Application of cassava common mosaic virus cp in down-regulating megrxc3

Abstract

This invention provides the application of the CP gene, or the protein encoded by the CP gene, or a recombinant vector or host bacterium containing the coding region of the CP gene, in downregulating MeGRXC3 expression levels. This invention reveals an interaction between CP and MeGRXC3, which can enhance the growth of yeast in SD / -Leu / -Trp / -His / -Ade auxotrophic media, activate autophagy, downregulate MeGRXC3 expression, and increase the reactive oxygen species content in plant tissues co-expressing MeGRXC3. These findings will lay a theoretical foundation for breeding cassava mosaic virus resistance.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of cassava mosaic virus CP in downregulating MeGRXC3. Background Technology

[0002] Cassava (Manihot esculenta) is a perennial crop belonging to the Euphorbiaceae family, mainly cultivated in tropical and subtropical countries and regions. It is the world's sixth largest food crop, and related industries play a vital role in the agricultural economy. Cassava mosaic virus disease is devastating to the cassava industry, causing a loss of 25 million tons of cassava production globally each year, affecting the food security of over 500 million people. Cassava common mosaic virus (CsCMV) belongs to the Potexvirus genus of the Alphaflexiviridae family. CsCMV was first reported in southern Brazil. CsCMV exhibits typical molecular characteristics of Potexviruses, being a monoid, positive-sense ssRNA (+) curved virus with a particle size of approximately 15 nm × 495 nm. The genome is approximately 6.4 kb in size, with a cap structure at the 5′ end and a poly(A) tail at the 3′ end, producing three subgenomic RNAs (sgRNAs) and containing five open reading frames (ORFs): ORF1 at the 5′ end encodes a 165 kD RNA-dependent RNA polymerase (RdRp), essential for viral replication; the three middle ORFs (ORF2, ORF3, and ORF4) encode three overlapping triple gene block proteins (TGBs): CP (25 kD), TGBp2 (12 kD), and TGBp3 (10 kD); and ORF5 at the 3′ end encodes a 24 kD coat protein (CP). ORF1 is directly synthesized from viral genomic RNA, while the other ORFs are translated from sgRNAs. Studies have shown that RdRp is the only viral protein absolutely required for viral replication, while CP-3 and CP are essential for viral intercellular or long-distance movement. Currently, there are few research reports on CsCMV both domestically and internationally, and the research is still in the detection and identification stage. The host range, transmission vector, and gene function of CsCMV are unclear, and in-depth research is urgently needed. This invention discovers that CP interacts with cassava glutoredoxin 3 (MeGRXC3) and downregulates its expression, as well as increasing the reactive oxygen species content in plant tissues co-expressing MeGRXC3. Summary of the Invention

[0003] The purpose of this invention is to overcome the shortcomings of the prior art and provide the application of cassava mosaic virus CP in downregulating MeGRXC3 and increasing the reactive oxygen species content in plant tissues co-expressing MeGRXC3.

[0004] The first aspect of the present invention is to provide the use of the CP gene, or the protein encoded by the CP gene, or a recombinant vector or host bacterium containing the coding region of the CP gene in downregulating the expression level of MeGRXC3.

[0005] The nucleotide sequence of the CP gene is shown in SEQ ID NO:1.

[0006] The nucleotide sequence of the gene corresponding to MeGRXC3 is shown in SEQ ID NO:2.

[0007] A second aspect of the invention is to provide the use of the CP gene, or the protein encoded by the CP gene, or a recombinant vector or host bacterium containing the coding region of the CP gene in interaction with MeGRXC3.

[0008] Specifically, the interaction between CP and MeGRXC3 leads to a downregulation of MeGRXC3 expression levels.

[0009] Among them, the interaction between CP and MeGRXC3 increases the content of reactive oxygen species in plant tissues.

[0010] Among them, the interaction between CP and MeGRXC3 improves the growth ability of yeast in SD / -Leu / -Trp / -His / -Ade auxotrophic media.

[0011] Among them, the interaction between CP and MeGRXC3 enhances the autophagic flux in tobacco leaves.

[0012] A third aspect of the present invention is to provide the application of the CP gene and the MeGRXC3 corresponding gene, or the protein encoded by the CP gene and the protein encoded by the MeGRXC3 corresponding gene, or a recombinant vector or host bacterium containing the coding region of the CP gene and a recombinant vector or host bacterium containing the coding region of the MeGRXC3 corresponding gene in increasing the reactive oxygen species content in plant tissues.

[0013] A fourth aspect of the present invention is to provide the application of the CP gene and the MeGRXC3 corresponding gene, or the protein encoded by the CP gene and the protein encoded by the MeGRXC3 corresponding gene, or a recombinant vector or host bacterium containing the coding region of the CP gene and a recombinant vector or host bacterium containing the coding region of the MeGRXC3 corresponding gene in improving the growth ability of yeast in SD / -Leu / -Trp / -His / -Ade auxotrophic media.

[0014] The fifth aspect of the present invention is to provide the application of the CP gene and the MeGRXC3 corresponding gene, or the protein encoded by the CP gene and the protein encoded by the MeGRXC3 corresponding gene, or a recombinant vector or host bacterium containing the coding region of the CP gene and a recombinant vector or host bacterium containing the coding region of the MeGRXC3 corresponding gene in improving autophagic flux in tobacco leaves.

[0015] This invention reveals an interaction between CP and MeGRXC3, which can enhance yeast growth in SD / -Leu / -Trp / -His / -Ade auxotrophic media, activate autophagy, downregulate MeGRXC3 expression, and increase reactive oxygen species (ROS) content in plant tissues co-expressing MeGRXC3. These findings will lay a theoretical foundation for breeding cassava mosaic virus-resistant varieties. Attached Figure Description

[0016] Figure 1 The interaction between pGADT7-CP and pGBKT7-MeGRXC3 yeast was studied. SD-LW: SD-LW / -Leu / -Trp medium; SD-LWHA: SD-LWHA / -Ade / -His / -Leu / -Trp medium.

[0017] Figure 2 To verify the interaction between CP protein and MeGRXC3 protein in tobacco for BiFC. Top image: MeGRXC3-FYP, p1300-YNs and nuclear localization marker H2B-RFP co-injected into tobacco; Bottom image: MeGRXC3-FYC, YNs-CP and nuclear localization marker H2B-RFP co-injected into tobacco.

[0018] Figure 3 Fluorescence observation on day 5 after co-expression of MeGRXC3-GFP with different concentrations of YNs-CP.

[0019] Figure 4 Western blotting was used to detect the accumulation level of MeGRXC protein in *Nicotiana benthamiana* leaves on day 5 after inoculating them with Vec and CP-Flag, respectively. MeGRXC3-GFP: plant expression vector expressing MeGRXC3-GFP; Vec: empty vector; CP-Flag: CP-tagged vector; CP-Flag: Flag antibody; GFP: GFP antibody; Rubisco: Rubisco Coomassie brilliant blue staining.

[0020] Figure 5The effects of CP on reactive oxygen species in leaf tissues co-expressed with MeGRXC3 were detected by laser scanning imaging (left) and DAB staining (right). p1300-Flag + CP-GFP: empty vector and CP-GFP co-infiltrated Tobacco Bunsenii leaves; p1300-Flag + pG1300: empty vector and pG1300 vector expressing only GFP co-infiltrated Tobacco Bunsenii leaves; MeGRXC3-Flag + CP-GFP: MeGRXC3-Flag and CP-GFP co-infiltrated Tobacco Bunsenii leaves; MeGRXC3-Flag + pG1300: MeGRXC3-Flag and pG1300 vector expressing only GFP co-infiltrated Tobacco Bunsenii leaves.

[0021] Figure 6 The effect of co-expression of MeGRXC3-RFP and CP-Flag on autophagic flux. Confocal microscopy observation on the 4th day after MeGRXC3-RFP and GFP-AtATG8 with empty vector or CP-Flag with empty vector and CP-GFP respectively (top figure) and autophagosome statistics (bottom figure). Detailed Implementation

[0022] The present invention will be further described below with reference to the accompanying drawings and specific embodiments to better understand the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0023] 1. Experimental Materials Ben's tobacco ( Nicotiana benthamiana Seed and yeast two-hybrid expression vectors pGADT7, pGBKT7-Lam, pGADT7-T, pGBKT7-53, and pGBKT7-MeGRXC3, as well as plant expression vectors p1300-YNs, YNs-CP, FYC-MeGRXC3, MeGRXC3-RFP, and pZP-P19, were all preserved in the laboratory. Restriction endonuclease BamH11 was also used. EcoR I and other tool enzymes were purchased from Baori Biotechnology (Beijing) Co., Ltd.; the high-efficiency seamless cloning kit was purchased from Mona Biotechnology Co., Ltd.; the agarose gel DNA kit and agarose gel recovery kit were purchased from Shanghai Yihui Biotechnology Co., Ltd.; Escherichia coli DH5α, Agrobacterium tumefaciens competent cells GV3101 and yeast competent cells AH109 were all purchased from Shanghai Weidi Biotechnology Co., Ltd.; LB medium was purchased from Shanghai Sangon Biotech Co., Ltd.; the plasmid mini-prep kit and DNA marker were purchased from Beijing Tiangen Biotech Co., Ltd.; SD / -Trp / -Leu (SD-LW) and SD / -Trp / -Leu / -His / -Ade (SD-LWHA) media were all purchased from Beijing Kulaibo Technology Co., Ltd.; kanamycin ( Kanamycin ), ampicillin ( Ampicillin Rifampin Rifampicin Purchased from Beijing Suobaolai Technology Co., Ltd.; Spectinomycin ( Spectinomycin Shanghai Yisheng Biotechnology Co., Ltd.

[0024] 2 Experimental Methods and Results

[0025] 2.1 Construction of expression vector (1) Construction of yeast expression vector AD-CP Using pCsCMV as a template, the target fragment CPEB (specific sequence shown in Table 2) was amplified using primers CP-1F EcoRI and CP-687R BamHI (specific primer sequences are shown in Table 1). The PCR product was double-digested with EcoRI and BamHI and then ligated with the large fragment of the yeast expression vector pGADT7, which had been double-digested with the same enzymes. The ligation product was transformed into E. coli, and the positive clones were identified by sequencing and named AD-CP (also known as pGADT7-CP).

[0026] (2) Construction of yeast expression vector BD-MeGRXC3 The target fragment MeGRXC3-EcoRI & BamHI (specific sequences shown in Table 2) was artificially synthesized by Shanghai Sangon Biotech Co., Ltd., with restriction endonucleases EcoRI and BamHI added to both ends respectively. After double digestion with EcoRI and BamHI, the target fragment was ligated to a pGBKT7 fragment that had also been double-digested. The ligation product was transformed into E. coli, and positive clones, after being confirmed by sequencing, were named BD-MeGRXC3 (also known as pGBKT7-MeGRXC3).

[0027] (3) Construction of plant expression vector YNs-CP Using pCsCMV as a template, the target fragment CPMK (specific sequence shown in Table 2) was amplified using primers CP-1F MluI and CP-687R KpnI (specific sequences are shown in Table 1). The PCR product was double-digested with MluI and KpnI and then ligated to a large fragment of the plant expression vector p1300-YNs (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Study on the interaction between cassava mosaic virus AC4 protein and AtPARN [J]. Journal of Tropical Crops, 2024, 45(01): 197-204.) which had been double-digested with the same enzymes. The ligation product was transformed into Escherichia coli, and the positive clone was identified by sequencing and named YNs-CP.

[0028] (4) Construction of plant expression vector CP-GFP Using pCsCMV as a template, the target fragment CPSK (specific sequence shown in Table 2) was amplified using primers CP-1F SpeI and CP-687R KpnI (specific sequences are shown in Table 1). The PCR product was double-digested with SpeII and KpnI and then ligated with a large fragment of the plant expression vector pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNAsilencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166). The ligation product was transformed into Escherichia coli, and the positive clone was identified by sequencing and named CP-GFP.

[0029] (5) The construction method of the plant expression vector MeGRXC3-YC is as follows: The target fragment MeGRXC3-SpeI&KpnI (specific sequences are shown in Table 2) was artificially synthesized by Shanghai Sangon Biotech Co., Ltd. with restriction endonucleases SpeI and KpnI added to both ends respectively. The fragment was then double-digested with SpeI and KpnI and ligated to a large fragment of p1300-FYC (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166). The ligation product was transformed into E. coli, and the positive clone was identified by sequencing and named MeGRXC3-YC.

[0030] (6) The construction method of the plant expression vector MeGRXC3-GFP is as follows: The synthesized target fragment MeGRXC3-SpeI & KpnI was double-digested with SpeI and KpnI and then ligated with a large fragment of pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNAsilencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166). The ligation product was transformed into E. coli, and the positive clone was identified by sequencing and named MeGRXC3-GFP.

[0031] (7) The construction method of the plant expression vector MeGRXC3-RFP is as follows: The synthesized target fragment MeGRXC3-SpeI & KpnI was double-digested with SpeI and KpnI and then ligated with a large fragment of pR1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNAsilencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166). The ligation product was transformed into E. coli, and the positive clone was identified by sequencing and named MeGRXC3-RFP.

[0032] (8) The method for constructing the empty vector p1300-Flag is as follows: The target fragment Flag-XbaI & SacI (specific sequences are shown in Table 2) was artificially synthesized by Shanghai Sangon Biotech Co., Ltd. with restriction endonucleases XbaI and SacI added to both ends respectively. The fragment was then double-digested with XbaI and SacI and ligated to a large fragment of pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166). The ligation product was transformed into E. coli, and the positive clone was identified by sequencing and named p1300-Flag.

[0033] (9) The construction method of the plant expression vector CP-Flag is as follows: Using pCsCMV as a template, the target fragment CPXB (specific sequence shown in Table 2) was amplified using primers CP-1F XbaI and CP-687R BamHI (specific sequences are shown in Table 1). The target fragment CPXB was double-digested with XbaI & BamHI and ligated to the p1300-Flag large fragment constructed above after being double-digested with the same enzymes. The ligation product was transformed into E. coli, and the positive clone was identified by sequencing and named CP-Flag.

[0034] (10) The construction method of the plant expression vector MeGRXC3-Flag is as follows: The target fragment MeGRXC3-XbaI & BamHI (specific sequences are shown in Table 2) was artificially synthesized by Shanghai Sangon Biotech Co., Ltd. with restriction endonucleases XbaI and BamHI added to both ends. The fragment was then double-digested with XbaI and BamHI and ligated to the p1300-Flag fragment constructed above, which had been double-digested with the same enzymes. The ligation product was transformed into E. coli, and the positive clone was identified by sequencing and named MeGRXC3-Flag.

[0035] (11) The construction method of the plant expression vector GFP-MeATG8f is as follows: The target fragment MeATG8f-SpeI & SacI (specific sequences are shown in Table 2) was artificially synthesized by Shanghai Sangon Biotech Co., Ltd., with restriction endonucleases SpeI and SacI added to both ends. The fragment was then double-digested with SpeI and SacI and ligated to a similarly double-digested GFP-AtATG8 fragment (Liu X, Kong H, Liu L, Xie Q, Fu Y, Yu X, Li W, RenY, Ruan M, Zhang X. Sri Lankan cassava mosaic virus Silencing Suppressor AC4Mediates Autophagic Degradation of SGS3 / RDR6 Bodies in Plants. Plant CellEnviron. 2025 Apr 3. doi: 10.1111 / pce.15511). The ligation product was transformed into E. coli, and the positive clone, after being correctly identified by sequencing, was named GFP-MeATG8f.

[0036] Table 1 Primers used CP-1F EcoRI <![CDATA[ GAATTC ATGGCCACCCCCACCTCAACCA]]> CP-1F XbaI <![CDATA[ TCTAGA ATGGCCACCCCCACCTCAACCA]]> CP-687R BamHI <![CDATA[ GGATCC TCACTCATCCACCCCTGTGAGGAAC]]> CP-1F MluI <![CDATA[ ACGCGT ATGGCCACCCCCACCTCAACCA]]> CP-687R KpnI <![CDATA[ GGTACC CTCATCCACCCCTGTGAGGAAC]]> CP-1F SpeI <![CDATA[ ACTAGT ATGGCCACCCCCACCTCAACCA]]> Table 2 Target Fragment Sequence CPEB <![CDATA[ GAATTC ATGGCCACCCCCACCTCAACCACTCCTACAACTGCAACAGCCACTCAAGCTGCGACCACCCCACTCTCAGCCCTTTCCACGGCTCCAACTGATGAAGAGTTGAGCCGTCTTGACCTGAAGCCAGCCTCCAATTTGGTCGCCTCAGCGGATGCCCTCTCAGCAATTGCTGCAGACTGGGCCAGTCTGAAGGTACCCACTGCACAACTCATGAGGCATGCCCTAGACCTGGTCAACTTCTGCTTTGATAGTGGGAGCTCAAAGTACACAACCGTGGAAGGCTCTTCACCAACACCCACCATTCCACGTGCTACACTTGCTGGAGTAGTGCGAAAGCATACAACTCTACGCCAATTCTGCCGCTACTACGCAAAGATCATCTGGAATGCTAGAGTCAAAGCCAACATACCTCCTGCTGGTTATGCAAACGCCCATATCAAACCTGAGCAGGCTTTTGCTGGCTTTGACTTCTTTGATGGGGTCATGAATGTAGCTGCGCTAGAACCCTCTGGTGGTCTAGTCAGGGACCCGACACCGCAAGAAATTATTGCAGCAGAGACAGCACGGTCCCTCAACCTGTTTGAAGCACAATCGAAAGGAAACAATCTAGCCACCAATGCAACCCAGGTCACACGTGGTCGATTGAGCAGCTCTGAACCACAAGTGCAGTTCCTCACAGGGGTGGATGAGGGATCC <!-- 6 -->]]> CPMK <![CDATA[ ACGCGT ATGGCCACCCCCACCTCAACCACTCCTACAACTGCAACAGCCACTCAAGCTGCGACCACCCCACTCTCAGCCCTTTCCACGGCTCCAACTGATGAAGAGTTGAGCCGTCTTGACCTGAAGCCAGCCTCCAATTTGGTCGCCTCAGCGGATGCCCTCTCAGCAATTGCTGCAGACTGGGCCAGTCTGAAGGTACCCACTGCACAACTCATGAGGCATGCCCTAGACCTGGTCAACTTCTGCTTTGATAGTGGGAGCTCAAAGTACACAACCGTGGAAGGCTCTTCACCAACACCCACCATTCCACGTGCTACACTTGCTGGAGTAGTGCGAAAGCATACAACTCTACGCCAATTCTGCCGCTACTACGCAAAGATCATCTGGAATGCTAGAGTCAAAGCCAACATACCTCCTGCTGGTTATGCAAACGCCCATATCAAACCTGAGCAGGCTTTTGCTGGCTTTGACTTCTTTGATGGGGTCATGAATGTAGCTGCGCTAGAACCCTCTGGTGGTCTAGTCAGGGACCCGACACCGCAAGAAATTATTGCAGCAGAGACAGCACGGTCCCTCAACCTGTTTGAAGCACAATCGAAAGGAAACAATCTAGCCACCAATGCAACCCAGGTCACACGTGGTCGATTGAGCAGCTCTGAACCACAAGTGCAGTTCCTCACAGGGGTGGATGAG GGTACC <!-- 7 -->]]> CPSK <![CDATA[ ACTAGT ATGGCCACCCCCACCTCAACCACTCCTACAACTGCAACAGCCACTCAAGCTGCGACCACCCCACTCTCAGCCCTTTCCACGGCTCCAACTGATGAAGAGTTGAGCCGTCTTGACCTGAAGCCAGCCTCCAATTTGGTCGCCTCAGCGGATGCCCTCTCAGCAATTGCTGCAGACTGGGCCAGTCTGAAGGTACCCACTGCACAACTCATGAGGCATGCCCTAGACCTGGTCAACTTCTGCTTTGATAGTGGGAGCTCAAAGTACACAACCGTGGAAGGCTCTTCACCAACACCCACCATTCCACGTGCTACACTTGCTGGAGTAGTGCGAAAGCATACAACTCTACGCCAATTCTGCCGCTACTACGCAAAGATCATCTGGAATGCTAGAGTCAAAGCCAACATACCTCCTGCTGGTTATGCAAACGCCCATATCAAACCTGAGCAGGCTTTTGCTGGCTTTGACTTCTTTGATGGGGTCATGAATGTAGCTGCGCTAGAACCCTCTGGTGGTCTAGTCAGGGACCCGACACCGCAAGAAATTATTGCAGCAGAGACAGCACGGTCCCTCAACCTGTTTGAAGCACAATCGAAAGGAAACAATCTAGCCACCAATGCAACCCAGGTCACACGTGGTCGATTGAGCAGCTCTGAACCACAAGTGCAGTTCCTCACAGGGGTGGATGAG GGTACC <!-- 8 -->]]> CPXB <![CDATA[ TCTAGA ATGGCCACCCCCACCTCAACCACTCCTACAACTGCAACAGCCACTCAAGCTGCGACCACCCCACTCTCAGCCCTTTCCACGGCTCCAACTGATGAAGAGTTGAGCCGTCTTGACCTGAAGCCAGCCTCCAATTTGGTCGCCTCAGCGGATGCCCTCTCAGCAATTGCTGCAGACTGGGCCAGTCTGAAGGTACCCACTGCACAACTCATGAGGCATGCCCTAGACCTGGTCAACTTCTGCTTTGATAGTGGGAGCTCAAAGTACACAACCGTGGAAGGCTCTTCACCAACACCCACCATTCCACGTGCTACACTTGCTGGAGTAGTGCGAAAGCATACAACTCTACGCCAATTCTGCCGCTACTACGCAAAGATCATCTGGAATGCTAGAGTCAAAGCCAACATACCTCCTGCTGGTTATGCAAACGCCCATATCAAACCTGAGCAGGCTTTTGCTGGCTTTGACTTCTTTGATGGGGTCATGAATGTAGCTGCGCTAGAACCCTCTGGTGGTCTAGTCAGGGACCCGACACCGCAAGAAATTATTGCAGCAGAGACAGCACGGTCCCTCAACCTGTTTGAAGCACAATCGAAAGGAAACAATCTAGCCACCAATGCAACCCAGGTCACACGTGGTCGATTGAGCAGCTCTGAACCACAAGTGCAGTTCCTCACAGGGGTGGATGAG GGATCC ]]> MeGRXC3-EcoRI & BamHI GAATTCATGGACGCAGTGACAAGAATGGTTGCAGAGAGACCACTGGTGATCTTCAGCAGGAGCACCTGTGACATGTGCCACTCCATTAAGACACTGATACTTGGATTTGGAGCAAATCCTACAATCTATGAGCTTGATCAAATTCCGAACGGCCAGCAAATTGAAAGAGCATTGCAGCAGCTAGGGTGCCAGAACTTACCAGCAGTATTCATAGGGGGCGAGTGTGTGGGTGGTGACAGGCAAGTCATGAGCTTACTGCTGAAGAACCAGTTAGGCCCATTGCTAAAGAGGGCTGGTGCCATATGGGTCTGGAATGATTAGGGATCC MeGRXC3-SpeI& KpnI ACTAGTATGGACGCAGTGACAAGAATGGTTGCAGAGAGACCACTGGTGATCTTCAGCAGGAGCACCTGTGACATGTGCCACTCCATTAAGACACTGATACTTGGATTTGGAGCAAATCCTACAATCTATGAGCTTGATCAAATTCCGAACGGCCAGCAAATTGAAAGAGCATTGCAGCAGCTAGGGTGCCAGAACTTACCAGCAGTATTCATAGGGGGCGAGTGTGTGGGTGGTGACAGGCAAGTCATGAGCTTACTGCTGAAGAACCAGTTAGGCCCATTGCTAAAGAGGGCTGGTGCCATATGGGTCTGGAATGATGGTACC Flag-BamHI & SacI GGATCCACGCGTATGgactacaaggacgacgatgacaaggattacaaagatgacgacgataaggactataaggacgatgatgataaatagTAAGAGCTC MeGRXC3 - XbaI & BamHI TCTAGAATGGACGCAGTGACAAGAATGGTTGCAGAGAGACCACTGGTGATCTTCAGCAGGAGCACCTGTGACATGTGCCACTCCATTAAGACACTGATACTTGGATTTGGAGCAAATCCTACAATCTATGAGCTTGATCAAATTCCGAACGGCCAGCAAATTGAAAGAGCATTGCAGCAGCTAGGGTGCCAGAACTTACCAGCAGTATTCATAGGGGGCGAGTGTGTGGGTGGTGACAGGCAAGTCATGAGCTTACTGCTGAAGAACCAGTTAGGCCCATTGCTAAAGAGGGCTGGTGCCATATGGGTCTGGAATGATGGATCC MeATG8f - SpeI & SacI ACTAGTATGGCAAGGAGCGGCTTCAAGCTAGAGCATGATTTTGAGAAGAGGCGCGCTGAGGCTGCAAGAATTAGGGATAAGTACCCAGATAGAATTCCGGTAATTGTGGAGAAGGCTGAGAGAAGTGATATTCCCACCATTGACAAGAAAAAATACCTAGTCCCAGCTGATCTGACAGTGGGTCAGTTTGTGTATGTAATCCGGAAGAGAATTAAACTGAGCGCAGAAAAGGCTATTTTCATATTTGTGGACAATGTACTCCCACCAACAGGAGCAGTAATGTCAACAATTTACGATGAAAAGAAGGATGCAGATGGATTTCTGTATGTGACATACAGCGGTGAGAACACCTTTGGGAGAGCAGATGCTGCTGTTGCTCAAGGCGGACTATAAGAGCTC

[0037] 2.2 Yeast double hybridization to identify the interaction between CP and MeGRXC3 For ease of description, during co-transformation, the "pGADT7" vector was abbreviated as "AD", and the "pGBKT7" vector was abbreviated as "BD". The yeast expression vectors pGADT7, pGBKT7, AD-T (pGADT7-T), BD-lam (pGBKT7-lam), and BD-53 (pGBKT7-53) (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNAsilencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166.) were all preserved in our laboratory.

[0038] Table 3. Pairing combinations of yeast bait plasmids and prey plasmids 1 (Positive control) pGADT7 - T pGBKT7 - 53 2 (Negative control) pGADT7 - T pGBKT7 - lam 3 pGBKT7 - MeGRXC3 pGADT7 - CP 4 pGADT7 - CP pGBKT7 5 pGBKT7 - MeGRXC3 pGADT7 - T Following the co-transformation of yeast competent cells with different yeast expression vectors as shown in Table 3, single colonies identified by PCR were picked and resuspended in 25 μL of sterile water to prepare a suspension. The suspension was then serially diluted with sterile water to 10-fold, 100-fold, and 1000-fold, and 2 μL of each was inoculated into SD / -Leu / -Trp (SD-LW) and SD / -Leu / -Trp / -His / -Ade (SD-LWHA) auxotrophic media. Yeast co-transformed with AD-T and BD-Lam and AD-T and BD-53 were used as negative and positive controls, respectively. The yeast suspensions transformed with the target plasmid were inoculated together with the yeast suspensions in solid culture medium and incubated upside down in a 28°C incubator for 3 days to observe and record the growth.

[0039] Results of yeast two-hybrid studies as follows Figure 1 As shown, all co-transformed yeasts grew normally in SD-LW deficient medium. However, in SD-LWHA deficient medium, only the yeast positive control and yeasts co-transformed with pGADT7-CP and pGBKT7-MeGRXC3 grew normally. The negative control and yeasts co-transformed with pGADT7-CP and pGBKT7 or pGBKT7-MeGRXC3 and pGADT7 did not grow normally. These results indicate that CP and MeGRXC3 interact within yeast cells.

[0040] 2.3 Bimolecular fluorescence identification of the interaction between CP and MeGRXC3 BiFC vector p1300-YNs (Liu, L., Zhao, P., Fu, Y., et al. Study on the interaction between AC4 protein and AtPARN of cassava mosaic virus [J]. Journal of Tropical Crops, 2024, 45(01): 197-204.) and nuclear localization red light labeling vector H2B-RFP (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interactions with Arabidopsis SGS3 to enhance virus infection. Molecular plantpathology, 24(2), 154–166.) were both preserved in our laboratory.

[0041] (1) Plant expression vector transformed Agrobacterium GV3101 Plant expression vectors YNs-CP, p1300-YNs, MeGRXC3-YC, H2B-RFP, and the silencing repressor expression vector pZP-P19 (Qu, F., Ren, T., & Morris, TJ (2003) were used. The coat protein of turnipcrinkle virus suppresses posttranscriptional gene silencing at an early initiation step. Journal of virology , 77 (1), 511–522.) Agrobacterium GV3101 competent cells were transformed, and the transformed Agrobacterium was evenly spread on LB solid medium containing the corresponding resistance (YNs-CP, p1300-YNs, MeGRXC3, and H2B-RFP were spread on LB plates containing Kan and Rif resistance, and pZP-P19 was spread on LB plates containing Spec and Rif resistance, all at a working concentration of 50 μg / mL). The cells were incubated upside down at 28°C for 72–90 h. After 2–3 days, when Agrobacterium colonies reached 2–3 mm in diameter, single colonies were selected for PCR identification.

[0042] (2) Agrobacterium infiltrates Nicotiana bungeanum Single colonies identified as positive by colony PCR were picked using a pipette tip and added to 5 mL of LB liquid medium containing the corresponding antibiotic. The medium was then incubated overnight at 28°C with shaking at 200 rpm. After centrifugation at 7000 rpm for 15 min, the supernatant was discarded, and the precipitate was resuspended in 5 mL of injection buffer. The suspension was thoroughly vortexed and diluted to an OD600 of 0.5. After incubation at room temperature for 2-3 h, resuspensions of different recombinant vectors were mixed in a 1:1:1 ratio (specific combinations are shown in Table 4). MeGRXC3-YC was mixed with p1300-YNs and YNs-CP resuspensions for injection. For each combination, 1 / 10 of the total volume of the nuclear localization red light vector FIB2-RFP was added as a nuclear marker for localization. The mixture was thoroughly mixed and used for injection into vigorously growing, 5-7 leaf stage tobacco leaves. Each combination should be injected in at least three replicates. After injection, the nicotine should be protected from light overnight and then incubated under normal conditions. After 2-3 days, approximately 1-2 cm of each sample should be taken. 2 The fluorescence of tobacco cells was observed and photographed using a laser confocal microscope (Olympus FV3000). GFP excitation light was 488 nm, and RFP excitation light was 546 nm.

[0043] Observation results as follows Figure 2 As shown, co-injection of MeGRXC3-YC and YNs-CP into Nicotiana Bunsenata leaves restored green fluorescence under excitation light of 488 nm, which overlapped with the red fluorescence expressed by H2B-RFP under excitation light of 546 nm. However, co-injection of MeGRXC3-YC and p1300-YNs did not restore green fluorescence. The BiFC study results further illustrate the interaction between Sri Lankan cassava mosaic virus CP and MeGRXC3.

[0044] Table 4. Different Agrobacterium-mediated recombinant plasmid combinations 1 YNs-CP + MeGRXC3-YC + pZP-P19 + 1 / 10 nuclear-labeled H2B-RFP 2 p1300-YNs + MeGRXC3-YC + pZP-P19 + 1 / 10 nuclear-labeled H2B-RFP

[0045] 2.4 CP negatively regulates MeGRXC3 expression The single-chain green fluorescent protein expression vector pG1300 is preserved in our laboratory.

[0046] First, Agrobacterium (GV3101) competent cells were transformed with the recombinant plasmid according to the method in 2.3.

[0047] Then, following the method described in section 2.3, the Agrobacterium combinations from Table 5 were mixed thoroughly and injected into the same tobacco leaf. Fluorescence microscopy was used for observation on day 5 post-injection. The results are as follows: Figure 3As shown, the fluorescence intensity of MeGRXC3-GFP decreased with increasing YNs-CP bacterial concentration, indicating that CP negatively regulates MeGRXC3 expression.

[0048] To further confirm the negative regulation of MeGRXC3 expression by CP, we mixed MeGRXC3-GFP tagged with GFP with pZP-p19 and co-injected it with the empty vector (Vec) and CP-Flag into the left and right sides of the same leaf, respectively. Protein was extracted on day 5 post-injection, and Western blot analysis was performed using GFP antibody and Flag antibody, respectively. Results are as follows: Figure 4 As shown, the expression level of MeGRXC3-GFP after co-injection with CP-Flag was significantly lower than that after co-expression with Vec, further indicating that CP negatively regulates MeGRXC3 expression.

[0049] Table 5. Different Agrobacterium-mediated recombinant plasmid combinations 1 Buffer + MeGRXC3-GFP + pZP-P19 2 OD0.1 YNs-CP + MeGRXC3-GFP + pZP-P19 3 OD0.5 YNs-CP + MeGRXC3-GFP + pZP-P19 4 OD1.0 YNs-CP + MeGRXC3-GFP + pZP-P19

[0050] 2.5 Reactive oxygen content in CP and MeGRXC3 tobacco leaves First, recombinant plasmids were transformed into competent Agrobacterium (GV3101) cells according to the method in section 2.3. Then, Agrobacterium combinations from Table 6 were mixed and injected into the same tobacco leaf according to the method in section 2.3. On the third day after injection, changes in ROS were observed and detected by laser scanning imaging at 532 nm and DAB staining.

[0051] Leaves were collected 3 days after injection, immersed in DAB staining solution, and allowed to react in the dark for 3 hours. They were then transferred to stop solution and boiled in a water bath for 10 minutes. The leaves were decolorized with 95% ethanol until chlorophyll was completely removed, then transferred to preservation solution and photographed for observation. Results are as follows: Figure 5 As shown, the ROS content increases when CP and MeGRXC3 are co-expressed.

[0052] Table 6. Different Agrobacterium-mediated recombinant plasmid combinations 1 p1300-Flag + pG1300 + pZP-P19 2 p1300-Flag + CP-GFP + pZP-P19 3 MeGRXC3-Flag + pG1300 + pZP-P19 4 MeGRXC3-Flag + CP-GFP + pZP-P19

[0053] 2.6 Co-expression of CP and MeGRXC3 enhances autophagic flux in tobacco leaves. First, transform Agrobacterium (GV3101) competent cells with the recombinant plasmid as described in section 2.3. Then, following the method in section 2.3, combine MeGRXC3-RFP and the silencing repressors pZP-P19 and GFP-MeATG8f with the empty vector (Vec) or CP-Flag (…). Figure 6After mixing, the samples were injected into both sides of the same Tobacco Bunsenii leaf. On the third day after injection, the samples were treated with E64D for 12 hours. On the fourth day, two duplicate tobacco leaves from each combination were taken for observation and photography using a laser confocal fluorescence microscope (Olympus FV3000) and autophagosome statistics were performed. GFP excitation light was 488 nm and RFP excitation light was 546 nm.

[0054] The results are as follows Figure 6 As shown, autophagosomes were observed when MeGRXC3-RFP, the silencing repressor pZP-P19, and GFP-MeATG8f were co-expressed with the empty vector or CP-Flag. Figure 6 (As shown by the arrow in the upper part of the figure), but the number of autophagosomes increased significantly after co-expression with CP. Figure 6 The figure below illustrates that co-expression of CP and MeGRXC3 can enhance autophagic flux in co-expressed tobacco leaves.

[0055] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to this invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. The application of the CP gene and the MeGRXC3 corresponding gene, or the protein encoded by the CP gene and the protein encoded by the MeGRXC3 corresponding gene, or a recombinant vector or host bacterium containing the coding region of the CP gene and a recombinant vector or host bacterium containing the coding region of the MeGRXC3 corresponding gene, in increasing the reactive oxygen species content in tobacco leaves, wherein, The nucleotide sequence of the CP gene is shown in SEQ ID NO:1; The nucleotide sequence of the gene corresponding to MeGRXC3 is shown in SEQ ID NO:

2.

2. The application as described in claim 1, characterized in that, The CP gene interacts with MeGRXC3 to downregulate MeGRXC3 expression levels.

3. The application of the CP gene and the MeGRXC3 corresponding gene, or the protein encoded by the CP gene and the protein encoded by the MeGRXC3 corresponding gene, or a recombinant vector or host bacterium containing the coding region of the CP gene and a recombinant vector or host bacterium containing the coding region of the MeGRXC3 corresponding gene, in improving autophagic flux in tobacco leaves, wherein, The nucleotide sequence of the CP gene is shown in SEQ ID NO:1; The nucleotide sequence of the gene corresponding to MeGRXC3 is shown in SEQ ID NO:

2.

4. The application as described in claim 3, characterized in that, The CP gene interacts with MeGRXC3 to downregulate MeGRXC3 expression levels.

Images