TaVRN1 protein and its encoding gene are applied to regulate wheat heading stage and plant height

CN120230783BActive Publication Date: 2026-08-11INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-24
Publication Date
2026-08-11

Smart Images

  • Figure FT_1
    Figure FT_1
Patent Text Reader

Abstract

This invention discloses the application of the TaVRN1 protein and its encoding gene in regulating the heading date and plant height of wheat, belonging to the field of biotechnology. The technical problem solved by this invention is how to regulate the heading date and / or plant height of plants. The TaVRN1 protein disclosed in this invention is a protein with the amino acid sequence of SEQ ID No. 3, SEQ ID No. 6, and / or SEQ ID No. 9. Experiments have shown that the TaVRN1 protein and its encoding gene can regulate the heading date and plant height of plants: overexpression of the TaVRN1 gene can shorten the heading date and increase the plant height; knockout of the TaVRN1 gene can prolong the heading date and decrease the plant height. This indicates that the TaVRN1 protein and its encoding gene can be used to regulate the heading date and plant height of plants.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of TaVRN1 protein and its encoding gene in regulating wheat heading stage and plant height. Background Technology

[0002] wheat( Triticum aestivum Wheat (L.) is an important food crop, with approximately 40% of the global population relying on it as a staple food. With the continued growth of the global population, the demand for high-yield wheat is also increasing. Suitable heading date and plant height are crucial for wheat's wide adaptability and high yield. By overexpressing genes or using CRISPR / Cas9 gene editing technology to knock out key regulatory genes controlling plant height and heading date, it is possible to create wheat materials with ideal plant height and heading phenotypes suitable for wheat breeding. Summary of the Invention

[0003] The technical problem to be solved by this invention is how to regulate the heading period and / or plant height of plants.

[0004] To address the aforementioned technical problems, the present invention first provides at least one of the following applications of proteins or substances that regulate the content or activity of said proteins: Y1) Regulating the heading period of plants; Y2) Preparing products that regulate the heading period of plants; Y3) Cultivating plants with altered heading periods; Y4) Preparing products that regulate the heading period of plants; Y5) Regulating plant height; Y6) Preparing products that regulate plant height; Y7) Cultivating plants with altered height; Y8) Preparing products that regulate the height of plants. The protein is derived from wheat ( Triticum aestivum L.), whose name is TaVRN1, specifically TaVRN1-5A protein, TaVRN1-5B protein and / or TaVRN1-5D protein; The TaVRN1-5A protein is as follows: A1), A2), or A3): A1) The amino acid sequence is that of SEQ ID No. 3; A2) The amino acid sequence shown in SEQ ID No. 3 in the sequence listing is modified by substitution and / or deletion and / or addition of amino acid residues, and has more than 98% identity with A1) and the same function; A3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2); The TaVRN1-5B protein is one of the following: B1), B2), or B3): B1) a protein whose amino acid sequence is SEQ ID No. 6; B2) a protein that has more than 98% identity with B1) and has the same function by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 6 in the sequence listing; B3) a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of B1) or B2); The TaVRN1-5D protein is as follows: C1), C2), or C3): C1) The amino acid sequence is SEQ ID No. 9; C2) The amino acid sequence shown in SEQ ID No. 9 in the sequence listing is modified by substitution and / or deletion and / or addition of amino acid residues, and has more than 98% identity with C1) and has the same function; C3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of C1) or C2).

[0005] The TaVRN1-5A protein in A2) above is a protein with 98% or more amino acid sequence identity and the same function as the protein shown in SEQ ID No. 3; the TaVRN1-5B protein in B2) above is a protein with 98% or more amino acid sequence identity and the same function as the protein shown in SEQ ID No. 6; and the TaVRN1-5D protein in C2) above is a protein with 98% or more amino acid sequence identity and the same function as the protein shown in SEQ ID No. 9. Identity refers to the similarity of the amino acid sequences. The similarity of the amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in advanced BLAST 2.1, by using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing an identity calculation for a pair of amino acid sequences, the identity value (%) can be obtained. A 98% or higher identity is defined as a 98% or 99% identity.

[0006] The TaVRN1-5A protein in A2), the TaVRN1-5B protein in B2), and the TaVRN1-5D protein in C2) can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0007] The gene encoding the TaVRN1-5A protein in A2) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in SEQ ID No. 2, and / or by performing a missense mutation of one or more base pairs, and / or by attaching a tag to its 5′ and / or 3′ ends. The DNA molecule shown in SEQ ID No. 2 encodes the TaVRN1-5A protein shown in SEQ ID No. 3. The gene encoding the TaVRN1-5B protein in B2) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in SEQ ID No. 5, and / or by performing a missense mutation of one or more base pairs, and / or by attaching a tag to its 5′ and / or 3′ ends. The DNA molecule shown in SEQ ID No. 5 encodes the TaVRN1-5B protein shown in SEQ ID No. 6. The gene encoding the TaVRN1-5D protein in C2) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in SEQ ID No. 8, and / or by performing a missense mutation of one or more base pairs, and / or by attaching a tag coding sequence to its 5′ and / or 3′ ends. The DNA molecule shown in SEQ ID No. 8 encodes the TaVRN1-5D protein shown in SEQ ID No. 9.

[0008] The tags described in A3), B3), and C3) can be polypeptides or proteins fused with the target protein using in vitro DNA recombination technology, to facilitate the expression, detection, tracing, and / or purification of the target protein. These tags can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag, and / or SUMO tag, etc.

[0009] In the above applications, the substances that regulate the content or activity of TaVRN1 are substances that regulate the content or activity of TaVRN1-5A protein, substances that regulate the content or activity of TaVRN1-5B protein, and / or substances that regulate the content or activity of TaVRN1-5D protein. The substance regulating the content or activity of the TaVRN1-5A protein is any one of the following D1) to D9): D1) a nucleic acid molecule encoding the TaVRN1-5A protein; D2) an expression cassette containing the nucleic acid molecule of D1); D3) a recombinant vector containing the nucleic acid molecule of D1, or a recombinant vector containing the expression cassette of D2); D4) a recombinant microorganism containing the nucleic acid molecule of D1, or a recombinant microorganism containing the expression cassette of D2, or a recombinant microorganism containing the recombinant vector of D3); D5) a transgenic microorganism containing the nucleic acid molecule of D1). The following are included: plant cell lines, or transgenic plant cell lines containing the expression cassette described in D2); D6) transgenic plant tissues containing the nucleic acid molecules described in D1), or transgenic plant tissues containing the expression cassette described in D2); D7) transgenic plant organs containing the nucleic acid molecules described in D1), or transgenic plant organs containing the expression cassette described in D2); D8) nucleic acid molecules that reduce the content or activity of the TaVRN1-5A protein; D9) expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in D8); The substance regulating the content or activity of the TaVRN1-5B protein is any one of the following E1) to E9): E1) a nucleic acid molecule encoding the TaVRN1-5B protein; E2) an expression cassette containing the nucleic acid molecule of E1); E3) a recombinant vector containing the nucleic acid molecule of E1), or a recombinant vector containing the expression cassette of E2); E4) a recombinant microorganism containing the nucleic acid molecule of E1), or a recombinant microorganism containing the expression cassette of E2), or a recombinant microorganism containing the recombinant vector of E3); E5) a transgenic microorganism containing the nucleic acid molecule of E1). E6) A transgenic plant cell line containing the expression cassette described in E1) or a transgenic plant tissue containing the expression cassette described in E2); E7) A transgenic plant organ containing the nucleic acid molecule described in E1) or a transgenic plant organ containing the expression cassette described in E2); E8) A nucleic acid molecule that reduces the content or activity of the TaVRN1-5B protein; E9) An expression cassette, recombinant vector, recombinant microorganism, transgenic plant cell line, transgenic plant tissue, or transgenic plant organ containing the nucleic acid molecule described in E8); The substance regulating the content or activity of the TaVRN1-5D protein is any one of the following F1) to F9): F1) a nucleic acid molecule encoding the TaVRN1-5D protein; F2) an expression cassette containing the nucleic acid molecule of F1); F3) a recombinant vector containing the nucleic acid molecule of F1), or a recombinant vector containing the expression cassette of F2); F4) a recombinant microorganism containing the nucleic acid molecule of F1), or a recombinant microorganism containing the expression cassette of F2), or a recombinant microorganism containing the recombinant vector of F3); F5) a transgenic microorganism containing the nucleic acid molecule of F1). The following are included: plant cell lines, or transgenic plant cell lines containing the expression cassette described in F2); F6) transgenic plant tissues containing the nucleic acid molecules described in F1), or transgenic plant tissues containing the expression cassette described in F2); F7) transgenic plant organs containing the nucleic acid molecules described in F1), or transgenic plant organs containing the expression cassette described in F2); F8) nucleic acid molecules that reduce the content or activity of the TaVRN1-5D protein; F9) expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in F8).

[0010] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0011] Those skilled in the art can readily mutate the nucleotide sequence encoding the TaVRN1 protein of this invention using known methods, such as directed evolution and point mutation. Any artificially modified nucleotides that possess 75% or higher identity to the nucleotide sequence of the TaVRN1 protein isolated according to this invention, provided they encode and function the TaVRN1 protein, are derived from and equivalent to the nucleotide sequence of this invention.

[0012] In the above applications, the nucleic acid molecule described in D1) can be a DNA molecule whose coding sequence is SEQ ID No. 2 in the sequence listing; E1) The nucleic acid molecule described may be a DNA molecule whose coding sequence is SEQ ID No. 5 in the sequence listing; F1) The nucleic acid molecule may be a DNA molecule whose coding sequence is SEQ ID No. 8 in the sequence listing.

[0013] Specifically, the nucleic acid molecule described in D1) may be the DNA molecule shown in SEQ ID No. 2 or SEQ ID No. 1; E1) The nucleic acid molecule may be the DNA molecule shown in SEQ ID No. 5 or SEQ ID No. 4; F1) The nucleic acid molecule may be the DNA molecule shown in SEQ ID No. 8 or SEQ ID No. 7.

[0014] In the above applications, the expression cassette (TaVRN1-5A gene expression cassette) containing a nucleic acid molecule encoding the TaVRN1-5A protein described in D2) refers to DNA capable of expressing the TaVRN1-5A protein in host cells. This DNA may include not only a promoter to initiate TaVRN1-5A gene transcription but also a terminator to terminate TaVRN1-5A gene transcription. The expression cassette (TaVRN1-5B gene expression cassette) containing a nucleic acid molecule encoding the TaVRN1-5B protein described in E2) refers to DNA capable of expressing the TaVRN1-5B protein in host cells. This DNA may include not only a promoter to initiate TaVRN1-5B gene transcription but also a terminator to terminate TaVRN1-5B gene transcription. The expression cassette (TaVRN1-5D gene expression cassette) containing a nucleic acid molecule encoding the TaVRN1-5D protein, as described in F2, refers to DNA capable of expressing the TaVRN1-5D protein in host cells. This DNA may include not only a promoter to initiate TaVRN1-5D gene transcription but also a terminator to terminate TaVRN1-5D gene transcription. Furthermore, the expression cassette may also include an enhancer sequence.

[0015] Recombinant vectors containing the TaVRN1-5A, TaVRN1-5B, and TaVRN1-5D gene expression cassettes can be constructed using existing expression vectors.

[0016] In the above applications, the vector can be a plasmid, granule, bacteriophage, or viral vector. Specifically, the plasmid can be... pWMB110 Carrier.

[0017] In one embodiment of the present invention, the recombinant vector in B3) is specifically... pWMB110::TaVRN1-5A The aforementioned pWMB110::TaVRN1-5A In order to be in pWMB110 The recombinant vector obtained by inserting the TaVRN1-5A gene into the vector.

[0018] D8) The nucleic acid molecule that reduces TaVRN1-5A content can be an sgRNA that targets the gene encoding TaVRN1-5A. E8) The nucleic acid molecule that reduces TaVRN1-5B content can be an sgRNA that targets the gene encoding TaVRN1-5B. F8) The nucleic acid molecule that reduces TaVRN1-5D content can be an sgRNA that targets the gene encoding TaVRN1-5D.

[0019] D9) The recombinant vector may be a recombinant vector prepared using the Crisper / Cas9 system capable of editing the TaVRN1-5A gene. The recombinant vector may express sgRNA targeting the nucleic acid molecule described in D1). The target sequence of the sgRNA may be positions 206-227 of SEQ ID No. 1 in the sequence listing.

[0020] E9) The recombinant vector may be a recombinant vector prepared using the Crisper / Cas9 system capable of editing the TaVRN1-5B gene. The recombinant vector may express an sgRNA targeting the nucleic acid molecule described in E1). The target sequence of the sgRNA may be positions 197-218 of SEQ ID No. 4 in the sequence listing.

[0021] The recombinant vector described in F9) may be a recombinant vector prepared using the Crisper / Cas9 system capable of editing the TaVRN1-5D gene. The recombinant vector may express an sgRNA targeting the nucleic acid molecule described in F1). The target sequence of the sgRNA may be positions 260-281 of SEQ ID No. 7 in the sequence listing.

[0022] In the above applications, the microorganisms can be yeast, bacteria, algae, or fungi. Among them, bacteria can be Agrobacterium, such as Agrobacterium EHA105.

[0023] In the above applications, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs do not include propagation material.

[0024] In the above applications, the substance that regulates the content or activity of TaVRN1 is a substance that increases the content or activity of TaVRN1; the substance that regulates the heading period of plants is a substance that shortens the heading period of plants; the substance that cultivates plants with altered heading periods is a substance that cultivates plants with shortened heading periods; the substance that regulates plant height is a substance that increases plant height; and the substance that cultivates plants with altered plant height is a substance that cultivates plants with increased plant height. The substance that regulates the content or activity of TaVRN1 is a substance that reduces the content or activity of TaVRN1; the regulation of the heading period of the plant is to prolong the heading period of the plant; the cultivation of a plant with a changed heading period is to cultivate a plant with a prolonged heading period; the regulation of the plant height is to reduce the plant height; the cultivation of a plant with a changed plant height is to cultivate a plant with a reduced plant height.

[0025] The present invention also provides any of the following methods: X1) Methods for shortening the heading period of plants and / or increasing plant height, including: making plants express TaVRN1, or increasing the content or activity of TaVRN1, to shorten the heading period of plants and / or increase plant height. X2) Methods for cultivating plants with shortened heading period and / or increased plant height, including: expressing TaVRN1 in plants, or increasing the content or activity of TaVRN1 to obtain plants with shortened heading period and / or increased plant height; X3) Methods to prolong the heading period of plants and / or reduce plant height include: reducing the content or activity of TaVRN1 in plants, or knocking out the TaVRN1 coding gene in plants, or reducing the expression level of the TaVRN1 coding gene in plants, thereby prolonging the heading period of plants and / or reducing plant height. X4) Methods for cultivating plants with prolonged heading period and / or reduced plant height include: reducing the content or activity of TaVRN1 in plants, or knocking out the TaVRN1 coding gene in plants, or reducing the expression level of the TaVRN1 coding gene in plants, to obtain plants with prolonged heading period and / or reduced plant height.

[0026] In the above methods, X1) and X2) can be achieved by introducing the TaVRN1 coding gene into the plant and expressing the coding gene; The methods described in X3) and X4) are achieved by inhibiting the expression of the gene encoding TaVRN1 in the plant or knocking out the gene encoding the protein in the plant.

[0027] In the above method, the encoding gene can be the nucleic acid molecule described in D1), E1) and / or F1).

[0028] The TaVRN1 coding gene can be introduced into recipient plants using a recombinant expression vector containing the TaVRN1 coding gene. Specifically, the recombinant expression vector can be the... pWMB110::TaVRN1-5A .

[0029] In the methods described above, X3) and X4) are implemented by editing the coding gene of TaVRN1, such as the CRISPR / Cas9 method.

[0030] Gene editing of the coding gene via CRISPR / Cas9 can be performed using an editing vector (e.g., Cas9-encoding sgRNA that can be transcribed to target the coding gene) pBUE413-TaVRN1 The target plant is obtained by importing the gene into the plant and screening to obtain the gene encoding the target plant.

[0031] In one embodiment of the present invention, the target plant is KO#1, KO#2, KO#3 and KO#4; KO#1 has an A inserted between positions 221-222 of SEQ ID No.1; KO#2 has an A inserted between positions 212-213 of SEQ ID No.4; KO#3 has an A inserted between positions 275-276 of SEQ ID No.7; KO#4 has a T inserted between positions 221-222 of SEQ ID No.1, omits the C at position 212 of SEQ ID No.4, and has an A inserted between positions 275-276 of SEQ ID No.7.

[0032] The recombinant expression vector and the editing vector can be introduced into plant cells using conventional biotechnological methods such as Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp.411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition)).

[0033] The target plant is understood to include not only first-generation plants containing the TaVRN1 protein or its encoding gene that have been altered, but also their progeny. For the target plant, the gene can be propagated within the species, or it can be transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. The target plant includes seeds, callus tissue, intact plants, and cells.

[0034] In this invention, the plant may be M1, M2, or M3: M1) monocotyledonous plant; M2) grass; M3) wheat.

[0035] TaVRN1 or substances that regulate the content or activity of TaVRN1 are also within the scope of protection of this invention.

[0036] Experiments have demonstrated that the TaVRN1 protein and its encoding gene can regulate the heading period and plant height of plants: overexpression of the TaVRN1 gene can shorten the heading period and increase plant height; knockout of the TaVRN1 gene can prolong the heading period and decrease plant height. This indicates that the TaVRN1 protein and its encoding gene can be used to regulate the heading period and plant height of plants. The agronomically altered plants produced by this invention can serve as breeding resources, accelerating the breeding process of plants with shortened heading periods and reduced plant height. The agronomically altered plants produced by this invention can be used to study which genes participate in the response to heading period and plant height after TaVRN1 gene overexpression or silencing. This invention provides new germplasm resources for genetic breeding work, provides new materials for plant variety selection, and plays a positive role in accelerating the improvement of plant varieties.

[0037] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0038] Figure 1 for TaVRN1 Gene knockout overexpression and phenotypic identification results. Figure A shows... TaVRN1 Schematic diagram of gene structure and sgRNA target sites TaVRN1 Genotypes of the gene in the KO#1, KO#2, KO#3, and KO#4 lines. Red letters indicate PAM sites, blue letters indicate mutations, "+" indicates nucleotide insertion, and black dashed lines indicate nucleotide deletions. The number of inserted and deleted bases is shown on the right. Figures BC show wild-type Fielder and... TaVRN1 Phenotypic and statistical analysis of heading time of gene knockout lines KO#1, KO#2, KO#3, and KO#4, Bar = 15 cm. Figure DE shows wild-type Fielder and... TaVRN1 Phenotypic and statistical analysis of plant height in gene knockout lines KO#1, KO#2, KO#3, and KO#4 (Bar = 15 cm). Figures F and G show wild-type Fielder and... TaVRN1 Heading time phenotype and statistics of overexpressing lines #1 and #2, Bar = 20 cm. Figure HI represents wild-type Fielder and... TaVRN1 Plant height phenotype and statistics of gene overexpression lines #1 and #2, Bar = 20 cm. In Figure FI, #1 and #2 represent OE-1 and OE-2, respectively. Error bars represent standard deviation (SD). * indicates significance analysis. P <0.05, ** indicates statistical significance analysis. P<0.01, *** indicates statistical significance analysis P <0.001, Student's t test. Detailed Implementation

[0039] The following examples illustrate the A, B, and D genomes of the wheat variety Fielder. TaVRN1 Genes (referred to as) TaVRN1-5A Gene, TaVRN1-5B Gene, TaVRN1-5D Gene editing was performed on a wheat fielder (specifically, a gene), resulting in delayed heading and maturity dates and reduced plant height in the edited plants compared to Fielder plants. Overexpression of this gene was performed in Fielder wheat. TaVRN1-5A The gene shortens the heading period and increases plant height.

[0040] In Fielder, TaVRN1-5A The genome sequence of the gene is shown in SEQ ID No. 1, and the CDS sequence is shown in SEQ ID No. 2, encoding the TaVRN1-5A protein shown in SEQ ID No. 3; TaVRN1-5B The genome sequence of the gene is shown in SEQ ID No. 4 (N in SEQ ID No. 4 represents an undetermined nucleotide), and the CDS sequence is shown in SEQ ID No. 5, encoding the TaVRN1-5B protein shown in SEQ ID No. 6; TaVRN1-5D The genome sequence of the gene is shown in SEQ ID No. 7, and the CDS sequence is shown in SEQ ID No. 8, encoding the TaVRN1-5D protein shown in SEQ ID No. 9.

[0041] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are all commercially available. All quantitative experiments in the following examples were performed in at least three replicates, and the results were averaged. Unless otherwise specified, in the following examples, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.

[0042] The CRISPR / Cas9 gene editing vector pBUE413 in the following examples is described in the literature "Wang Zhiping (2017) Doctoral Dissertation, Creation and Functional Verification of Plant Genome and Base Editing Toolkit, Doctoral Dissertation of China Agricultural University, pp. 40-41. 2017". It can be obtained by the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences. This biological material is only used to repeat the relevant experiments of this invention and should not be used for other purposes.

[0043] In the following embodiments Bsa I-endonuclease and T4 ligase are products of NEB, with catalog numbers R3535 and M0202V, respectively.

[0044] Example 1, Overexpression TaVRN1-5A Genetically modified wheat can regulate the heading date and plant height of wheat, and increase wheat yield. I. Building using Infusion technology TaVRN1-5A Gene overexpression vector Using restriction endonucleases BamHⅠ and SpeⅠ Enzyme digestion pWMB110 The vector is obtained by ligating the target fragment with the adapter into the vector backbone fragment using In-Fusion enzyme, and the resulting recombinant vector is the vector. TaVRN1 Gene overexpression vector. The specific steps are as follows: (a) PCR amplification Using wheat Fielder cDNA as a template, pWMB110-TaVRN1-5A-BamHⅠ-Fw / pWMB110- TaVRN1-5A-SpeI-Rv PCR amplification was performed using primers to obtain PCR amplification products (the underlined sequence is the In-Fusion adapter sequence).

[0045] pWMB110-TaVRN1-5A-BamHⅠ-Fw :5′- AGGTCGACTCTAGAGGATCC ATGGGGCGGGGGAAGG -3′; pWMB110-TaVRN1-5A-SpeI-Rv :5′- ATGAATTCCGGCTCGAGACTAGT CCCGTTGATGTGGCTC-3′; (ii) Plasmid digestion Using restriction endonucleases BamHⅠ and SpeI Enzyme digestion pWMB110 The carrier was used to obtain the carrier skeleton fragment.

[0046] (III) In-Fusion enzyme ligation The PCR amplification product obtained in step (I) was ligated into the vector backbone fragment obtained in step (II) using In-Fusion enzyme. The resulting recombinant vector with the correct sequence was denoted as […]. pWMB110::TaVRN1-5A This recombinant vector can express the fusion protein formed by the TaVRN1-5A protein shown in SEQ ID No. 3 and a 3×flag tag. TaVRN1-5A Gene expression is driven by the maize ubiquitin promoter (Ubi).

[0047] II. Obtaining Recombinant Agrobacterium The above recombinant plasmid pWMB110::TaVRN1-5A The bacteria were introduced into Agrobacterium EHA105 to obtain recombinant strain EHA105 / pWMB110::TaVRN1-5A .

[0048] III. Obtaining T0 generation transgenic wheat Using wheatfield (Fielder) as the recipient plant, Agrobacterium-mediated genetic transformation was performed using the recombinant strain EHA105 / obtained in step two. pWMB110::TaVRN1-5A Genetic transformation was performed, resulting in 22 T0 generation transgenic wheat plants.

[0049] IV. Identification of Transgenic Plants 1. Bar test strip identification The transgenic wheat obtained in step three was tested using PAT / Bar rapid test strips produced by Shanghai Youlong Biotechnology, and positive transgenic wheat varieties OE-1 and OE-2 were obtained through screening.

[0050] 2. Phenotypic identification The plants to be tested were T2 generation OE-1, OE-2 and wild-type wheat (Fielder), with no less than 8 individual plants selected from each line.

[0051] The plant height at the heading and maturity stages of wheat was statistically analyzed. The results showed that, compared to Fielder wheat, the heading stage of the positive transgenic wheat was 6–8 days earlier, significantly shorter than that of wild-type wheat, while the plant height was significantly taller. This indicates that... TaVRN1-5A Genes are involved in regulating the heading date and plant height of wheat.

[0052] Example 2, Wheat TaVRN1 Gene knockout can affect wheat plant height and heading date, and regulate wheat yield. This embodiment is performed in the Fielder context. TaVRN1 Three orthologous genes ( TaVRN1-5A , TaVRN1-5B and TaVRN1-5D CRISPR / Cas9-mediated gene editing was performed. TaVRN1 A target site was designed at the position of the first exon, and the sequence of the target site is: 5′-GATCGAGAACAAGATCAACCGG-3′ (i.e., positions 206-227 of SEQ ID No. 1, positions 197-218 of SEQ ID No. 4, and positions 260-281 of SEQ ID No. 7).

[0053] I. Recombinant plasmids pBUE413-TaVRN1 Construction 1. Using an intermediate carrier pCBC-MT1T2Using a template, PCR amplification was performed using a primer pair consisting of primer VRN1-MT1T2-F0: 5′-GGATCGAGAACAAGATCAACGTTTTAGAGCTAGAAATAGC-3′ and primer VRN1-MT1T2-R0: 5′-TGGTGGAGAAGATGATGAGCGCTTCTTGGTGCC-3′, and a DNA fragment of approximately 964 bp was recovered.

[0054] 2. Preparation of the enzyme digestion and ligation reaction system. The reaction system is 15 μL, consisting of 2 μL of the DNA fragment obtained from PCR amplification in step 1, and 2 μL of... pBUE413 Vector, 1.5 μL 10×NEB T4 Buffer, 1.5 μL 10×BSA, 1 μL restriction endonuclease Bsa The mixture consists of 1 μL of T4 DNA ligase and 6 μL of ddH2O.

[0055] 3. Take the reaction system prepared in step 2 and react (reaction program: 37℃ for 5 h, 50℃ for 5 min, 80℃ for 10 min). Then transform it into *E. coli* TOP10 competent cells, select positive clones, and send them to Beijing Qingke Xinyue Biotechnology Co., Ltd. for sequencing. The sequencing primers are pBUE413-SeqF: 5′-TTTCCCAGTCACGACGTTGT-3′ and pBUE413-SeqR: 5′-ATCTCTAGAGAGGGGCACGA-3′. The selected target site sequences were all correctly constructed. pBUE413 Positive clones on the vector, from which plasmids are extracted to obtain recombinant plasmids with the correct sequence, are denoted as... pBUE413-TaVRN1 . pBUE413-TaVRN1 Transcriptional targeting TaVRN1-5A , TaVRN1-5B and TaVRN1-5D It contains the sgRNA of the gene and can express the Cas protein.

[0056] II. Obtaining Recombinant Agrobacterium Recombinant plasmid pBUE413-TaVRN1 Recombinant Agrobacterium EHA105 was obtained by introducing it into Agrobacterium, and named EHA105 / pBUE413-TaVRN1 .

[0057] III. Obtaining T0 generation transgenic wheat Using wheat Fielder as the recipient plant, Agrobacterium-mediated genetic transformation was performed using the recombinant strain EHA105 / obtained in step two. pBUE413-TaVRN1 Genetic transformation was performed, resulting in 19 T0 generation transgenic wheat plants.

[0058] IV. Molecular and Phenotypic Identification of Mutations in Transgenic Wheat 1. PCR molecular identification Using the genomic DNA (gDNA) of the T0 generation transgenic wheat obtained in step three as a template, PCR amplification was performed to identify the gene-edited transgenic lines. The primers used are as follows: TaVRN1-5A Genes: F1A: 5′-TGGCCTGGCCATCCTCACCTCACG-3′; R1A: 5′-TCGCCAGCACCAACAAATATCACG-3′.

[0059] TaVRN1-5B Genes: F1B: 5′-CTTCCGCCTCACCCAACCACCT-3′; R1B: 5′-GGTATTGTAGCGTCTAGTAAGATTCT-3′.

[0060] TaVRN1-5D Genes: F1D: 5′-TCTCGCCTTCCATTCCATTTC-3′; R1D: 5′-TTTGATGAGGCAGACAACCA-3′.

[0061] 2. The PCR amplification products were recovered and purified, and sent to Beijing Qingke Xinyue Biotechnology Co., Ltd. for sequencing.

[0062] 3. Use SeqMan to analyze the sequencing results and count the mutation types.

[0063] 4. Phenotypic identification of genetically modified wheat Nineteen individual plants were obtained from the T0 generation, all of which had homozygous or biallelic heterozygous mutations. Sequencing and phenotypic identification in the T1 generation showed that lines with different mutations at the target site all exhibited a late-heading phenotype. Sequencing and phenotypic identification were performed on homozygous lines with different mutation types in the T2 generation.

[0064] PCR identification of lines with different mutations at the target site yielded positive plants, i.e. TaVRN1 Edit the plant. For a given T1 generation plant, if all T2 generation plants obtained by self-pollination from this plant test positive by PCR, then the plant is homozygous. TaVRN1 Edit the plant; the plant and its descendants constitute one plant. TaVRN1 Edit the strain.

[0065] After the above identification experiments, four were obtained. TaVRN1 Edit the homozygous wheat line KO#1 、 KO#2 、 KO#3 and KO#4 ( Figure 1 (A)

[0066] KO#1 is Figure 1 middle vrn1-aa The editing process is as follows: For TaVRN1-5A The gene has an A inserted between positions 221-222 of SEQ ID No. 1, and TaVRN1-5B , TaVRN1-5D The genome was not edited.

[0067] KO#2 is Figure 1 middle vrn1-bb The editing process is as follows: For TaVRN1-5B The gene has an A inserted between positions 212 and 213 of SEQ ID No. 4, and TaVRN1-5A , TaVRN1-5D The genome was not edited.

[0068] KO#3 is Figure 1 middle vrn1-dd The editing process is as follows: For TaVRN1-5D The gene has an A inserted between positions 275 and 276 of SEQ ID No. 7, and TaVRN1-5A , TaVRN1-5B The genome was not edited.

[0069] KO#4 is Figure 1 middle vrn1-aabbdd The editing process is as follows: For TaVRN1-5A The gene, with a T inserted between positions 221-222 of SEQ ID No. 1; for TaVRN1-5B The gene is missing C at position 212 of SEQ ID No. 4; for TaVRN1- 5D The gene, A, is inserted between positions 275 and 276 of SEQ ID No. 7.

[0070] The T1 and T2 generation plants in the control group underwent the above molecular identification, and the results were all negative.

[0071] Compared to wheat Fielder, vrn1-aa , vrn1-bb , vrn1-dd and vrn1-aabbdd The heading period of both plants increased significantly, while the plant height decreased significantly. This indicates that... TaVRN1-5A , TaVRN1-5B , TaVRN1-5D All genes are involved in regulating the heading period and plant height of wheat.

[0072] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. At least one of the following applications of TaVRN1-5A protein: Y1) Shorten the wheat heading period; Y2) Prepare products that shorten the wheat heading period; Y3) Breed wheat with a shortened heading period; Y4) Increase wheat plant height; Y5) Prepare products that increase wheat plant height; Y6) Breeding wheat with increased plant height; The TaVRN1-5A protein is either A1 or A2 as follows: A1) The amino acid sequence of this protein is SEQ ID No. 3; A2) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1).

2. At least one of the following applications of substances that regulate protein content: Y1) Regulates the wheat heading stage; Y2) Prepare products that regulate the heading stage of wheat; Y3) Breed wheat with altered heading period; Y4) regulates wheat plant height; Y5) Prepare products that regulate wheat plant height; Y6) Breeding wheat with altered plant height; The protein is TaVRN1-5A protein, TaVRN1-5B protein and / or TaVRN1-5D protein; The TaVRN1-5A protein is either A1 or A2 as follows: A1) The amino acid sequence of this protein is SEQ ID No. 3; A2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1); The TaVRN1-5B protein is either B1 or B2). B1) The amino acid sequence of this protein is that of SEQ ID No. 6; B2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of B1); The TaVRN1-5D protein is either C1 or C2 as follows: C1) The amino acid sequence of this protein is that of SEQ ID No. 9; C2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of C1); The substance regulating protein content is a substance that increases the TaVRN1-5A protein content; the regulation of wheat heading period is to shorten the wheat heading period; the cultivation of wheat with altered heading period is to cultivate wheat with a shortened heading period; the regulation of wheat plant height is to increase the wheat plant height; the cultivation of wheat with altered plant height is to cultivate wheat with increased plant height; the substance increasing the TaVRN1-5A protein content is any one of D1) to D4). D1) The nucleic acid molecule encoding the TaVRN1-5A protein; D2) An expression cassette containing the nucleic acid molecules described in D1); D3) A recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2); D4) Recombinant microorganisms containing the nucleic acid molecules described in D1), or recombinant microorganisms containing the expression cassette described in D2), or recombinant microorganisms containing the recombinant vector described in D3); The substance regulating protein content is a substance that reduces the protein content; the regulation of wheat heading period is to prolong the wheat heading period; the cultivation of wheat with altered heading period is to cultivate wheat with a prolonged heading period; the regulation of wheat plant height is to reduce the wheat plant height; the cultivation of wheat with altered plant height is to cultivate wheat with a reduced plant height; the substance reducing the protein content is any one of D5)-D10). D5) Nucleic acid molecules that reduce the content of the TaVRN1-5A protein; D6) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues or transgenic plant organs containing the nucleic acid molecules described in D5); D7) Nucleic acid molecules that reduce the content of the TaVRN1-5B protein; D8) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in D7); D9) Nucleic acid molecules that reduce the content of the TaVRN1-5D protein; D10) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in D9).

3. The application according to claim 2, characterized in that: D1) The nucleic acid molecule described is a DNA molecule whose coding sequence is SEQ ID No. 2 in the sequence listing.

4. Any of the following methods: X1) Methods to shorten the wheat heading period and / or increase wheat plant height include: Increasing the content of TaVRN1-5A protein as described in claim 1 can shorten the heading period of wheat and / or increase plant height; X2) A method for cultivating wheat with a shortened heading period and / or increased plant height, comprising: increasing the content of TaVRN1-5A protein as described in claim 1 to obtain wheat with a shortened heading period and / or increased plant height; X3) A method for prolonging the heading period of wheat and / or reducing the plant height of wheat, comprising: reducing the content of the protein described in claim 2 in wheat, or knocking out the coding gene of the protein described in claim 2 in wheat, or reducing the expression level of the coding gene of the protein described in claim 2 in wheat, thereby prolonging the heading period of wheat and / or reducing the plant height. X4) A method for cultivating wheat with extended heading period and / or reduced plant height, comprising: reducing the content of the protein described in claim 2 in wheat, or knocking out the coding gene of the protein described in claim 2 in wheat, or reducing the expression level of the coding gene of the protein described in claim 2 in wheat, to obtain wheat with extended heading period and / or reduced plant height.

5. The method according to claim 4, characterized in that: The methods described in X1) and X2) are achieved by introducing the gene encoding the TaVRN1-5A protein into the wheat and expressing the gene. The methods described in X3) and X4) are achieved by inhibiting the expression of the gene encoding the protein in the wheat, or by knocking out the gene encoding the protein in the wheat.

6. The method according to claim 5, characterized in that: The methods described in X3) and X4) are implemented by editing the gene encoding the protein.

Citation Information

Patent Citations

  • Plants having enhanced yield-related traits and a method for making the same

    CN103773796A