Manganese magnesium carbonate nanoparticles encapsulated by cell membrane vesicles, preparation method and application thereof

Abstract

The application provides a cell membrane vesicle-encapsulated magnesium manganese carbonate nanoparticle and a preparation method and application thereof, the nanoparticle comprises: tumor cell-derived membrane vesicles with high expression of PD1; and MgMn nanoparticle complexes encapsulated in the vesicles; the cell membrane vesicle-encapsulated magnesium manganese carbonate nanoparticle (CVs@MgMn) provided by the application integrates the advantages of Mg 2+ , Mn 2+ ions, in addition to the fact that the composite nanoparticle itself has the effects of regulating immunity and killing tumors, can realize radiotherapy sensitization, and has the effects of regulating immunity and remodeling microenvironment on any type of solid tumor, and is a general-purpose multifunctional composite nanoparticle.

Description

Technical Field

[0001] This invention relates to the fields of biology and pharmaceutical technology, and in particular to a magnesium manganese carbonate nanoparticle encapsulated in cell membrane vesicles, its preparation method, and its application. Background Technology

[0002] Recent breakthroughs in cancer immunotherapy have revolutionized the clinical treatment of many malignancies; however, as a standalone treatment, immunotherapy rarely results in durable objective responses. These challenges necessitate the development of combination therapies with superior efficacy and acceptable toxicity. Radiotherapy (RT), as the primary first-line treatment for cancer, exerts a systemic immune-stimulating effect by inducing immunogenic cell death (ICD), leading to widespread clinical trials of RT in combination with immunotherapy. However, conventional high-dose RT can cause systemic toxicity to the tumor microenvironment (TME) or potent immunosuppression, at least to some extent reflecting repeated killing of circulating immune effector cells or effects on surrounding lymph nodes, resulting in low success rates for combination therapy. Furthermore, STING agonists suffer from low delivery efficiency and systemic toxicity issues.

[0003] In summary, there is an urgent need to develop a drug for treating solid tumors that addresses the issues of poor targeting and immunogenicity of metal nanoparticles. Summary of the Invention

[0004] The purpose of this invention is to provide a method for preparing and applying magnesium manganese carbonate nanoparticles encapsulated in cell membrane vesicles. This invention is the first to combine PD1-overexpressing cell membrane vesicles with Mn / Mg nanoparticles, achieving a dual function of targeted delivery and immune checkpoint blockade. This is combined with STING pathway activation and metal ion metabolism regulation (Mn... 2+ / Mg 2+ Synergistic effect), achieving spatiotemporally controllable radiosensitization and immune regulation through acidic microenvironment-responsive decomposition.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] In a first aspect of the invention, magnesium manganese carbonate nanoparticles encapsulated in cell membrane vesicles are provided, the nanoparticles comprising:

[0007] (a) Tumor cell-derived membrane vesicles that highly express PD1;

[0008] (b) A MgMn nanoparticle complex encapsulated within vesicles; wherein the complex decomposes to produce Mn under acidic conditions in the tumor microenvironment. 2+ Mg 2+ , ·OH and O2.

[0009] The magnesium manganese carbonate (CVs@MnMg) nanoparticles encapsulated in cell membrane vesicles are referred to as CVs@MnMg.

[0010] Furthermore, the ratio of the protein concentration (mg / mL) in the tumor cell-derived membrane vesicles that highly express PD1 to the weight of the MgMn nanoparticles is 1:1;

[0011] In a second aspect of the invention, a method for preparing magnesium manganese carbonate nanoparticles encapsulated in cell membrane vesicles is provided, the method comprising:

[0012] A PD1-overexpressing tumor cell line was constructed using CRISPR technology, and cell membrane vesicles were then extracted to obtain tumor cell-derived membrane vesicles that highly express PD1.

[0013] After dispersing MgCO3 nanoparticles in anhydrous ethanol, KMnO4 aqueous solution was added under stirring and ultrasonic conditions, and the mineralization reaction was carried out by stirring at room temperature. After purification, MgMn nanoparticles were obtained.

[0014] The tumor cell-derived membrane vesicles that highly express PD1 are mixed with the MgMn nanoparticles, and the nanoparticles are loaded into the membrane vesicles by electroporation to obtain magnesium manganese carbonate nanoparticles encapsulated in cell membrane vesicles, abbreviated as CVs@MgMn.

[0015] Furthermore, the mass-to-volume ratio of the MgCO3 nanoparticles to the KMnO4 aqueous solution ranges from 20:1 to 50:1, and the concentration of the KMnO4 aqueous solution is (4-6) mg / mL.

[0016] In a third aspect of the invention, the use of the aforementioned cell membrane vesicle-encapsulated magnesium manganese carbonate nanoparticles in the preparation of immunotherapeutic drugs or radiosensitizers for solid tumors is provided.

[0017] Furthermore, the solid tumor is selected from one of melanoma, breast cancer, LLC lung cancer, CT26 or MC38 colorectal cancer.

[0018] In a fourth aspect of the invention, a combination drug composition is provided, the combination drug composition comprising a PD1 monoclonal antibody and the aforementioned cell membrane vesicle-encapsulated magnesium manganese carbonate nanoparticles.

[0019] In a fifth aspect of the invention, the use of the aforementioned combination pharmaceutical composition in the preparation of immunotherapeutic drugs or radiosensitizers is provided.

[0020] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0021] 1. This invention develops engineered nanoparticles (CVs@MgMn) composed of gene-edited cell membrane vesicles (CVs), MnO2, and MgCO3 nanoparticles for radioimmunotherapy via tumor microenvironment (TME) remodeling and STING (Synthetic Interferon Stimulation) pathway activation. Within the TME, CVs@MgMn nanoparticles, precisely enriched in the tumor microenvironment, are decomposed by the acidic microenvironment to generate hydroxyl groups (·OH) and oxygen (O2), enhancing radiosensitization and tumor killing. Subsequently, the MnO2 nanoparticles, reduced by the tumor microenvironment... 2+ By activating the STING pathway, it promotes the maturation of dendritic cells (DCs) in the tumor microenvironment, thereby promoting the maturation of CD8+ T cells and tumor killing; while the decomposition of MgCO3 nanoparticles releases Mg 2+ This study enhances CD8+ T cell and macrophage-mediated anti-tumor immunity by modulating the metabolic activity of CD8+ T cells and M1-type repolarization of tumor-associated macrophages. More importantly, the extracellular vesicles encapsulating the manganese-magnesium carbonate nanoparticles originate from PD1-highly expressing tumor cells. The CVs extensively express PD1 protein, and the tumor-derived CVs not only enhance the targeting effect of the manganese-magnesium carbonate nanoparticles, but the PD1 protein also mediates competitive blockade of the PD-L1 checkpoint. These synergistic effects trigger a robust anti-tumor immune response. In both in situ and distant re-challenge melanoma models, radiotherapy combined with the nanocomposite (CVs@MnMg) demonstrated strong radioimmunotherapy effects, prolonging mouse survival and generating durable immune memory. Furthermore, the MgCO3 nanoparticles, while promoting PD-1 mAb immunotherapy, produce a synergistic therapeutic effect on solid tumors far greater than the sum of its parts (1+1>2). This biomimetic composite manganese-magnesium carbonate nanoparticle encapsulated in extracellular vesicles demonstrates a simple and easily translatable strategy to enhance the benefits of radiotherapy and immunotherapy for patients with any type of solid tumor.

[0022] 2. The magnesium manganese carbonate nanoparticles (CVs@MgMn) encapsulated in cell membrane vesicles provided by this invention integrate Mg 2+ Mn 2+ Combining the numerous advantages of ions, in addition to the immunomodulatory and tumor-killing effects of the composite nanoparticles themselves, it can also achieve radiosensitization and has immunomodulatory and microenvironment remodeling effects on any type of solid tumor, making it a versatile and multifunctional composite nanoparticle. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 This is a schematic diagram of the present invention, wherein A is a schematic diagram of the synthesis of magnesium carbonate nanoparticles (MgCO3), manganese ion-modified nanoparticles (MnMg), and cell membrane-coated manganese ion-modified magnesium carbonate nanoparticles (CVs@MnMg), and B is a schematic diagram of the role of CVs@MnMg nanoparticles in radiosensitization and immune response regulation in vivo.

[0025] Figure 2 The images show the morphology, particle size, and Zeta potential of magnesium carbonate-based nanoparticles. A represents transmission electron microscopy (TEM) images of MgCO3 and MnMg nanoparticles; B represents TEM images of cell membrane nanovesicles expressing PD1 protein (PD1-CVs) and CVs@MnMg nanoparticles; C represents the particle size distribution of MgCO3, MnMg, PD1-CVs nanovesicles, and CVs@MnMg nanoparticles; and D represents the Zeta potential of MgCO3, MnMg, PD1-CVs nanovesicles, and CVs@MnMg nanoparticles.

[0026] Figure 3 Magnesium carbonate nanoparticles can enhance CD8 + The killing effect of T cells promotes their metabolic energy supply; where A represents the effect of different nanoparticle pretreatments on B16F10 cells, CD8+ + The killing effect of T cells on B16F10 cells was detected; B represents the effect of MgCO3 nanoparticles and PD1-CVs nanovesicles added to the culture medium on CD8 cells. + Results of T-cell glycolytic stress assay.

[0027] Figure 4 Treatment with magnesium carbonate-based nanoparticles promoted M1 polarization of macrophages and increased the secretion of cytotoxic inflammatory factors. Specifically, A represents the M1 polarization ratio of RAW264.7 macrophages treated with different magnesium carbonate-based nanoparticles compared to LPS and PD1-CVs treatments; B represents the M2 polarization ratio of RAW264.7 macrophages induced by IL-4 treated with different magnesium carbonate-based nanoparticles; C represents the TNF-α secretion level of RAW264.7 macrophages treated with different magnesium carbonate-based nanoparticles compared to LPS and PD1-CVs treatments; and D represents the IFN-γ secretion level of RAW264.7 macrophages treated with different magnesium carbonate-based nanoparticles compared to LPS and PD1-CVs treatments.

[0028] Figure 5Magnesium manganese carbonate-based nanoparticles and cell membrane-coated magnesium manganese carbonate nanoparticles exhibit cancer cell killing and radiosensitizing effects; where A represents the killing effect of different concentrations of magnesium manganese carbonate-based nanoparticles on B16F10 cells; B represents the killing effect of 6 Gy radiotherapy on B16F10 cells; and C represents the killing effect of 6 Gy radiotherapy combined with different concentrations of magnesium manganese carbonate-based nanoparticles on B16F10 cells.

[0029] Figure 6 Magnesium carbonate-based manganese nanoparticles coated on cell membranes have an immune-activating effect that promotes the maturation of dendritic cells (DCs). Here, A represents the CD80 content of BMDCs treated with different magnesium carbonate-based nanoparticles. + CD86 + The DC polarization ratio; B represents the CD40 content of BMDC cells when treated with different magnesium carbonate-based nanoparticles. + CD11c + C represents the DC polarization ratio; D represents the level of IFN-β secreted by BMDC cells when treated with different magnesium carbonate nanoparticles; E represents the level of IL-12 secreted by BMDC cells when treated with different magnesium carbonate nanoparticles; and E represents the level of CXCL10 secreted by BMDC cells when treated with different magnesium carbonate nanoparticles.

[0030] Figure 7 Cell membrane-coated magnesium manganese carbonate nanoparticles exhibit good targeting activity against solid tumors. A shows the fluorescence enrichment and metabolism of tumor sites in a B16F10 cell-bearing C57 mouse subcutaneous tumor model after intravenous injection of cell membrane-coated magnesium manganese carbonate nanoparticles versus free DIR dye. B shows the proportion of cell membrane-coated magnesium manganese carbonate nanoparticles versus free DIR dye within the tumor and surrounding vital organs 24 hours after tail vein injection. C shows the fluorescence imaging data comparing the proportion of drug within the tumor in the magnesium manganese carbonate nanoparticle group versus the free DIR group 24 hours after tail vein injection.

[0031] Figure 8 Magnesium carbonate nanoparticles enhance the effect of intracellular immunotherapy with PD1 monoclonal antibody. A represents the tumor growth of B16F10 tumor-bearing mice after intravenous administration of magnesium carbonate nanoparticles compared to PD1 monoclonal antibody alone, MgCl2, and their combined use. B represents the survival of B16F10 tumor-bearing mice after intravenous administration of magnesium carbonate nanoparticles compared to PD1 monoclonal antibody alone, MgCl2, and their combined use.

[0032] Figure 9Magnesium carbonate-based nanoparticles enhance the in vivo tumor-suppressing effect of radiotherapy. A represents the tumor growth in subcutaneous tumors of B16F10 tumor-bearing mice after intravenous injection of magnesium carbonate nanoparticles alone or in combination with radiotherapy; B represents the overall survival of mice with subcutaneous tumors after intravenous injection of magnesium carbonate nanoparticles alone or in combination with radiotherapy.

[0033] Figure 10 Magnesium carbonate-based nanoparticles remodeled the suppressive immune microenvironment within solid tumors, increasing the proportion of cytotoxic immune cells. Specifically, A represents the change in the proportion of dendritic cells (DCs) within subcutaneous tumors of B16F10 tumor-bearing mice after intravenous injection of magnesium carbonate nanoparticles alone or in combination with radiotherapy; B represents the change in the proportion of CD8+ cells within subcutaneous tumors of B16F10 tumor-bearing mice after intravenous injection of magnesium carbonate nanoparticles alone or in combination with radiotherapy. + Changes in the proportion of T cells; C represents the changes in the proportion of M1 macrophages in subcutaneous tumors of B16F10 tumor-bearing mice after intravenous injection of magnesium sulfate nanoparticles alone and in combination with radiotherapy.

[0034] Figure 11 Magnesium carbonate-based nanoparticles enhance the in vivo tumor-suppressing effect of radiotherapy. A represents the in situ tumor growth in a B16F10 tumor-bearing mouse subcutaneous bilateral tumor model after intravenous injection of magnesium carbonate nanoparticles alone and in combination with radiotherapy; B represents the contralateral tumor growth in a B16F10 tumor-bearing mouse subcutaneous bilateral tumor model after intravenous injection of magnesium carbonate nanoparticles alone and in combination with radiotherapy.

[0035] Figure 12 Magnesium carbonate-based nanoparticles remodeled the suppressive immune microenvironment within solid tumors, increasing the proportion of cytotoxic immune cells. In this study, A involved the intravenous injection of magnesium carbonate nanoparticles alone, combined with radiotherapy. In a B16F10 tumor-bearing mouse model with bilateral subcutaneous tumors, CD8+ levels were increased in the contralateral tumor. + The proportion of T cells; B, magnesium carbonate nanoparticles administered intravenously alone or in combination with radiotherapy, in a B16F10 tumor-bearing mouse subcutaneous bilateral tumor model, showed increased CD8 levels in the contralateral tumor. + IFN-γ + The proportion of T cells, C represents the intravenous injection of magnesium carbonate nanoparticles alone and in combination with radiotherapy, in a B16F10 tumor-bearing mouse subcutaneous bilateral tumor model, the CD8 content in the contralateral tumor. + GramB +D represents the proportion of T cells in the contralateral tumor of a B16F10 tumor-bearing mouse model, calculated using magnesium carbonate nanoparticles alone or in combination with radiotherapy. E represents the proportion of peripheral memory T cells in the contralateral tumor of a B16F10 tumor-bearing mouse model, calculated using magnesium carbonate nanoparticles alone or in combination with radiotherapy. F represents the proportion of Treg cells in the contralateral tumor of a B16F10 tumor-bearing mouse model, calculated using magnesium carbonate nanoparticles alone or in combination with radiotherapy.

[0036] Figure 13 Magnesium carbonate-based nanoparticles have shown significant safety when administered intravenously in vivo. Detailed Implementation

[0037] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0038] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0039] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing them from the market or by existing methods.

[0040] The overall concept of this invention is as follows:

[0041] According to a typical embodiment of the present invention, a magnesium manganese carbonate nanoparticle encapsulated in a cell membrane vesicle is provided, the nanoparticle comprising:

[0042] (a) Tumor cell-derived membrane vesicles that highly express PD1;

[0043] (b) A MgMn nanoparticle complex encapsulated within vesicles; wherein the complex decomposes to produce Mn under acidic conditions in the tumor microenvironment. 2+ Mg 2+ , ·OH and O2.

[0044] In the above technical solution,

[0045] Magnesium manganese carbonate composite nanoparticles (MnMg) can not only reshape the acidic microenvironment of solid tumors, but also replenish the Mg required for T cell metabolism and activation in the tumor microenvironment (TME). 2+Mn ions required for DC cell activation and maturation 2+ Ions, promoting CD8 + T-cell-mediated tumor killing effect is a functionally enhanced nanomaterial of magnesium carbonate nanoparticles.

[0046] Encapsulation of manganese magnesium carbonate nanoparticles (CVs@MgMn) via cell membrane imparts excellent targeting properties to solid tumors, delivering large amounts of Mg to the tumor site. 2+ Mn 2+ Promote CD8 + T-cell-mediated tumor killing effect and radiosensitization by catalytic oxygen production to reverse the hypoxic microenvironment of solid tumors are functionally enhanced nanomaterials of magnesium manganese carbonate nanoparticles (MnMg).

[0047] According to another typical embodiment of the present invention, a method for preparing magnesium manganese carbonate nanoparticles encapsulated in cell membrane vesicles is provided, the method comprising:

[0048] Step S1: Construct a PD1-overexpressing tumor cell line, then extract cell membrane vesicles to obtain tumor cell-derived membrane vesicles that highly express PD1.

[0049] In step S1

[0050] The construction of PD1-overexpressing tumor cell lines specifically included mouse and melanoma cells B16F10.

[0051] Step S2: After dispersing MgCO3 nanoparticles in anhydrous ethanol, KMnO4 aqueous solution is added under stirring and ultrasonic conditions. The mineralization reaction is carried out by stirring at room temperature. After purification, MgMn nanoparticles are obtained.

[0052] In step S2

[0053] The mass-to-volume ratio of the MgCO3 nanoparticles to the KMnO4 aqueous solution ranges from 30:1 to 50:1, and the concentration of the KMnO4 aqueous solution is (4-6) mg / mL.

[0054] Step S3: Mix the tumor cell-derived membrane vesicles that highly express PD1 with the MgMn nanoparticles, and load the nanoparticles into the membrane vesicles by electroporation to obtain magnesium manganese carbonate nanoparticles encapsulated in cell membrane vesicles, abbreviated as CVs@MgMn.

[0055] In step S3

[0056] The ratio of protein content in the tumor cell-derived membrane vesicles that highly express PD1 to the weight of MgMn nanoparticles is 1:1; a ratio that is too low or too high is not conducive to uniformly coating the magnesium carbonate-based nanoparticles.

[0057] Through the above steps, magnesium manganese carbonate nanoparticles encapsulated in cell membrane vesicles can be successfully constructed. These magnesium manganese carbonate nanoparticles encapsulated in cell membrane vesicles integrate three functions: radiosensitization (·OH / O2 generation), immune microenvironment remodeling (DC maturation / T cell activation / macrophage polarization), and immune checkpoint blockade (PD1-PDL1 competition). They have the potential to be used in the preparation of immunotherapeutic drugs or radiosensitizers for solid tumors.

[0058] The present application will now be described in detail with reference to embodiments and experimental data.

[0059] Example 1: Synthesis of magnesium carbonate-based nanoparticles and verification of their functions in enhancing CD8+ T cell killing effect, enhancing CD8+ T cell glucose metabolism, and promoting macrophage polarization to M1 type.

[0060] I. Synthesis of magnesium carbonate (MgCO3), magnesium manganese carbonate (MnMg), and magnesium manganese carbonate (CVs@MnMg) nanoparticles encapsulated in cell membrane vesicles

[0061] 1. Preparation of MgCO3 nanoparticles

[0062] MgCO3 nanoparticles were prepared using a carbon dioxide bubbling carbonization method. MgCl2 (1M) was rapidly added in equal volumes to a 2M NaOH aqueous solution under vigorous stirring, forming a Mg(OH)2 precipitate. After 10 min, CO2 gas was slowly bubbled into the reaction mixture until the pH of the mixture dropped to -pH 7.4. The nanoparticles were then collected and redissolved in ultrapure water, and purified by repeated centrifugation at 12000 rpm to obtain MgCO3 nanoparticles.

[0063] 2. Preparation of MgMn nanoparticles

[0064] After separating a portion of the MgCO3 nanoparticles and dispersing them in anhydrous ethanol, 10 mL of KMnO4 (5 mg / mL) aqueous solution was added under stirring and sonication conditions. The mineralization reaction was carried out at room temperature for 8 h with stirring. The black MgMn nanoparticles were collected and purified by repeated centrifugation at 8000 rpm using ddH2O. Finally, the MgMn nanoparticles were dispersed in ddH2O by sonication and stored at 4 °C for later use.

[0065] 3. Preparation of tumor cell-derived membrane vesicles with high PD1 expression

[0066] (1) The preparation method of B16F10 cells stably expressing PD-1 membrane protein includes: the construction of PD-1 overexpression plasmid was entrusted to Hanheng Biotechnology Co., Ltd., the PD1 sequence was obtained from the NCBI database (serial number: NM_008798.3), and the expression vector was the pDisplay-GRAB_VIP1.0 expression vector (Plasmid: #208682) from Addgene Co., Ltd.; the PDGFRβ transmembrane domain sequence was added to the N-terminus of the PD1 sequence to help the PD1 protein cross the cell membrane during translation. The base sequence of the PDGFRβ transmembrane domain is as follows:

[0067] (GCTGTGGGCCAGGACACGCAGGAGGTCATCGTGGTGCCACACTCCTTGCCCTTT AAGGTGGTGGTGATCTCAGCCATCCTGGCCCTGGTGGTGCTCACCATCATCTCCCTTATC ATCCTCATCATGCTTTGGCAGAAGAAGCCACGT, SEQ ID NO.1), the C-terminus of the PD1 sequence contains an Igk leader signal peptide sequence, which helps the PD1 protein to be immobilized and expressed on the cell membrane after crossing the membrane. The base sequence of the Igk leader signal peptide is as follows:

[0068] (ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACT GGTGAC, SEQ ID NO.2). The pDisplay-GRAB_VIP1.0 expression vector was digested with AjiI and Eco47III, and then the PD1 complex base sequence containing the PDGFRβ transmembrane domain and the Igk leader fixed peptide was recombined into the pDisplay-GRAB_VIP1.0 vector by DNA ligase to construct a complete PD1 overexpression plasmid (named: pcDNA3.4-PD-1).

[0069] Transfection of the PD1 plasmid was performed using PEI according to the manufacturer's instructions. A composite plasmid consisting of 0.75 μg psPAX2 (Beyotime Biotechnology: JY03062), 0.25 μg pMD2 helper plasmid (Beyotime Biotechnology: JY03061), and 1 μg PD1 recombinant plasmid (pcDNA3.4-PD-1) was transiently transfected into HEK293T cells using PEI reagent. After 48 h, the viral supernatant from HEK293T cells was collected and filtered through a 0.45 μm filter. The filtrate was diluted to a fresh RPMI 1640 solution containing 10 μg / mL polybrene and then used to infect B16F10 cells. After 48 h of infection, cells were collected and resuspended in fresh culture medium. Mcherry-positive cells were sorted using CytoFLEX SRT.

[0070] (2) B16F10 cells stably expressing PD-1 membrane protein were suspended in autoclaved ultrapure water and destroyed by repeated freeze-thaw cycles with liquid nitrogen. DNA and RNA were removed by treating the solution with DNase and RNase, and then the cells were centrifuged at 3200g for 5 min. The supernatant was collected and centrifuged at 20000g for 30 min, and then centrifuged again at 100,000g for 2 h to obtain cell membranes. The cell membranes were resuspended in sterile PBS and extruded sequentially through polycarbonate membranes with nanopores of 800 nm, 400 nm and 200 nm using a micro extruder (Avanti Polar Lipids, USA) to obtain nanoscale PD1-CVs cell membrane nanovesicles expressing PD1 protein.

[0071] 4. Magnesium manganese carbonate (CVs@MnMg) nanoparticles encapsulated in cell membrane vesicles

[0072] B16F10 cell-derived membrane vesicles (CVs) with high PD1 expression and MgMn nanoparticles were mixed at a 1:1 ratio of total protein concentration (mg / mL) on CVs to weight of MgMn nanoparticles. The mixture was then repeatedly squeezed back and forth more than 20 times with a 400 nm polycarbonate porous membrane to obtain CVs@MgMn nanomaterials.

[0073] II. Characterization of magnesium carbonate (MgCO3), magnesium manganese carbonate (MnMg), and magnesium manganese carbonate nanoparticles encapsulated in cell membrane vesicles (CVs@MnMg).

[0074] The morphology of nanoparticles was observed using transmission electron microscopy, and the particle size and potential of MgCO3, CVs, MgMn and CVs@MgMn were determined under dynamic light scattering.

[0075] The results showed that the magnesium carbonate and magnesium manganese carbonate nanoparticles had a particle size of approximately 100 nm and were semi-regularly elliptical in shape. Figure 2A), PD1-CVs are lipid cell membranes with a particle size of approximately 150 nm. Figure 2 B), CVs-MgMn are composite nanoparticles encapsulated in membrane vesicles, with a particle size of approximately 170 nm. Figure 2 C); The Zate potential changes significantly with the combination of composite nanoparticle sizes. Figure 2 D) The potential of CVs-MgMn nanoparticles is around -30mV. Based on the potential change, it can be inferred that the carbonate-based nanoparticles have good dispersibility.

[0076] Example 2: Pretreatment of cancer cells with magnesium carbonate nanoparticles, MgMn, or CVs@MgMn to supplement the Mg in the culture medium. 2+ Ions can promote the metabolic function of CD8+ T cells and enhance CD8+ T cell function. + The killing effect of T cells on cancer cells

[0077] We isolated and extracted Naive T cells from the spleen of C57 mice. These cells were activated for 12 hours with phorbol ester (PMA) (50 ng / mL) and iodine (500 ng / mL) to induce them into primary mouse CD8 cells. + T; then 5×10 3 B16F10-luc cells were incubated in black 96-well plates and treated with 40 μg / mL MgCO3, PD1-CVs, MgMn, and CVs@MgMn for 4 h, then 1×10 5 Activated CD8 + T cells were co-cultured with B16-luc cells for 24 h. The cytotoxicity of CD8+ T cells was detected using a luciferase detection system (Promega, E2610). Quantitative analysis of the luminescence of each B16F10 cancer cell group was performed in the presence of D-fluorescein substrate. After removing the cytotoxic effects caused by the nanomaterials themselves, the cytotoxicity (%) of sample X in the MgCO3, MgMn, and CVs@MgMn treatment groups was calculated as (1 - luminescence amount of X / 'luminescence amount of target cells only') × 100%. Figure 3 A). CD8 levels were analyzed using a hippocampal cell energy metabolism analyzer and an Agilent cell glycolysis stress assay kit. + T cells in Mg 2+ In the presence of CD8 + T cell glycolytic metabolic activity.

[0078] The results are as follows Figure 3 As shown, pretreatment of cancer cells with magnesium carbonate nanoparticles, MgMn, or CVs@MgMn reverses the microenvironment of B16F10 cells and enhances CD8 activity. + The killing effect of T cells on B16F10 cancer cells ( Figure 3A) Supplementing the culture medium with Mg 2+ Ions can promote CD8 + T-cell glycolytic metabolism increases CD8 + T's ATP energy supply ( Figure 3 B).

[0079] Example 3: Pretreatment of cancer cells with magnesium carbonate nanoparticles, MgMn, or CVs@MgMn to supplement Mg in the culture medium. 2+ Ions can promote the polarization of Raw264.7 macrophages towards the M1 type and enhance the secretion of cytotoxic inflammatory factors.

[0080] We treated B16F10 cancer cells with 50 μg / mL MgCO3 nanoparticles, PD1-CVs nanovesicles, MgMn nanoparticles, and CVs@MgMn nanoparticles for 12 h, respectively. The culture medium containing these cancer cells was then used to culture RAW264.7 macrophages for 24 h. The positive control group, RAW264.7 cells, was supplemented with 50 ng / mL LPS. To induce M2 polarization in RAW264.7 macrophages, an additional 50 ng / mL IL-4 was added to the supernatant containing the nanoparticles. Flow cytometry was used to detect the polarization of RAW264.7 cells, and ELISA was used to detect the secretion of cytokines in the cell supernatant.

[0081] The results are as follows Figure 4 As shown, pretreatment of cancer cells with magnesium carbonate nanoparticles, MgMn, or CVs@MgMn supplements the Mg content in the culture medium. 2+ Ions can promote the polarization of Raw264.7 macrophages towards the M1 type. Figure 4 A), reversing IL-4-mediated macrophage M2 polarization ( Figure 4 B), enhances the secretion of cytotoxic inflammatory factors TNF-α and INF-γ. Figure 4 C, Figure 4 D).

[0082] Example 4: Magnesium manganese carbonate nanoparticles and cell membrane-coated magnesium manganese carbonate nanoparticles have direct killing effects on cancer cells, radiosensitizing and killing effects, and immune activation effects that promote the maturation of dendritic cells.

[0083] 1. Magnesium manganese carbonate-based nanoparticles and cell membrane-coated magnesium manganese carbonate nanoparticles have a killing effect on cancer cells.

[0084] 1×10 3B16F10 cells were seeded in 96-well plates and cultured. After 12 h, the cells were treated with medium containing different concentrations of MgCO3, MgMn, and CVs@MgMn for 24 h, with 10 μL of CCK-8 solution added to each well, and incubated for another 2 h. Cell viability was then evaluated by measuring the optical density (OD) at 450 nm using a Synergy H1 (Biotek) microplate reader. For the radiosensitization assay, 1 × 10⁶ cells were still used. 3 B16F10 cells were seeded in 96-well plates and cultured for 12 h. Afterward, the cells were treated with culture medium containing different concentrations of MgCO3, MgMn, and CVs@MgMn for 12 h. Half of the cells were then irradiated with 6 Gy. Following irradiation, the cells were cultured for another 24 h, and 10 μL of CCK-8 solution was added to each well for an additional 2 h of incubation. Cell viability was then evaluated by measuring the optical density (OD) at 450 nm using a microplate reader.

[0085] The results showed that both magnesium manganese carbonate nanoparticles and cell membrane-coated magnesium manganese carbonate nanoparticles had a direct killing effect on cancer cells. Figure 5 A) and the sensitizing and killing effects of radiotherapy ( Figure 5 C).

[0086] 2. Cell membrane-coated magnesium carbonate-based manganese nanoparticles have an immune-activating effect that promotes the maturation of dendritic cells (DCs).

[0087] We seeded BMDC cells derived from C57 mouse bone marrow into 6cm cell culture plates and co-cultured them for 48 hours with PD1-CVs derived from B16F10 cells, MnMg, and cell membrane-coated magnesium manganese carbonate (CVs@MnMg) nanoparticles. Flow cytometry was used to detect BMDC cell maturation and the secretion of inflammatory factors.

[0088] The results showed that cell membrane-coated magnesium manganese carbonate nanoparticles had an immune-activating effect that promoted the maturation of dendritic cells (DCs). Figure 6 A and Figure 6 B), promotes the secretion of maturation-related inflammatory factors by BMDC cells ( Figure 6 C to Figure 6 E).

[0089] 3. Cell membrane-coated magnesium manganese carbonate nanoparticles exhibit good targeting effects on solid tumors in vivo.

[0090] To confirm whether cell membrane coating modification endows magnesium manganese carbonate nanoparticles with targeting effects on solid tumors in vivo, we constructed solid tumors in C57 mice using B16F10 mouse melanoma cancer cells and intravenously administered DIR-modified cell membrane-coated magnesium manganese carbonate nanoparticles. We then monitored the enrichment of fluorescence signals within the tumor in real time using a small animal in vivo imaging system.

[0091] Experimental results showed that, compared with DIR dye alone, cell membrane coating modification significantly enhanced the targeting effect of magnesium carbonate manganese nanoparticles on in vivo solid tumor sites. Figure 7 A); Statistical analysis of fluorescence distribution in major organs clearly shows that cell membrane-coated nanoparticles account for approximately 13% of the major organs. Figure 7 B); The comparison inside the tumor in vitro shows that the enrichment of cell membrane-coated nanoparticles in the tumor is about 10 times higher than that of DIR fluorescent dye alone. Figure 7 C).

[0092] Example 5: Magnesium carbonate-based nanoparticles and cell membrane-coated magnesium carbonate-based nanoparticles exhibit good immunomodulatory and radiosensitizing effects in vivo.

[0093] 1. Magnesium carbonate nanoparticles can enhance the effect of intracellular immunotherapy with PD1 monoclonal antibodies.

[0094] We constructed a solid tumor model in C57 mice using B16F10 mouse melanoma cancer cells and administered magnesium carbonate nanoparticles (150 μg / mouse), MgCl2, PD-1 mAb (200 μg), or a combination of both intravenously. The control group received an equal volume of PBS intravenously. The treatment was administered every other day, and tumor growth and mouse survival were monitored. When the tumor size in the control group approached 1500 mm... 3 The experiment was terminated and the mice were recorded as dead.

[0095] Experimental results showed that magnesium carbonate nanoparticles significantly enhanced the in vivo immunotherapeutic effect of PD1 monoclonal antibodies. Figure 8 A) significantly prolonged the survival of tumor-bearing mice. Figure 8 B);

[0096] 2. Magnesium carbonate-based nanoparticles can enhance the tumor-suppressing effect of radiotherapy in vivo.

[0097] We constructed a solid tumor model in C57 mice using B16F10 mouse melanoma cancer cells and administered MnMg nanoparticles, CVs nanovesicles, and CVs@MnMg nanoparticles intravenously. Twenty-four hours after administration, some mice were irradiated with 6 Gy of the tumor tissue. The control group received an equal volume of PBS intravenously. The mice received either the drug administration or irradiation every other day for a total of three treatments. Tumor growth and mouse survival were monitored. When the tumor size in the control group approached 1500 mm... 3 The experiment was terminated and the mice were recorded as dead.

[0098] Experimental results showed that magnesium carbonate-based nanoparticles (MnMg nanoparticles and CVs@MnMg nanoparticles) and PD1-CVs nanoparticles significantly enhanced the in vivo immunotherapy effect of radiotherapy, while the cell membrane-coated magnesium carbonate-based nanoparticles (CVs@MnMg) combined with radiotherapy almost completely inhibited the growth of solid tumors. Figure 9 A), this group also significantly prolonged the survival of tumor-bearing mice. Figure 9 B);

[0099] 3. Magnesium carbonate-based nanoparticles remodeled the inhibitory immune microenvironment within solid tumors.

[0100] We constructed a solid tumor model in C57 mice using B16F10 mouse melanoma cancer cells and administered magnesium carbonate nanoparticles, MnMg nanoparticles, CVs nanovesicles, and CVs@MnMg nanoparticles intravenously. Twelve hours after administration, some mice were irradiated with 6 Gy of the tumor tissue, while the control group received an equal volume of PBS intravenously. The mice underwent administration or irradiation every other day for a total of three treatments, with the last irradiation occurring 24 hours later. Mice were euthanized, and the tumor tissue was removed and prepared into a single-cell suspension. Antibody labeling and flow cytometry analysis were used to detect immune cell populations within the tumor tissue. The results showed that magnesium carbonate nanoparticle treatment significantly increased CD8+ ionotropic enzyme activity within the solid tumor. + The ratio of T cells to M1 macrophages and DC cells ( Figure 10 A to Figure 10 C);

[0101] Example 7: Cell membrane-coated magnesium carbonate nanoparticles exhibit a vaccine effect in vivo with radiosensitization and long-term memory.

[0102] 1. Cell membrane-coated magnesium carbonate nanoparticles have radiosensitizing and long-lasting vaccine memory effects in vivo.

[0103] We constructed an orthotopic solid tumor model in the right subcutaneous tissue of C57 mice using B16F10 mouse melanoma cancer cells. Five days later, we again constructed a distal solid tumor model in the left subcutaneous tissue of C57 mice using B16F10 cells. When the right-sided solid tumor reached a size of 50 mm... 3 Subsequently, magnesium carbonate nanoparticles, MnMg nanoparticles, CVs nanovesicles, and CVs@MnMg nanoparticles were administered intravenously. Twelve hours after administration, some mice were irradiated with 6 Gy of the right-sided tumor, while the control group received an equal volume of PBS intravenously. The mice underwent administration or irradiation every other day for a total of three treatments. The growth of the right-sided in situ tumor and the distal left-sided tumor was monitored. The results showed that magnesium carbonate-based nanoparticles significantly enhanced the in vivo immunotherapeutic effect of radiotherapy and inhibited the growth of the right-sided tumor. Figure 11A) also significantly inhibited the growth of the distal left tumor, and CVs@MnMg and radiotherapy also had a synergistic anti-tumor effect on the left tumor. Figure 11 B);

[0104] 2. Treatment with cell membrane-coated magnesium carbonate nanoparticles increases the distal tumor memory effect and the proportion of anti-tumor immune cells in radiotherapy.

[0105] We constructed an orthotopic solid tumor model in the right subcutaneous tissue of C57 mice using B16F10 mouse melanoma cancer cells. Five days later, we again constructed a distal solid tumor model in the left subcutaneous tissue of C57 mice using B16F10 cells. When the right-sided solid tumor reached a size of 50 mm... 3 Subsequently, mice were intravenously administered magnesium carbonate nanoparticles, MnMg nanoparticles, CVs nanovesicles, and CVs@MnMg nanoparticles. Twelve hours after administration, some mice were irradiated with 6 Gy of the right-sided tumor, while the control group received an equal volume of PBS intravenously. Treatment consisted of administration or irradiation every other day for a total of three treatments. Twenty-four hours after the final irradiation, mice were euthanized, and the distal tumor (left side) was removed and prepared into a single-cell suspension. Antibody labeling and flow cytometry analysis revealed immune cell populations within the tumor. The results showed that treatment with cell membrane-coated magnesium carbonate nanoparticles significantly increased CD8+ in the distal solid tumor (left side). + T, IFN-γ + T cells and GramB + T cells ( Figure 12 A to Figure 12 C) The proportion of memory T cells ( Figure 12 D, Figure 12 E), reducing the proportion of Treg cells ( Figure 12 F);

[0106] 3. Magnesium carbonate-based nanoparticles have significant safety when administered intravenously in vivo.

[0107] We administered magnesium carbonate manganese nanoparticles, CVs cell membrane nanovesicles, and cell membrane-encapsulated magnesium carbonate manganese nanoparticles CVs@MnMg to C57 mice via continuous intravenous injection for 7 days. After anesthetizing the mice, blood was drawn from the abdominal main vein to detect major organ function indicators. The experimental results showed that long-term intravenous injection of magnesium carbonate-based nanoparticles has significant safety in vivo and does not alter organ function such as liver function (ALT, AST), kidney function (UA, CREA), and myocardial enzyme profile (CK, LDH) in mice.

[0108] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0109] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0110] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A cell membrane vesicle-encapsulated magnesium manganese carbonate nanoparticle, characterized in that, The nanoparticles comprise: Tumor cell-derived membrane vesicles that highly express PD1; A MgMn nanoparticle complex encapsulated within vesicles; The ratio of the amount of protein in the tumor cell-derived membrane vesicles that highly express PD1 to the weight of MgMn nanoparticles is 1:

1. The method for preparing the magnesium manganese carbonate nanoparticles encapsulated in cell membrane vesicles includes: A PD1-overexpressing tumor cell line was constructed, and cell membrane vesicles were then extracted to obtain tumor cell-derived membrane vesicles that highly express PD1. After dispersing MgCO3 nanoparticles in anhydrous ethanol, KMnO4 aqueous solution was added under stirring and ultrasonic conditions, and the mineralization reaction was carried out by stirring at room temperature. After purification, MgMn nanoparticles were obtained. The tumor cell-derived membrane vesicles that highly express PD1 are mixed with the MgMn nanoparticles, and the nanoparticles are loaded into the membrane vesicles by electroporation to obtain magnesium manganese carbonate nanoparticles encapsulated in cell membrane vesicles, abbreviated as CVs@MgMn.

2. The cell membrane vesicle-encapsulated magnesium manganese carbonate nanoparticle of claim 1, wherein, The extraction of cell membrane vesicles specifically includes: Tumor cell-derived membrane vesicles with high PD1 expression were obtained by differential centrifugation or membrane filtration.

3. The cell membrane vesicle-encapsulated magnesium manganese carbonate nanoparticle of claim 1, wherein, The mass-to-volume ratio of the MgCO3 nanoparticles to the KMnO4 aqueous solution ranges from 30:1 to 50:1, and the concentration of the KMnO4 aqueous solution is (4-6) mg / mL.

4. The use of magnesium manganese carbonate nanoparticles encapsulated in cell membrane vesicles as described in any one of claims 1-3 in the preparation of immunotherapeutic drugs or radiosensitizers for melanoma.

5. A combination drug composition, characterized in that, The combination drug composition comprises a PD1 monoclonal antibody and magnesium manganese carbonate nanoparticles encapsulated in cell membrane vesicles as described in any one of claims 1-3.

6. The use of the combination drug composition according to claim 5 in the preparation of immunotherapeutic drugs or radiosensitizers for melanoma.

Images