Fluorine-containing tri-substituted acridine derivative as well as preparation method and application thereof

CN120230080APending Publication Date: 2025-07-01WENZHOU MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510379643.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-28
Publication Date
2025-07-01

Smart Images

  • Figure CN120230080A_ABST
    Figure CN120230080A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of preparation of anti-inflammatory drugs, and particularly discloses a fluorine-containing tri-substituted acridine derivative as well as a preparation method and application thereof. The preparation method comprises the following steps: mixing N, N '-(9-(4-(dimethylamino) phenylamino) acridine-3, 6-diyl) bis (3-chloropropionamide) with 4, 4-difluoropiperidine, potassium iodide, potassium carbonate and absolute ethyl alcohol, and carrying out nucleophilic substitution reaction to obtain the fluorine-containing tri-substituted acridine derivative: # imgabs0. The fluorine-containing tri-substituted acridine derivative prepared by the invention has excellent anti-inflammatory action and low cytotoxicity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of anti-inflammatory drug preparation, and particularly to a fluorine-based trisubstituted acridine derivative, a preparation method thereof and an application thereof. Background Art

[0002] Inflammation is a defensive response of the body to infection, injury or other stimuli. Moderate inflammation has a protective effect on the body, while excessive inflammation can cause serious damage to the body and even endanger life. In recent years, the role of inflammation in various diseases such as autoimmune diseases (such as rheumatoid arthritis, Crohn's disease), neurodegenerative diseases (such as Alzheimer's disease), cardiovascular diseases, cancer, metabolic diseases (such as diabetes), intrauterine adhesions, etc. has attracted much attention. Therefore, the prevention and treatment of inflammation have become an important research direction in the fields of biomedicine and pharmacy.

[0003] Acridine is a nitrogen-containing heterocyclic compound with a tricyclic aromatic structure. Acridine derivatives obtained by modifying different chemical groups can exhibit various biological activities. Due to its strong affinity for nucleic acids, especially the interaction with DNA and RNA, acridine derivatives are potential anti-tumor drugs. However, there is still less research on acridine derivatives as anti-inflammatory drugs. G-quadruplex (G4) is an atypical DNA or RNA structure formed by the folding of guanine (G)-rich sequences. The G4-DNA structure can be significantly distinguished from the conventional double-helix DNA structure. Recent studies have shown that G4-DNA not only exists widely in the promoter regions of proto-oncogenes, but also exists widely in the transcriptional regions and promoter regions of inflammatory factors, and is a potential new target for anti-cancer and anti-inflammatory drugs. Acridine derivatives obtained by modifying different chemical groups are expected to exhibit high targeting and activity only against the inflammatory gene G4-DNA, effectively improving the anti-inflammatory activity of acridine derivatives and reducing their toxic side effects on immune cells and normal cells.

[0004] Therefore, it is of great significance to study fluorine-based trisubstituted acridine derivatives with high anti-inflammatory activity, selectivity and low toxic side effects targeting the G4-DNA in the inflammatory gene region. Summary of the Invention

[0005] In view of this, the present invention provides a fluorine-based trisubstituted acridine derivative, a preparation method thereof and an application thereof, and acridine derivatives with high targeting and activity against the inflammatory gene G4-DNA are obtained by modifying different chemical groups.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A fluorine-based trisubstituted acridine derivative, the structural formula of the fluorine-based trisubstituted acridine derivative is:

[0008]

[0009] Another object of the present invention is to provide a preparation method of a fluorine-based trisubstituted acridine derivative, comprising the following steps:

[0010] Mix N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropionamide) with 4,4-difluoropiperidine, potassium iodide, potassium carbonate and absolute ethanol, and carry out a nucleophilic substitution reaction to obtain a fluorine-based trisubstituted acridine derivative;

[0011] The structural formula of the N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropionamide) is:

[0012] Preferably, the molar volume ratio of the N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropionamide), 4,4-difluoropiperidine, potassium iodide, potassium carbonate and absolute ethanol is 0.8-1.2 mmol: 9-11 mmol: 0.4-0.6 mmol: 0.4-0.6 mmol: 10-20 mL.

[0013] Preferably, the temperature of the nucleophilic addition reaction is 80-100 °C, and the time of the nucleophilic substitution reaction is 1-3 h.

[0014] Another object of the present invention is to provide an application of the fluorine-based trisubstituted acridine derivative prepared by the above preparation method in the preparation of anti-inflammatory drugs.

[0015] It can be seen from the above technical solutions that, compared with the prior art, the present invention has the following beneficial effects:

[0016] The fluorine-based trisubstituted acridine derivative of the present invention has excellent selectivity and stability for the G-quadruplex structure (G4-DNA) in the inflammatory gene region, and at the same time has a broad-spectrum anti-inflammatory activity. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained according to the provided drawings without creative efforts.

[0018] Figure 11H NMR spectrum of the fluorine-containing trisubstituted acridine derivative prepared in Example 1 of the present invention;

[0019] Figure 2 Anti-inflammatory test results of the fluorine-containing trisubstituted acridine derivative prepared in Example 1 of the present invention at different concentrations;

[0020] Figure 3 Anti-inflammatory test results of N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropionamide) used in Example 1 of the present invention at different concentrations;

[0021] Figure 4 Effect of the fluorine-containing trisubstituted acridine derivative prepared in Example 1 of the present invention on the activity of macrophage RAW264.7 at different concentrations (Cell viability - Cell survival rate, Concentration - Concentration);

[0022] Figure 5 Effect of the fluorine-containing trisubstituted acridine derivative prepared in Example 1 of the present invention on the activity of human normal colon epithelial cell NCM460 at different concentrations (Cell viability - Cell survival rate, Concentration - Concentration);

[0023] Figure 6 Circular dichroism spectrum of N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropionamide) inducing the formation of G4 structure in the G-rich sequence of the IL-6 promoter region;

[0024] Figure 7 Circular dichroism spectrum of N,N'-(9-((4-(dimethylamino)phenyl)amino)acridine-3,6-diyl)bis(3-(4,4-difluoropiperidin-1-yl)propionamide) prepared in Example 1 of the present invention inducing the formation of G4 structure in the G-rich sequence of the IL-6 promoter region. Detailed implementation manners

[0025] The present invention provides a fluorine-containing trisubstituted acridine derivative, and the structural formula of the fluorine-containing trisubstituted acridine derivative is:

[0026]

[0027] The present invention also provides a preparation method of a fluorine-containing trisubstituted acridine derivative, comprising the following steps:

[0028] Mix N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropanamide) with 4,4-difluoropiperidine, potassium iodide, potassium carbonate and absolute ethanol, and carry out a nucleophilic substitution reaction to obtain a fluorine-substituted tris-acridine derivative;

[0029] The structural formula of the N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropanamide) is as follows:

[0030] In the present invention, the molar volume ratio of the N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropanamide), 4,4-difluoropiperidine, potassium iodide, potassium carbonate and absolute ethanol is 0.8 - 1.2 mmol: 9 - 11 mmol: 0.4 - 0.6 mmol: 0.4 - 0.6 mmol: 10 - 20 mL, preferably 0.9 - 1.1 mmol: 9.5 - 10.5 mmol: 0.45 - 0.55 mmol: 0.45 - 0.55 mmol: 12 - 18 mL, and further preferably 1 mmol: 10 mmol: 0.5 mmol: 0.5 mmol: 15 mL.

[0031] In the present invention, the temperature of the nucleophilic addition reaction is 80 - 100 °C, specifically it can be 82 °C, 84 °C, 85 °C, 86 °C, 88 °C, 90 °C, 92 °C, 94 °C, 95 °C, 96 °C, 98 °C; the time of the nucleophilic substitution reaction is 1 - 3 h, specifically it can be 1.2 h, 1.4 h, 1.5 h, 1.6 h, 1.8 h, 2 h, 2.2 h, 2.4 h, 2.5 h, 2.6 h, 2.8 h.

[0032] In the present invention, stirring is preferably carried out during the nucleophilic addition reaction, and the stirring speed is preferably 400 - 600 rpm, specifically it can be 420 rpm, 450 rpm, 480 rpm, 500 rpm, 520 rpm, 550 rpm, 580 rpm.

[0033] In the present invention, for the mixing, it is preferred to first mix the N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropanamide), potassium iodide and potassium carbonate, and then successively add absolute ethanol and 4,4-difluoropiperidine.

[0034] In the present invention, after the nucleophilic addition reaction, a quenching reaction, vacuum distillation, and extraction are sequentially carried out to obtain an organic layer, and the organic layer is sequentially dried, vacuum distilled, and subjected to silica gel column chromatography to obtain a fluorine-based trisubstituted acridine derivative; the reagent used in the quenching reaction is water, and the volume ratio of water to absolute ethanol is preferably 10-20:0.01-1, more preferably 15:0.1; the temperature of vacuum distillation is preferably 45-55°C independently, specifically it can be 46°C, 48°C, 50°C, 52°C, 54°C; the pressure of vacuum distillation is preferably 0.05-0.15 Mpa independently, more preferably 0.1 Mpa; the time of vacuum distillation is preferably 20-30 min independently, specifically it can be 22 min, 24 min, 25 min, 26 min, 28 min; the reagents used in the extraction are preferably dichloromethane and saturated sodium chloride solution, and the volume ratio of dichloromethane to saturated sodium chloride solution is preferably 1-2:1, more preferably 1:1; the number of extraction times is preferably 2-4 times, more preferably 3 times; the reagent used in the drying is preferably anhydrous magnesium sulfate; the reagents used in the silica gel column chromatography are preferably dichloromethane and methanol, and the volume ratio of dichloromethane to methanol is preferably 20-40:1, more preferably 30:1.

[0035] In the present invention, the fluorine-based trisubstituted acridine derivative is N,N'-(9-((4-(dimethylamino)phenyl)amino)acridine-3,6-diyl)bis(3-(4,4-difluoropiperidin-1-yl)propanamide).

[0036] In the present invention, the preparation method of N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropanamide) preferably includes the following steps:

[0037] (1) Condensing 2-chloro-4-aminobenzoic acid and acetic anhydride to obtain a condensation intermediate;

[0038] (2) Mixing the condensation intermediate, m-aminophenetidine, copper powder, cuprous oxide, potassium carbonate, and ethylene glycol monoethyl ether, and carrying out an Ullmann reaction to obtain a benzoic acid intermediate;

[0039] (3) Carrying out a cyclization reaction on the benzoic acid intermediate and sulfuric acid to obtain an acridone intermediate 1;

[0040] (4) Condensing the acridone intermediate 1 and butyric anhydride to obtain an acridone intermediate 2;

[0041] (5) Carrying out an electrophilic substitution reaction on the acridone intermediate 2 and phosphorus oxychloride to obtain an acridine intermediate;

[0042] (6) Mix the acridine intermediate, N,N-dimethyl-p-phenylenediamine, and phenol, and carry out a nucleophilic substitution reaction to obtain a trisubstituted acridine intermediate 1;

[0043] (7) Carry out a hydrolysis reaction on the trisubstituted acridine intermediate 1 and sulfuric acid to obtain a trisubstituted acridine intermediate 2;

[0044] (8) Mix the trisubstituted acridine intermediate 2, 3-chloropropionyl chloride, triethylamine, and N,N-dimethylformamide, and carry out a nucleophilic addition reaction to obtain N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropionamide).

[0045] In the present invention, the molar volume ratio of the 2-chloro-4-aminobenzoic acid and acetic anhydride in step (1) is preferably 110-120 mmol: 30 mL, more preferably 112-118 mmol: 30 mL, and even more preferably 116.6 mmol: 30 mL; the temperature of the condensation reaction is preferably 90-110 °C, more preferably 95-105 °C, and even more preferably 100 °C; the time of the condensation reaction is preferably 20-40 min, more preferably 25-35 min, and even more preferably 30 min.

[0046] In the present invention, stirring is preferably carried out during the condensation reaction in step (1), and the stirring speed is preferably 700-900 rpm, more preferably 800 rpm.

[0047] In the present invention, after the condensation reaction in step (1), it is preferably to first add dichloromethane to precipitate a solid, and then filter and wash to obtain a condensation intermediate; the volume ratio of the dichloromethane and acetic anhydride is preferably 2-4:1, more preferably 3:1; the reagent used for washing is preferably dichloromethane, and the number of washing times is preferably 2-4 times, more preferably 3 times. The purpose of filtration is to remove excess acetic anhydride, by-product acetic acid, and dichloromethane.

[0048] In the present invention, the condensation intermediate in step (1) is 4-(acetylamino)-2-chlorobenzoic acid, and its structural formula is:

[0049] In the present invention, the molar ratio of the condensation intermediate, m-aminoacetanilide, copper powder, cuprous oxide and potassium carbonate in step (2) is preferably 1:0.8 - 1.2:0.08 - 0.12:0.08 - 0.12:0.2 - 0.8, more preferably 1:0.9 - 1.1:0.09 - 0.11:0.09 - 0.11:0.3 - 0.6, and even more preferably 1:1.0:0.098:0.092:0.5; the molar volume ratio of the condensation intermediate and ethylene glycol monoethyl ether is preferably 1 mmol:1 - 2.5 mL, more preferably 1 mmol:1.3 - 2 mL, and even more preferably 1 mmol:1.7 mL; the temperature of the Ullmann reaction is preferably 125 - 145 °C, more preferably 130 - 140 °C, and even more preferably 135 °C; the time of the Ullmann reaction is preferably 4 - 6 h, more preferably 4.5 - 5.5 h, and even more preferably 5 h.

[0050] In the present invention, during the Ullmann reaction in step (2), stirring is preferably carried out, and the stirring speed is preferably 400 - 600 rpm, more preferably 500 rpm.

[0051] In the present invention, after the Ullmann reaction in step (2), a quenching reaction, filtration, recrystallization, and drying are preferably carried out in sequence to obtain a benzoic acid intermediate; the reagent used for the quenching reaction is water, and the volume ratio of water to ethylene glycol monoethyl ether is preferably 3 - 4:1, more preferably 3.75:1; the recrystallization preferably uses hydrochloric acid to acidify the filtrate obtained by filtration, and the volume ratio of HCl to water in the hydrochloric acid is preferably 2.5 - 3.5:1, more preferably 3:1, and the acidification ends when the pH value of the filtrate is 2 - 3; the drying temperature is preferably 40 - 60 °C, more preferably 50 °C; the drying time is preferably 20 - 28 h, more preferably 24 h. The purpose of filtration is to remove the catalyst copper powder and cuprous oxide.

[0052] In the present invention, the benzoic acid intermediate in step (2) is 4-(acetamido)-2-(3-(acetamido)phenylamino)benzoic acid, and the structural formula is:

[0053] In the present invention, the molar volume ratio of the benzoic acid intermediate and sulfuric acid in step (3) is preferably 14 - 17 mmol:12 mL, more preferably 15 - 16 mmol:12 mL, and even more preferably 15.3 mmol:12 mL; the mass concentration of sulfuric acid is preferably 92 - 98%, more preferably 94 - 96%; the temperature of the ring-forming reaction is preferably 125 - 145 °C, more preferably 130 - 140 °C, and even more preferably 135 °C; the time of the ring-forming reaction is preferably 2 - 4 h, more preferably 2.5 - 3.5 h, and even more preferably 3 h.

[0054] In the present invention, during the ring-forming reaction in step (3), stirring is preferably carried out, and the stirring speed is preferably 400 - 600 rpm, more preferably 500 rpm.

[0055] In the present invention, after the ring-forming reaction in step (3) is completed, the reaction solution is preferably placed in ice water to obtain a crude mixture, and the crude mixture is sequentially subjected to recrystallization, filtration, and drying to obtain acridone intermediate 1; the temperature of the ice water is preferably -10 to 10°C, more preferably 0°C, and the volume ratio of ice water to sulfuric acid is preferably 100:10 - 15, more preferably 100:12; the recrystallization is preferably carried out by adjusting the pH value of the crude mixture to 12 - 13 with a saturated sodium hydroxide solution; the drying temperature is preferably 40 - 60°C, more preferably 50°C; the drying time is preferably 20 - 28 h, more preferably 24 h.

[0056] In the present invention, the acridone intermediate 1 in step (3) is 3,6-diamino-9(10H)-acridone, and its structural formula is:

[0057] In the present invention, the molar volume ratio of the acridone intermediate 1 to butyric anhydride in step (4) is preferably 0.8 - 2.5 mmol:10 mL, more preferably 1 - 2 mmol:10 mL, and most preferably 1.33 mmol:10 mL; the temperature of the condensation reaction is preferably 90 - 110°C, more preferably 95 - 105°C, and most preferably 100°C; the condensation reaction time is preferably 1 - 3 h, more preferably 1.5 - 2.5 h, and most preferably 2 h.

[0058] In the present invention, during the condensation reaction in step (4), stirring is preferably carried out, and the stirring speed is preferably 400 - 600 rpm, more preferably 500 rpm.

[0059] In the present invention, after the condensation reaction in step (4) is completed, recrystallization, filtration, and drying are preferably carried out sequentially to obtain acridone intermediate 2; the recrystallization is preferably carried out by adjusting the pH value of the reaction solution to 12 - 13 with a sodium hydroxide solution, and the mass concentration of the sodium hydroxide solution is preferably 37 - 43%, more preferably 40%; the drying temperature is preferably 40 - 60°C, more preferably 50°C; the drying time is preferably 20 - 28 h, more preferably 24 h.

[0060] In the present invention, the acridone intermediate 2 in step (4) is 3,6-bis(butyrylamino)-9(10H)-acridone, and its structural formula is:

[0061] In the present invention, the molar volume ratio of the acridone intermediate 2 to phosphorus oxychloride in step (5) is preferably 12 - 15 mmol: 20 mL, more preferably 13 - 14 mmol: 20 mL, and even more preferably 13.7 mmol: 20 mL; the temperature of the electrophilic substitution reaction is preferably 80 - 100 °C, more preferably 85 - 95 °C, and even more preferably 90 °C; the time of the electrophilic substitution reaction is preferably 1 - 2 h, more preferably 1.5 h.

[0062] In the present invention, during the electrophilic substitution reaction in step (5), stirring is preferably carried out, and the stirring speed is preferably 400 - 600 rpm, more preferably 500 rpm.

[0063] In the present invention, after the electrophilic substitution reaction in step (5) is completed, the reaction solution is preferably cooled to room temperature, and then subjected to reduced pressure distillation, neutralization of phosphorus oxychloride, and extraction to obtain an organic layer. The organic layer is then sequentially dried, subjected to reduced pressure distillation, and silica gel column chromatography to obtain the acridine intermediate; the temperature of the reduced pressure distillation is independently preferably 50 - 60 °C, more preferably 55 °C; the pressure of the reduced pressure distillation is independently preferably 0.05 - 0.15 MPa, more preferably 0.1 MPa; the time of the reduced pressure distillation is independently preferably 5 - 15 min, more preferably 10 min; the neutralization of phosphorus oxychloride is preferably to place the product of the reduced pressure distillation in ice water to obtain a crude product, and the pH value of the crude product is adjusted to 12 - 13 using saturated sodium hydroxide solution; the temperature of the ice water is preferably -10 - 10 °C, more preferably 0 °C, and the volume ratio of ice water to phosphorus oxychloride is preferably 100: 15 - 25, more preferably 100: 20; the extraction reagent is preferably dichloromethane and methanol, and the volume ratio of dichloromethane to methanol is preferably 9 - 11: 1, more preferably 10: 1; the number of extraction times is preferably 2 - 4 times, more preferably 3 times; the drying reagent is preferably anhydrous magnesium sulfate; the silica gel column chromatography reagent is preferably dichloromethane and methanol, and the volume ratio of dichloromethane to methanol is preferably 20 - 40: 1, more preferably 30: 1. The purpose of the first reduced pressure distillation is to remove the solvent phosphorus oxychloride, and the purpose of the second reduced pressure distillation is to remove dichloromethane and methanol.

[0064] In the present invention, the acridine intermediate in step (5) is 3,6-bis(butyrylamino)-9-chloroacridine, and its structural formula is:

[0065] In the present invention, the molar volume ratio of the acridine intermediate, N,N-dimethyl-p-phenylenediamine, and phenol in step (6) is preferably 1 mmol: 3 - 5 mmol: 2 - 4 mL, more preferably 1 mmol: 3.5 - 4.5 mmol: 2.5 - 3.5 mL, and even more preferably 1 mmol: 4 mmol: 2.88 mL; the temperature of the nucleophilic substitution reaction is preferably 90 - 110 °C, more preferably 95 - 105 °C, and even more preferably 100 °C; the time of the nucleophilic substitution reaction is preferably 1 - 3 h, more preferably 1.5 - 2.5 h, and even more preferably 2 h.

[0066] In the present invention, during the process of the nucleophilic substitution reaction in step (6), stirring is preferably carried out, and the stirring speed is preferably 400 - 600 rpm, more preferably 500 rpm.

[0067] In the present invention, after the nucleophilic substitution reaction in step (6), a quenching reaction and extraction are preferably carried out in sequence to obtain an organic layer, and the organic layer is sequentially dried, subjected to vacuum distillation, and silica gel column chromatography to obtain the trisubstituted acridine intermediate 1; the reagent used for the quenching reaction is preferably water, and the volume ratio of water to phenol is preferably 100: 10 - 15, more preferably 100: 12; the reagents used for the extraction are preferably dichloromethane and saturated sodium chloride solution, and the volume ratio of dichloromethane to saturated sodium chloride solution is preferably 1 - 2: 1, more preferably 1.5: 1; the number of extraction times is preferably 2 - 4 times, more preferably 3 times; the reagent used for drying is preferably anhydrous magnesium sulfate; the temperature of the vacuum distillation is preferably 50 - 60 °C, more preferably 55 °C; the pressure of the vacuum distillation is preferably 0.05 - 0.15 MPa, more preferably 0.1 MPa; the time of the vacuum distillation is preferably 10 - 20 min, more preferably 15 min; the reagents used for the silica gel column chromatography are preferably dichloromethane and methanol, and the volume ratio of dichloromethane to methanol is preferably 10 - 30: 1, more preferably 20: 1. The purpose of vacuum distillation is to remove dichloromethane and methanol.

[0068] In the present invention, the trisubstituted acridine intermediate 1 in step (6) is 3,6-bis(butyramido)-9-[4'-(N,N-dimethylamino)phenylamino]acridine, and its structural formula is:

[0069] In the present invention, the molar volume ratio of the trisubstituted acridine intermediate 1 to sulfuric acid in step (7) is preferably 2 - 4 mmol: 10 mL, more preferably 2.68 - 3.5 mmol: 10 mL, and even more preferably 3 mmol: 10 mL; the mass concentration of sulfuric acid is preferably 92 - 98%, more preferably 94 - 96%; the temperature of the hydrolysis reaction is preferably 90 - 110 °C, more preferably 95 - 105 °C, and even more preferably 100 °C; the time of the hydrolysis reaction is preferably 20 - 40 min, more preferably 25 - 35 min, and even more preferably 30 min.

[0070] In the present invention, during the hydrolysis reaction in step (7), stirring is preferably carried out, and the stirring speed is preferably 400 - 600 rpm, more preferably 500 rpm.

[0071] In the present invention, after the hydrolysis reaction in step (7), the reaction solution is preferably cooled to room temperature, and then successively neutralized with sulfuric acid, recrystallized, filtered, and dried to obtain the trisubstituted acridine intermediate 2; the neutralization of sulfuric acid is preferably to place the reaction solution in ice water to obtain a crude mixture; the temperature of the ice water is preferably -10 - 10 °C, more preferably 0 °C, and the volume ratio of ice water to sulfuric acid is preferably 50:8 - 12, more preferably 50:10; the recrystallization is preferably to adjust the pH value of the crude mixture to 12 - 13 with a saturated sodium hydroxide solution; the drying temperature is preferably 40 - 50 °C, more preferably 45 °C; the drying time is preferably 20 - 28 h, more preferably 24 h.

[0072] In the present invention, the trisubstituted acridine intermediate 2 in step (7) is 3,6 - diamino - 9 - [4'-(N,N - dimethylamino)phenylamino]acridine, and its structural formula is:

[0073] In the present invention, the molar volume ratio of the trisubstituted acridine intermediate 2, 3 - chloropropionyl chloride, triethylamine, and N,N - dimethylformamide in step (8) is preferably 1 mmol: 4 - 6 mmol: 0.3 - 0.6 mL: 1 - 3 mL, more preferably 1 mmol: 4.5 - 5.5 mmol: 0.4 - 0.5 mL: 1.67 - 2.5 mL, and even more preferably 1 mmol: 5 mmol: 0.42 mL: 2 mL; the temperature of the nucleophilic addition reaction is preferably 50 - 70 °C, more preferably 55 - 65 °C, and even more preferably 60 °C; the time of the nucleophilic addition reaction is preferably 1 - 3 h, more preferably 1.5 - 2.5 h, and even more preferably 2 h.

[0074] In the present invention, during the nucleophilic addition reaction in step (8), stirring is preferably carried out, and the stirring speed is preferably 400 - 600 rpm, more preferably 500 rpm.

[0075] In the present invention, in step (8), the mixing preferably first mixes the trisubstituted acridine intermediate 2 and triethylamine, and then successively adds N,N-dimethylformamide and 3-chloropropionyl chloride.

[0076] In the present invention, after the nucleophilic addition reaction in step (8), a quenching reaction, vacuum distillation, and extraction are successively carried out to obtain an organic layer. The organic layer is successively dried, vacuum distilled, and subjected to silica gel column chromatography to obtain the trisubstituted acridine derivative; the reagent used for the quenching reaction is water, and the volume ratio of water to N,N-dimethylformamide is preferably 20-30:1, more preferably 25:1; the temperature of the vacuum distillation is independently preferably 60-70 °C, more preferably 65 °C; the pressure of the vacuum distillation is independently preferably 0.05-0.15 MPa, more preferably 0.1 MPa; the time of the vacuum distillation is independently preferably 20-30 min, more preferably 25 min; the reagents used for the extraction are preferably dichloromethane and saturated sodium chloride solution, and the volume ratio of dichloromethane to saturated sodium chloride solution is preferably 1-2:1, more preferably 1.5:1; the number of extractions is preferably 2-4 times, more preferably 3 times; the reagent used for the drying is preferably anhydrous magnesium sulfate; the reagents used for the silica gel column chromatography are preferably dichloromethane and methanol, and the volume ratio of dichloromethane to methanol is preferably 10-30:1, more preferably 20:1.

[0077] In the present invention, the preparation process of the fluorine-containing trisubstituted acridine derivative is as follows:

[0078]

[0079] The present invention also provides an application of the fluorine-containing trisubstituted acridine derivative prepared by the above preparation method in the preparation of anti-inflammatory drugs.

[0080] In the present invention, the anti-inflammatory drug includes any acceptable dosage form, and specifically may be an injection, tablet, capsule, aerosol, suppository, film, dripping pill, ointment, controlled release agent, sustained release agent or nano preparation.

[0081] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.

[0082] The raw material used in all embodiments of the present invention: N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropanamide) is prepared by the following method, and the preparation method is not regarded as a limitation to the present invention.

[0083] Mix 116.6 mmol of 2-chloro-4-aminobenzoic acid and 30 mL of acetic anhydride, and carry out a condensation reaction by stirring at a speed of 800 rpm at 100 °C for 30 min to obtain a clear solution. Add 90 mL of dichloromethane to the clear solution to precipitate, and then filter with a sintered glass funnel to obtain a solid product. Wash the solid product 3 times with dichloromethane to obtain a condensation intermediate: 4-(acetylamino)-2-chlorobenzoic acid. The condensation intermediate is a white solid with a mass of 17.2 g and a yield of 69.1%.

[0084] Mix 2.34 mmol of anhydrous potassium carbonate, 0.46 mmol of copper powder, 0.43 mmol of cuprous oxide, 4.68 mmol of the condensation intermediate, 5.15 mmol of m-aminoacetanilide and 8 mL of ethylene glycol monoethyl ether, and carry out an Ullmann reaction by stirring at a speed of 500 rpm at 135 °C for 5 h to obtain a reaction mixture. Pour the reaction mixture into 30 mL of distilled water, and filter with a diatomite filter to obtain a filtrate. Add hydrochloric acid (the volume ratio of HCl to water in the hydrochloric acid is 3:1) to the filtrate for acidification, and end the acidification when the pH value of the filtrate reaches 2.5. Filter again to obtain a crude product. Dry the crude product at 50 °C for 24 h to obtain a benzoic acid intermediate: 4-(acetylamino)-2-(3-(acetylamino)phenylamino)benzoic acid. The benzoic acid intermediate is a gray solid with a mass of 420 mg and a yield of 27.4%.

[0085] Dropwise add 12 mL of sulfuric acid with a mass concentration of 96% to 15.3 mmol of the benzoic acid intermediate at a rate of 1 drop / s, and carry out a cyclization reaction by stirring at a speed of 500 rpm at 135 °C for 2 h. After the reaction is completed, cool to room temperature to obtain a reaction mixture. Pour the reaction mixture into 100 mL of ice water at 0 °C to obtain a crude mixture. Adjust the pH value of the crude mixture to 12.5 with saturated sodium hydroxide solution, and then filter with a sintered glass funnel to obtain a filter residue. Dry the filter residue at 45 °C for 24 h to obtain an acridone intermediate 1: 3,6-diamino-9(10H)-acridone. The acridone intermediate 1 is a yellowish green solid and is directly used for the next reaction step without further purification.

[0086] Place 1.33 mmol of acridone intermediate 1 in a 100 mL round-bottom flask, add 10 mL of butyric anhydride, and stir at 500 rpm for 2 h at 100 °C for a condensation reaction to obtain a reaction mixture. Adjust the pH value of the reaction mixture to 12.5 with a 40% sodium hydroxide solution by mass concentration, then filter with a sintered glass funnel to obtain a filter residue. Place the filter residue in an oven at 50 °C for 24 h to obtain acridone intermediate 2: 3,6-bis(butyrylamino)-9(10H)-acridone. Acridone intermediate 2 is a gray solid and can be directly used in the next reaction step without further purification.

[0087] Add 20 mL of phosphorus oxychloride to 13.7 mmol of acridone intermediate 2, and stir at 500 rpm for 1.5 h at 90 °C for an electrophilic substitution reaction. After the reaction is completed, cool to room temperature to obtain a reaction mixture. Place the reaction mixture in a rotary evaporator and perform vacuum distillation at 55 °C and 0.1 MPa for 10 min. Pour the product of the vacuum distillation into 100 mL of ice water at 0 °C to obtain a crude product, and adjust the pH value of the crude product to 12.5 with a saturated sodium hydroxide solution to obtain a mixed solution. Extract the mixed solution with a 10:1 volume ratio of dichloromethane and methanol three times to obtain an organic layer. Dry the organic layer with anhydrous magnesium sulfate and then place it in a rotary evaporator and perform vacuum distillation at 55 °C and 0.1 MPa for 15 min. Perform silica gel column chromatography on the product of the vacuum distillation with a 30:1 volume ratio of dichloromethane and methanol (the dropping rate of the product of the vacuum distillation is 5 drops / s) to obtain acridine intermediate: 3,6-bis(butyrylamino)-9-chloroacridine. The acridine intermediate is a bright yellow solid with a mass of 1.6 g and a yield of 30.5%.

[0088] Mix 4.16 mmol of acridine intermediate, 16.66 mmol of N,N-dimethyl-p-phenylenediamine, and 12 mL of phenol, and stir at 500 rpm for 2 h at 100 °C for a nucleophilic substitution reaction to obtain a reaction mixture. Pour the reaction mixture into 100 mL of distilled water, adjust the pH value of the reaction mixture to 12.5 with a saturated sodium hydroxide solution, and then extract three times with a 1:1 volume ratio of dichloromethane and saturated sodium chloride solution to obtain an organic layer. Dry the organic layer with anhydrous magnesium sulfate and then place it in a rotary evaporator and perform vacuum distillation at 55 °C and 0.1 MPa for 15 min. Perform silica gel column chromatography on the product of the vacuum distillation with a 20:1 volume ratio of dichloromethane and methanol (the dropping rate of the product of the vacuum distillation is 5 drops / s) to obtain trisubstituted acridine intermediate 1: 3,6-bis(butyrylamino)-9-[4'-(N,N-dimethylamino)phenylamino]acridine. The trisubstituted acridine intermediate 1 is a reddish-brown solid with a mass of 1.3 g and a yield of 64.7%.

[0089] At a rate of 1 drop / s, 10 mL of sulfuric acid with a mass concentration of 96% was added dropwise to 2.68 mmol of the trisubstituted acridine intermediate 1. The mixture was placed at 100 °C and stirred at a speed of 500 rpm for 0.5 h for hydrolysis reaction. After the reaction was completed, it was cooled to room temperature to obtain a reaction mixture. The reaction mixture was poured into 50 mL of ice water at 0 °C to obtain a crude product. The pH value of the crude product was adjusted to 12.5 with saturated sodium hydroxide solution, and then filtered through a sintered funnel to obtain a filter residue. The filter residue was dried at 45 °C for 24 h to obtain the trisubstituted acridine intermediate 2: 3,6-diamino-9-[4'-(N,N-dimethylamino)phenylamino]acridine. The trisubstituted acridine intermediate 2 was a red-brown solid and was directly used in the next reaction step without further purification.

[0090] 2.39 mmol of the trisubstituted acridine intermediate 2 and 1 mL of triethylamine were mixed, and then 4 mL of N,N-dimethylformamide and 11.95 mmol of 3-chloropropionyl chloride were sequentially added. The mixture was placed at 60 °C and stirred at a speed of 500 rpm for 2 h for nucleophilic addition reaction to obtain a reaction mixture. 2 drops of distilled water were added dropwise to the reaction mixture, and it was placed in a rotary evaporator and distilled under reduced pressure at 65 °C and 0.1 MPa for 25 min. The product of the reduced-pressure distillation was extracted 3 times with a volume ratio of 1:1 dichloromethane and saturated sodium chloride solution to obtain an organic layer. The organic layer was dried with anhydrous magnesium sulfate and then placed in a rotary evaporator and distilled under reduced pressure at 55 °C and 0.1 MPa for 15 min. Silica gel column chromatography was performed on the product of the reduced-pressure distillation with a volume ratio of 20:1 dichloromethane and methanol (the dropping rate of the product of the reduced-pressure distillation was 5 drops / s) to obtain N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropionamide), which was a red-brown solid with a mass of 550 mg and a yield of 44.7%.

[0091] Example 1

[0092] Mix 1.05 mmol of N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropanamide), 0.5 mmol of potassium iodide and 0.5 mmol of potassium carbonate, then successively add 15 mL of absolute ethanol and 10.5 mmol of 4,4-difluoropiperidine, and place it at 90 °C and stir at a speed of 500 rpm for 2 h to carry out a nucleophilic substitution reaction to obtain a reaction mixture. Drop the reaction mixture into 0.1 mL of distilled water, and place it in a rotary evaporator, and carry out vacuum distillation at 50 °C and 0.1 MPa for 25 min. Extract the product of vacuum distillation 3 times with a dichloromethane and saturated sodium chloride solution with a volume ratio of 1:1 to obtain an organic layer. Dry the organic layer with anhydrous magnesium sulfate and then place it in a rotary evaporator, and carry out vacuum distillation at 50 °C and 0.1 MPa for 15 min. Carry out silica gel column chromatography on the product of vacuum distillation with a dichloromethane and methanol with a volume ratio of 30:1 (the dropping rate of the product of vacuum distillation is 5 drops / s) to obtain a fluorine-substituted trisacridine derivative: N,N'-(9-((4-(dimethylamino)phenyl)amino)acridine-3,6-diyl)bis(3-(4,4-difluoropiperidin-1-yl)propanamide). The fluorine-substituted trisacridine derivative is a red-brown solid with a mass of 95 mg and a yield of 13.06%.

[0093] Perform NMR characterization on the fluorine-substituted trisacridine derivative prepared in Example 1. Figure 1 For the fluorine-substituted trisacridine derivative prepared in Example 1 1 1H NMR nuclear magnetic resonance spectrum diagram.

[0094] Figure 1 The obtained 1 1H NMR is: 1H NMR (400 MHz, Methanol-d4) δ 8.44 (s, 2H), 8.02 (d, J = 9.3 Hz, 2H), 7.27–7.19 (m, 4H), 6.89–6.83 (m, 2H), 3.14–3.07 (m, 4H), 3.05–3.02 (m, 7H), 3.01–2.89 (m, 8H), 2.82 (t, 4H), 2.20–2.09 (m, 8H).

[0095] From Figure 1 It can be seen that the fluorine-substituted trisacridine derivative prepared in Example 1 of the present invention is N,N'-(9-((4-(dimethylamino)phenyl)amino)acridine-3,6-diyl)bis(3-(4,4-difluoropiperidin-1-yl)propanamide).

[0096] Example 2

[0097] Mix 1 mmol of N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropanamide), 0.5 mmol of potassium iodide and 0.5 mmol of potassium carbonate, then successively add 20 mL of absolute ethanol and 11 mmol of 4,4-difluoropiperidine, place it at 80 °C and stir at a speed of 500 rpm for 3 h to carry out a nucleophilic substitution reaction to obtain a reaction mixture. Drop the reaction mixture into 2 drops of distilled water, and place it in a rotary evaporator, and carry out reduced pressure distillation at 50 °C and 0.1 MPa for 25 min. Extract the product of the reduced pressure distillation 3 times with a volume ratio of 1:1 dichloromethane and saturated sodium chloride solution to obtain an organic layer. Dry the organic layer with anhydrous magnesium sulfate and then place it in a rotary evaporator, and carry out reduced pressure distillation at 50 °C and 0.1 MPa for 15 min. Carry out silica gel column chromatography on the product of the reduced pressure distillation with a volume ratio of 30:1 dichloromethane and methanol (the dropping rate of the product of the reduced pressure distillation is 5 drops / s) to obtain a fluorine-substituted trisacridine derivative: N,N'-(9-((4-(dimethylamino)phenyl)amino)acridine-3,6-diyl)bis(3-(4,4-difluoropiperidin-1-yl)propanamide). The fluorine-substituted trisacridine derivative is a red-brown solid.

[0098] Example 3

[0099] Mix 1 mmol of N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropanamide), 0.6 mmol of potassium iodide and 0.6 mmol of potassium carbonate, then successively add 10 mL of absolute ethanol and 9 mmol of 4,4-difluoropiperidine, place it at 100 °C and stir at a speed of 500 rpm for 1 h to carry out a nucleophilic substitution reaction to obtain a reaction mixture. Drop the reaction mixture into 2 drops of distilled water, and place it in a rotary evaporator, and carry out reduced pressure distillation at 50 °C and 0.1 MPa for 25 min. Extract the product of the reduced pressure distillation 3 times with a volume ratio of 1:1 dichloromethane and saturated sodium chloride solution to obtain an organic layer. Dry the organic layer with anhydrous magnesium sulfate and then place it in a rotary evaporator, and carry out reduced pressure distillation at 50 °C and 0.1 MPa for 15 min. Carry out silica gel column chromatography on the product of the reduced pressure distillation with a volume ratio of 30:1 dichloromethane and methanol (the dropping rate of the product of the reduced pressure distillation is 5 drops / s) to obtain a fluorine-substituted trisacridine derivative: N,N'-(9-((4-(dimethylamino)phenyl)amino)acridine-3,6-diyl)bis(3-(4,4-difluoropiperidin-1-yl)propanamide). The fluorine-substituted trisacridine derivative is a red-brown solid.

[0100] Experimental Example 1

[0101] Detect the inhibitory effect of the fluorine-substituted trisacridine derivative prepared by the present invention on the secretion of pro-inflammatory cytokine IL-6 through an in vitro inflammation model constructed by LPS-stimulated RAW264.7 cells.

[0102] The specific steps are as follows: RAW264.7 cells (mouse macrophage cell line) were seeded into a 96-well plate (200 μL / well) at a density of 1×10 5 cells / well and incubated overnight in a cell culture incubator at 37 °C and 5% CO2 to ensure cell attachment. On the next day, RAW264.7 cells were first treated with DMEM medium ([brand: ThermoFisher; catalog number: C11995500BT; product specification: 500 ml * 1 bottle]) containing 5, 10 or 20 μM of trisubstituted acridine derivatives (the trisubstituted acridine derivatives were prepared in Example 1 as N,N'-(9-((4-(dimethylamino)phenyl)amino)acridine-3,6-diyl)bis(3-(4,4-difluoropiperidin-1-yl)propanamide) or N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropanamide) used in Example 1), 10% FBS (brand: GIBCO; name and catalog number: FBS Australian Premium Fetal Bovine Serum 10099-141), and 1% P / S (brand: Solarbio; name: Penicillin-Streptomycin Mixture (100×) for Cell Culture Special Double Antibody; catalog number: P1400-10*100 ml]), or DMEM medium containing 0.1% DMSO (as a control group). After treating RAW264.7 cells for 30 min, RAW264.7 cells were then stimulated with 0.5 ng / μL LPS for 12 h. The cell supernatant was collected, and the content of IL-6 in the collected cell supernatant was detected using a murine IL-6 ELISA kit (purchased from Beyotime). The detection of IL-6 was completed entirely according to the operation steps attached to the kit.

[0103] The treatment with the above N,N'-(9-((4-(dimethylamino)phenyl)amino)acridine-3,6-diyl)bis(3-(4,4-difluoropiperidin-1-yl)propanamide) was used as the experimental group, and the treatment with N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropanamide) was used as the control group. The experimental results of the experimental group treated with the product of Example 1 are as Figure 2 shown, and the experimental results of the control group treated with the control compound are as Figure 3 shown. By Figure 2 and Figure 3It can be seen that the fluorine-based trisubstituted acridine derivative prepared by the present invention can effectively inhibit the secretion of inflammatory factors in LPS-induced RAW264.7 cells, and its inhibitory effect on LPS-induced IL-6 secretion shows a dose-dependence: especially when its concentration is 20 μM, the inhibitory effect on IL-6 secretion reaches more than 60%, indicating that the fluorine-based trisubstituted acridine derivative of the present invention has excellent anti-inflammatory activity. However, the chlorine-substituted trisubstituted acridine derivative cannot inhibit the secretion of LPS-induced IL-6, indicating that it does not have anti-inflammatory activity.

[0104] Experimental Example 2

[0105] The effects of the fluorine-based trisubstituted acridine derivative prepared by the present invention on the activities of macrophages RAW264.7 and human normal colon epithelial cells NCM460 were determined by the MTT assay method, and its toxic and side effects were further evaluated.

[0106] The specific steps are as follows: Resuscitate macrophages RAW264.7 and human normal colon epithelial cells NCM460. One day in advance, in a 96-well plate, RAW264.7 and NCM460 cells were seeded at a density of 5000 cells per well (160 μL / well), and 3 replicate wells were set for each group of experiments. After the cells adhered completely, the control group was added with complete medium containing 0.1% DMSO, and the drug administration groups were added with complete medium containing 2.5, 5.0, 10.0, and 20.0 μM of the fluorine-based trisubstituted acridine derivative (the fluorine-based trisubstituted acridine derivative was prepared by Example 1); the added volume was 40 μL / well for all; in addition, the blank group was a blank well without adding cells or medium. The cells were then continued to be incubated in a cell culture incubator at 37 °C and 5% CO2 for 48 h; then 5 mg / mL MTT working solution was added (the added volume was 20 μL / well for all), and the cells were cultured for another 4 h; in a light-shielded environment, the supernatant was carefully aspirated and discarded; then 100 μL of DMSO was added to each well, and the plate was shaken on a horizontal shaker for 10 min to ensure that the purple formazan crystals were completely dissolved. The absorbance of each well was measured at 570 nm on an enzyme-linked immunosorbent assay (ELISA) reader. Finally, the cell viability was determined according to the following calculation formula: Cell viability % = (OD 给药组 -OD 空白组 ) / (OD 对照组 -OD 空白组 )×100%.

[0107] The test results of the effects on the activities of macrophages RAW264.7 and human normal colon epithelial cells NCM460 are shown respectively in Figure 4 and Figure 5As shown, the fluoro-group trisubstituted acridine derivatives did not significantly inhibit the activity of RAW264.7 cells and NCM460 cells at the tested doses, indicating that they have weak cytotoxicity to RAW264.7 cells and NCM460 cells and high safety.

[0108] Experimental Example 3

[0109] G4 structures are widely present in the promoter regions, introns, telomere regions, and 5′ / 3′ UTRs of inflammation-related genes. Studies have confirmed that when G-rich DNA forms stable G4s, it inhibits the transcription and expression of related inflammatory genes (such as TNF-α, IL-6, IL-8, COX-2, NF-κB, STAT3, TLR, etc.). Therefore, small molecule drugs that can specifically stabilize the G4 structure in the inflammatory gene region contribute to the development of precise anti-inflammatory treatment strategies.

[0110] Circular dichroism spectroscopy (CD) is an optical technique used to detect nucleic acid secondary structures (such as G-quadruplexes) and their interactions. G4s with different topologies have characteristic CD spectral signals: parallel type (positive peak at 263 nm), antiparallel type (positive peak at 295 nm and negative peak at 265 nm), and mixed type (positive peak at 290 nm and shoulder peak at 265 nm). By judging the peak position shift and peak intensity change on the CD spectrum after the interaction between the compound and the G-rich oligonucleotide, the effect of the compound on the G4 structure can be explored.

[0111] We synthesized the G-rich sequence GGGTGCTGGGGGTGGGAGAGGG at position 1470 of the IL-6 promoter region by Sangon Biotech (Shanghai) Co., Ltd. (as shown in SEQ ID NO: 1); then dissolved the G-rich sequence in 10 mM Tris-HCl buffer solution with pH = 7.4 to prepare a solution with a final concentration of 3 μM; a total of 4 samples to be tested were prepared, namely: Tris-HCl buffer solution, the solution containing 3 μM IL-6 G-rich sequence prepared above, the solution containing 3 μM IL-6 G-rich sequence + 3 μM fluorine-substituted triacridine derivative of the present invention (N,N'-(9-((4-(dimethylamino)phenyl)amino)acridine-3,6-diyl)bis(3-(4,4-difluoropiperidin-1-yl)propanamide)), and the solution containing 3 μM IL-6 G-rich sequence + 3 μM chlorine-substituted triacridine derivative (N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropanamide)). CD spectral scanning was performed using a quartz cuvette with an optical path of 1 cm; instrument parameters: wavelength range 200 - 450 nm, bandwidth of 3.87 nm, step size of 1 nm, and response time of 1 s. The buffer baseline was measured in the same cuvette and could be automatically subtracted. Each tested sample was scanned at least three times and averaged automatically to obtain the final spectral diagram.

[0112] The circular dichroism spectrum of the G-rich sequence in the IL-6 promoter region induced by the chlorine-substituted triacridine derivative (N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropanamide)) to form a G4 structure is as Figure 6 shown; the circular dichroism spectrum of the G-rich sequence in the IL-6 promoter region induced by the fluorine-substituted triacridine derivative (N,N'-(9-((4-(dimethylamino)phenyl)amino)acridine-3,6-diyl)bis(3-(4,4-difluoropiperidin-1-yl)propanamide)) to form a G4 structure is as Figure 7 shown. It can be seen through Figure 6 that there is no particularly significant characteristic peak pattern for the G-rich sequence of IL-6 in 10 mM Tris-HCl buffer solution with pH = 7.4, indicating that it is in a disordered state; after adding the chlorine-substituted triacridine derivative, there is still no new peak shape or change in peak intensity, indicating that the sequence is still in a disordered state; the above experimental results show that the chlorine-substituted triacridine derivative cannot induce the G-rich sequence of IL-6 to form a G4 structure. Through Figure 7It can be seen that although the IL-6 rich G sequence is disordered in a 10 mM, pH = 7.4 Tris-HCl buffer solution; however, after adding the fluorine-substituted triacridine derivative of the present invention, the positive peak at 263 nm and the negative peak at 238 nm (typical parallel positive topology) in the CD spectrum indicate that the fluorine-substituted triacridine derivative of the present invention can induce the formation of a G4 structure in the IL-6 rich G sequence.

[0113] The various embodiments in this specification are described in a progressive manner. Each embodiment focuses on the differences from other embodiments. For the same or similar parts among the various embodiments, reference can be made to each other.

[0114] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A fluorine-containing trisubstituted acridine derivative, characterized in that: The structural formula of the fluorine-containing trisubstituted acridine derivative is:

2. The method for preparing a fluorine-containing trisubstituted acridine derivative according to claim 1, characterized in that: The following steps are included: N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropionamide) is mixed with 4,4-difluoropiperidine, potassium iodide, potassium carbonate and anhydrous ethanol to carry out a nucleophilic substitution reaction to obtain a fluorine-containing trisubstituted acridine derivative; The structural formula of the N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropionamide) is:

3. The method for preparing a fluorine-containing trisubstituted acridine derivative according to claim 2, characterized in that: The molar volume ratio of the N,N'-(9-(4-(dimethylamino)phenylamino)acridine-3,6-diyl)bis(3-chloropropionamide), 4,4-difluoropiperidine, potassium iodide, potassium carbonate and anhydrous ethanol is 0.8-1.2 mmol: 9-11 mmol: 0.4-0.6 mmol: 0.4-0.6 mmol: 10-20 mL.

4. The method for preparing a fluorine-containing trisubstituted acridine derivative according to claim 3, characterized in that: The temperature of the nucleophilic addition reaction is 80-100° C., and the time of the nucleophilic substitution reaction is 1-3 hours.

5. Use of the fluorine-containing trisubstituted acridine derivative prepared by the preparation method according to any one of claims 2 to 4 in the preparation of anti-inflammatory drugs.