity.

[0146] S3. Take the Lin containing the IDUA gene obtained in step S2. - BMC differentiation yields microglia expressing the IDUA gene.

[0147] Specifically:

[0148] S3-1, Transplantation efficiency test:

[0149] Mucopolysaccharidosis (IDUA KO mice) is caused by a defect in the IDUA gene, which leads to a deficiency in the function of the encoded IDUA enzyme. This results in the accumulation of mucopolysaccharides in cells, causing cellular dysfunction, especially in specialized phagocytes, including microglia.

[0150] IDUA KO mice were first treated with PLX5622 and busulfan for myeloablation (refer to Xu Z, STAR Protocol. 2021). Then, lin mice overexpressing IDUA were... - BMC was injected into IDUA KO mice via the tail vein, and the transplantation efficiency could be observed by fluorescence detection one month later.

[0151] like Figure 7 The figure shows the transplantation efficiency of microglia in the brains of IDUA KO mice. Figure 7 The fluorescence image of A shows LV-IDUA-EGFP infection of Lin - BMC (EGFP, green) enters the brain and differentiates into microglia-like cell type (IBA1, red). Figure 7 B. Data statistics show the microglia replacement efficiency in different groups. All statistical data are mean ± SD. Figure 7 This indicates that LV-IDUA-EGFP infection of Lin - BMCs can cross the blood-brain barrier to enter the central nervous system and successfully differentiate into mature microglia-like cell types, expressing molecules such as ionized calcium-binding aptamer 1 (IBA1), demonstrating the effectiveness of transplantation.

[0152] S3-2, Behavioral Improvement Effects

[0153] IDUA KO mice exhibit reduced motor and cognitive memory abilities due to abnormal skeletal development and excessive accumulation of mucopolysaccharides within cells. This decline shows a cumulative effect, with symptoms becoming more pronounced with age. This experiment examined motor-related behaviors in mice, including a grip test, and observed the effects of injecting LV-IDUA-EGFP-infected Lin... - The allergic effect of BMC on IDUA KO mice.

[0154] The grip strength test in this experiment includes forelimb strength testing (such as...) Figure 8 A) Limb strength (such as...) Figure 8 B) Test. Forelimb strength test results are as follows: Figure 8 As shown in C, the maximum gripping force and latency to reach the maximum gripping force were statistically analyzed for each group of mice in the forelimb gripping test. The limb strength test results are as follows: Figure 8As shown in Figure D, the maximum gripping force and latency to reach maximum gripping force were statistically analyzed in the limb gripping tests of mice in each group. All statistical data are mean ± standard deviation (SD). The results indicate that IDUA KO mice, compared to IDUA mice... + / + In mice, the strength of the limbs was significantly weakened, while the LV-IDUA treatment group showed a significant improvement in the grip strength of the limbs compared to the LV-Ctrl group.

[0155] In this embodiment, purified bone marrow stem cells are preferably infected with a lentiviral vector that overexpresses the target gene IDUA, and the gene-edited bone marrow stem cells are injected into mice lacking the IDUA gene, causing them to differentiate into microglia expressing the target gene IDUA in the brain, thereby replacing the original microglia lacking the target gene IDUA in the mice.

[0156] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1. A method for constructing microglia expressing the IDUA gene, characterized in that, It includes the following steps: S1. Construct and culture lentivirus containing the IDUA gene; sort Lin - bone marrow stem cells from bone marrow cells by magnetic bead sorting - bone marrow stem cells S2. Transfect the lentivirus containing the IDUA gene obtained in step S1 into Lin - bone marrow stem cells by centrifugal infection method to obtain Lin - bone marrow stem cells containing the IDUA gene; S3. Differentiate the Lin bone marrow stem cells containing the IDUA gene obtained in step S2 into microglia expressing the IDUA gene. - The Lin bone marrow stem cells containing the IDUA gene obtained in step S2 are differentiated into microglia expressing the IDUA gene.

2. The construction method of a microglia expressing the IDUA gene according to claim 1, characterized in that, In step S1, the specific steps for constructing and culturing the lentivirus containing the IDUA gene are as follows: The IDUA gene with the nucleotide sequence shown in SEQ ID NO.1 is constructed with the lentiviral vector plenti-CAG-EGFP to obtain the plenti-CAG-IDUA-EGFP recombinant plasmid. The plenti-CAG-IDUA-GFP recombinant plasmid, PxpAx2 plasmid, PMD2g plasmid and DMEM medium are mixed and denoted as solution A; The transfection reagent and DMEM medium are mixed and denoted as solution B; Solution B is added dropwise to solution A for mixing, and then added dropwise to HEK 293FT cells for transfection and culture to obtain the lentivirus containing the IDUA gene.

3. The construction method of a microglia expressing the IDUA gene according to claim 2, characterized in that, The mass ratio of the plenti-CAG-IDUA-EGFP recombinant plasmid, PxpAx2 plasmid, and PMD2g plasmid is 4:3:1; The ratio of the total mass of the plenti-CAG-IDUA-EGFP recombinant plasmid, PxpAx2 plasmid, and PMD2g plasmid to the DMEM medium is 20 μg:500 μL; The concentration of the transfection reagent is 1 μg / mL, and the ratio of 1 μg / mL of the transfection reagent to the DMEM medium is 60 μg:500 μL.

4. The construction method of a microglia expressing the IDUA gene according to claim 1, characterized in that, In step S1, the specific steps of magnetic bead sorting are as follows: Add buffer to bone marrow cells to resuspend cell particles, then add a biotinylated antibody mixture, mix well and incubate. After terminating the reaction, add antibiotin microbeads, mix well and incubate. Wash the cell particles and resuspend them, and then drop the resuspended cell particles onto a separation column placed in a magnetic field. Centrifuge to collect the cells flowing out of the separation column, which are Lin - bone marrow stem cells.

5. The construction method of a microglia expressing the IDUA gene according to claim 4, characterized in that, The concentration of the resuspended bone marrow cells is 10 7 cells / mL. The volume ratio among the resuspended bone marrow cells, the biotinylated antibody mixture, and the avidin microbeads is 50:1:2; The antibody molecules in the biotinylated antibody mixture include CD5 antibody, CD45R (B220) antibody, CD11b antibody, Gr-1 (Ly-6G / C) antibody, Ly-6B.2 antibody, and Ter-119 antibody.

6. The construction method of a microglia expressing the IDUA gene according to claim 1, characterized in that, In step S2, the specific steps of the centrifugal infection method are as follows: Lin - bone marrow stem cells are cultured in the SFEM2 basal medium supplemented with cofactors, and lentivirus containing the IDUA gene and Polybrene are added. After centrifugation at room temperature, they are placed in a CO2 incubator for culture.

7. The construction method of a microglia expressing the IDUA gene according to claim 6, characterized in that, The cofactors include mSCF, TPO, FLt3L, and the addition amounts are all 100 ng / mL respectively.

8. The construction method of a microglia expressing the IDUA gene according to claim 6, characterized in that, Lentivirus containing the IDUA gene and Lin - The MOI of bone marrow stem cells is 20, and the working concentration of polybrene added to the SFEM2 basal medium is 10 μg / mL.

9. A microglia expressing the IDUA gene, characterized in that, Obtained based on the construction method of microglia expressing the IDUA gene according to any one of claims 1-8.

10. Use of microglia expressing the IDUA gene as described in claim 9 in the preparation of products for treating mucopolysaccharidosis.

Images