SNP marker for identifying salt tolerance of grass carp and application thereof

Abstract

The application belongs to the technical field of molecular biology, discloses a SNP marker for identifying the salt tolerance of grass carp and application thereof, and specifically discloses a molecular marker related to the salt tolerance of grass carp, characterized in that the sequence of the SNP molecular marker is shown as SEQ ID NO:1, the SNP site is located at the 3503th position from the 5' end of the sequence shown as SEQ ID NO:1, and the polymorphism is T / C. The application provides a SNP marker of grass carp, through detection of the SNP marker, salt-tolerant grass carp parents with excellent salt tolerance can be effectively selected under the same breeding conditions, and the SNP marker can be effectively used for molecular marker assisted breeding of grass carp. Furthermore, grass carp parents can be genotyped according to actual breeding requirements, suitable genotype grass carp parents are selected for breeding, and grass carp offspring (fish fry) with high salt tolerance can be obtained, breeding time is saved, cost is low, accuracy is high, and the breeding process of grass carp is accelerated.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to an SNP marker for identifying the salt tolerance of grass carp and its application. Background Technology

[0002] grass carp( Ctenopharyngodon idellus Grass carp is an important freshwater economic fish in my country, possessing advantages such as rapid growth, strong adaptability, and high feed conversion efficiency. Its annual production has long ranked first among freshwater aquaculture fish, making it a core species for ensuring the supply of high-quality protein to residents and promoting rural economic development. As a typical freshwater fish, grass carp's physiological and metabolic mechanisms are highly sensitive to saline-alkali environments. Long-term exposure to high-salinity (salinity > 5‰) or high-pH water can lead to osmotic imbalance, growth inhibition, and even death, severely limiting the effective utilization of saline-alkali land resources.

[0003] To overcome this bottleneck, molecular marker-assisted breeding technology has become a key research direction. Currently, commonly used molecular markers include single nucleotide polymorphisms (SNPs), simple sequence repeats (SSRs), and insertions / deletions (Indels). Among these, SNP markers have become the preferred tool for elucidating the genetic mechanisms of complex traits due to their advantages such as high distribution density, high detection throughput, high degree of automation in genotyping, and low cost. Through genome-wide association studies (GWAS) or selective clearance analysis, SNP sites associated with salt tolerance can be precisely screened, such as those regulating ion transport proteins (e.g., Na+). + / K + Functional variations in ATPases or osmotic pressure regulating genes (such as AQP3). Genotypic selection technology based on SNP markers can rapidly identify salt-tolerant candidate individuals. Combined with family breeding or genomic selection (GS) strategies, salt-tolerant dominant alleles can be selectively aggregated to breed new salt-tolerant grass carp varieties. Summary of the Invention

[0004] This invention utilizes molecular genetics and molecular biology methods to obtain SNP molecular markers related to the salt tolerance of grass carp. These SNP molecular markers can quickly distinguish the salt tolerance of grass carp with high accuracy, providing a reliable basis for the breeding and improvement of new salt-tolerant grass carp varieties.

[0005] The first objective of this invention is to provide SNP molecular markers related to the salt tolerance of grass carp.

[0006] A second aspect of the present invention is to provide a primer set for amplifying the SNP molecular markers of the first aspect of the present invention.

[0007] A third aspect of the present invention is to provide a reagent kit.

[0008] The fourth aspect of this invention aims to provide applications of the SNP molecular markers of the first aspect of this invention, the primer sets of the second aspect of this invention, and / or the kits of the third aspect of this invention.

[0009] The fifth aspect of this invention aims to provide a method for screening salt-tolerant grass carp.

[0010] The sixth aspect of this invention aims to provide the application of the method of the fifth aspect of this invention in the breeding of salt-tolerant grass carp.

[0011] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a molecular marker related to the salt tolerance of grass carp, wherein the sequence of the SNP molecular marker is shown in SEQ ID NO:1, the SNP site is located at position 3503 from the 5' end of the sequence shown in SEQ ID NO:1, and its polymorphism is T / C.

[0012] In some embodiments of the present invention, when the genotype of the SNP locus is CT, it is a grass carp with strong salt tolerance, and when the genotype of the SNP locus is CC, it is a grass carp with weak salt tolerance.

[0013] A second aspect of the present invention provides a primer set for amplifying the SNP molecular markers of the first aspect of the present invention.

[0014] In some embodiments of the present invention, the primer set is primer set 1 or primer set 2. The nucleotide sequence of primer set 1 is shown below: P1: 5'-AAACAAACTGGCTCCCAGAG-3' (SEQ ID NO: 2); P2: 5'-GGAACTAGTGGAAGTGGTTG-3' (SEQ ID NO: 3); The nucleotide sequence of primer set 2 is shown below. P3: 5'-GCCAACCTTGTGTGTTTGTC-3' (SEQ ID NO: 4); P4: 5'-TTGTCACACGCTGTGCTTTG-3' (SEQ ID NO: 5); P5: 5'-ctgactgactCATCTTCTCTCAGTTTATATG-3' (SEQ ID NO: 6).

[0015] A third aspect of the present invention is to provide a kit comprising the primer set of the second aspect of the present invention.

[0016] In some embodiments of the present invention, the kit further includes a buffer used in PCR.

[0017] In some embodiments of the present invention, the buffer used in the PCR is any reagent required for PCR amplification, such as DNA polymerase, dNTPs, etc. taq Enzymes, MgCl2, etc.

[0018] In some embodiments of the present invention, the kit further includes SAP, ExoI, and reagents for single-base extension reactions (such as SNaPshot Mix).

[0019] In a fourth aspect of the present invention, the SNP molecular marker of the first aspect of the present invention, the primer set of the second aspect of the present invention, and / or the kit of the third aspect of the present invention are provided for use in any one of (1) to (5): (1) Assisted breeding or selection of salt-tolerant grass carp; (2) To prepare products for auxiliary breeding or breeding of salt-tolerant grass carp; (3) Identify the salt tolerance of grass carp; (4) Prepare products for identifying the salt tolerance of grass carp; (5) Management and development of grass carp germplasm resources.

[0020] In some embodiments of the present invention, the breeding is to screen for grass carp with excellent salt tolerance.

[0021] A fifth aspect of the present invention provides a method for screening salt-tolerant grass carp, wherein the salt tolerance of the grass carp is determined by detecting the genotype of the SNP molecular marker of the first aspect of the present invention in the genome of the grass carp to be tested, based on the genotype.

[0022] In some embodiments of the present invention, the method includes the following steps: using grass carp DNA as a template, performing PCR amplification using primer set 1 of the second aspect of the present invention or the kit of the third aspect of the present invention to obtain PCR amplification products; performing sequencing analysis on the PCR amplification products to determine the genes of the SNP molecular markers of the first aspect of the present invention in the genome of the grass carp to be tested; or The method includes the following steps: using grass carp DNA to be tested as a template, performing PCR amplification using P3 and P4 in the second aspect of the present invention to obtain PCR amplification products; The PCR amplification product was treated with alkaline phosphatase to obtain product A; Product A was subjected to a single-base extension reaction using P5. After the reaction was completed, sequencing analysis was performed to identify the SNP molecular marker gene of the first aspect of the present invention in the genome of the grass carp to be tested.

[0023] In some embodiments of the present invention, the DNA of the grass carp can be extracted using conventional methods in this technical field, including the phenol-chloroform method and various DNA extraction kits.

[0024] In some embodiments of the present invention, the PCR amplification reaction program is as follows: pre-denaturation at 90–94°C for 3–6 min; denaturation at 90–94°C for 20–35 s, annealing at 56–60°C for 30–35 s, extension at 70–72°C for 20–30 s, for 35–37 cycles; and extension at 70–72°C for 3–12 min.

[0025] In some embodiments of the present invention, the alkaline phosphatase treatment includes mixing the PCR amplification product with SAP Mix and reacting it in a PCR instrument. The reaction program is 35-37°C for 35-40 min; 80-85°C for 12-16 min; 4°C for ∞.

[0026] In some embodiments of the present invention, the single-base extension reaction includes the following steps: mixing products A and P5 with SNaPshot Mix, reacting in a PCR instrument, and the reaction program is as follows: pre-denaturation at 94-96℃ for 25-30s; denaturation at 94-96℃ for 2-5s, annealing at 50-52℃ for 3-5s, extension at 60-62℃ for 2-3min, for 35-37 cycles; extension at 70-72℃ for 3-5min; and extension at 15-17℃ for 1-2min.

[0027] In some embodiments of the present invention, the method for sequencing the PCR amplification products is not particularly limited, as long as the sequence of the PCR amplification product, i.e., the fragment containing the SNP marker, can be effectively obtained. The PCR amplification products can be detected using at least one method selected from first-generation gene sequencing, second-generation high-throughput gene sequencing, or third-generation high-throughput gene sequencing, or any other feasible method for determining the genotype. Thus, the genotype results can be obtained rapidly, efficiently, and accurately.

[0028] A sixth aspect of the present invention provides the application of the method of the fifth aspect of the present invention in the breeding of salt-tolerant grass carp.

[0029] The beneficial effects of this invention are: This invention provides a SNP marker for grass carp. By detecting this SNP marker, grass carp broodstock with excellent salt tolerance can be effectively selected under the same farming conditions, making it effective for marker-assisted breeding of grass carp. Furthermore, it allows for genotyping of grass carp broodstock according to actual breeding needs, enabling the selection of suitable genotypes for reproduction, resulting in grass carp offspring (fry) with high salt tolerance. This saves breeding time, is cost-effective, highly accurate, accelerates the grass carp breeding process, and increases the economic benefits of grass carp farming in saline-alkali environments.

[0030] Using high-salt conditions to select grass carp with excellent salt tolerance may cause irreversible damage to the grass carp and reduce their reproductive performance. This invention can directly select grass carp parents with excellent salt tolerance through SNP molecular markers, which greatly reduces the breeding cost of new salt-tolerant grass carp varieties. Attached Figure Description

[0031] Figure 1 The expression level of the NKCC1 gene in the gills of grass carp in the control group, sensitive group, and tolerant group is shown. Detailed Implementation

[0032] The present invention will be further described in detail below through specific embodiments.

[0033] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0034] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0035] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0036] Example 1: Obtaining the major gene (NKCC1 gene) of salt-tolerant grass carp and screening candidate SNPs. (a) Candidate gene identification (1) Obtaining experimental materials for salt-tolerant and sensitive grass carp populations 1200 fast-growing grass carp (average weight 10 grams) bred by the Pearl River Fisheries Research Institute were selected as experimental fish. Two aquariums were used as the control group and the experimental group, respectively. Before the experiment, the experimental fish were transferred to the aquariums and acclimatized for 12 hours, with 600 grass carp in each aquarium. No feed was given during this period. After the acclimatization period, the salinity of the experimental group was adjusted to 12 ppt at a rate of 3 ppt every two hours. After the salinity reached 12 ppt, the fish were observed every four hours, dead fish were removed promptly, the cumulative survival time was recorded, and the tail fins were collected, soaked in anhydrous ethanol, and stored at 4°C for later use. The first 150 fish to die and the last 150 fish to die were considered the salt-sensitive group and the salt-tolerant group, respectively. At the same time, during sample collection, gill tissues were collected from the control group, the salt-sensitive group (fish near death), and the salt-tolerant group (fish that survived to the end in relatively good condition) and stored at -80°C.

[0037] (2) Obtaining NKCC1 candidate genes Primers for the NKCC1 gene were designed (F: AAGCGTGCTGCCATGTTGAAA (SEQ ID NO:7); R: CCGGCTGAGTACTGAGAGTT (SEQ ID NO:8)) to obtain the expression levels of the NKCC1 gene in the gills of grass carp in the control group, sensitive group, and salt-tolerant group.

[0038] The results showed that the expression level of the NKCC1 gene in the tolerant group was 1.93 times that in the sensitive group, identifying the NKCC1 gene as an important candidate gene. Figure 1 ).

[0039] (II) Identification of candidate SNP molecular markers related to salt tolerance in grass carp Twenty grass carp tail fins (10 salt-tolerant and 10 non-salt-tolerant) were randomly selected as experimental materials. Genomic DNA was extracted from the fin rays using a marine animal tissue genomic DNA extraction kit (Tiangen). The quality of the genomic DNA was assessed by 1.0% agarose gel electrophoresis, and the concentration was determined using a UV spectrophotometer (Eppendorf, AG2231). The samples were stored at -20℃ for later use. Based on the NKCC1 gene annotation, the sequence covering the NKCC1 gene transcript (SEQ ID NO:1) was extracted as a template to design primers (P1: 5'-TCACCATTAATTGCTTTTTG-3' (SEQ ID NO:2); P2: 5'-ACAGTAATCCAGATTGTTAGTGG-3' (SEQ ID NO:3)). PCR amplification was performed on 20 grass carp. The PCR amplification reaction system consisted of: 1 μL DNA, 20 μL Mix, 1.5 μL of primer P1, 1.5 μL of primer P2, and H2O to a final volume of 40 μL. The PCR amplification program was: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; and 72℃ extension for 10 min. The amplified products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, and the SNP sites and peak patterns of the sequencing results were statistically analyzed.

[0040] The results showed that a SNP existed at base 3503 of the nucleotide sequence (SEQ ID NO:1) of the grass carp NKCC1 gene transcript. This SNP contained three genotypes: TT, TC, and CC. Among the 20 grass carp, the CC genotype accounted for 30%, the TC genotype for 60%, and the TT genotype for 10%. All salt-tolerant grass carp had the TC genotype, while among the non-salt-tolerant grass carp, 6 had the CC genotype, 2 had the TT genotype, and 2 had the TC genotype.

[0041]

[0042] Example 2: Development of a SNP marker for identifying salt tolerance in grass carp The SNP sites and salt tolerance in Example 1 were analyzed using the SNaPshot method, including the following steps: (a) Primer sequence Based on the partial genomic sequence of the grass carp NKCC1 gene shown in SEQ ID NO:1, SNaPshot extension primers were designed, and the primer sequences are as follows: P3: 5'-GCCAACCTTGTGTGTTTGTC-3' (SEQ ID NO: 4); P4: 5'-TTGTCACACGCTGTGCTTTG-3' (SEQ ID NO: 5); P5: 5'-ctgactgactCATCTTCTCTCAGTTTATATG-3' (SEQ ID NO: 6).

[0043] (ii) Extracting genomic DNA from the tail fin rays of the experimental fish. Approximately 0.5 × 0.5 cm of the caudal fin was cut from grass carp using scissors sterilized with alcohol and stored in anhydrous ethanol at room temperature. Genomic DNA was extracted from the fin rays using a marine animal tissue genomic DNA extraction kit (Tiangen). The quality of the genomic DNA was assessed by 1.0% agarose gel electrophoresis, and the concentration was measured using a UV spectrophotometer (Eppendorf, AG2231). The sample was stored at -20℃ for later use.

[0044] (III) Subtyping Experiment (1) PCR amplification reaction 1) Prepare the PCR master mix in a 1.5 mL EP tube and centrifuge at low speed with shaking.

[0045] 2) Using an 8-channel pipette, add 9 μL of PCR master mix to each well of a 384-well plate, followed by 1 μL of template DNA (20 ng / μL). Mix well, carefully cover the wells with the 384-well sealing film, and press firmly to prevent evaporation during the PCR program. Centrifuge at 1000 rpm for 1 min. The PCR reaction system is shown in Table 1.

[0046] Table 1 PCR reaction system

[0047] 3) Set up the PCR amplification reaction program. Place the PCR reaction plate on the PCR instrument and start the program. The reaction program is shown in Table 2.

[0048] Table 2 PCR reaction procedure

[0049] (2) Treatment of product alkaline phosphatase After the PCR reaction, the PCR products were treated with SAP (shrimp alkaline phosphatase and shrimp alkaline phosphatase, catalog number 783901000UN) to remove free dNTPs from the system. Details are as follows: Prepare the alkaline phosphatase treatment reaction solution (i.e., SAP mix) in a new 1.5 mL EP tube. The SAP mix reaction components are shown in Table 3. Add the SAP mix to a 384-well PCR plate. For each alkaline phosphatase treatment well, the total reaction volume is 6 μL, including 4 μL of PCR product and 2 μL of SAP mix. After pipetting, carefully cover the 384-well sealing film and press firmly on each well to prevent evaporation during the PCR program. Centrifuge and then transfer to the PCR instrument. Set the SAP reaction program: 37℃ for 40 min; 85℃ for 15 min; 4℃ ∞. Start the program. Table 3 SAP Mix

[0050] (3) Single base extension reaction After alkaline phosphatase treatment, a single-base extension reaction was performed. The total reaction volume was 5 μL, prepared according to Table 4. After pipetting, the 384-well sealing film was carefully applied and each well was pressed firmly to prevent evaporation during the PCR program. After centrifugation, the plate was placed in a PCR instrument for the reaction program as shown in Table 4.

[0051] Table 4. Single-base extension reaction system and reaction procedure

[0052] (4) Sequencing Take 2 μL of SNaPshot reaction product and add it to 8 μL of deionized formamide containing 0.8% LIZ120. Denature at 95 °C for 5 min, then quench at -20 °C, and then sequence at 3730 xL.

[0053] (5) Reading genotypes The raw data in .fsa format was exported from the 3730xL instrument, classified and archived according to the detection reaction, and then imported into the GeneMarker analysis software for genotype data reading.

[0054] (iv) Results Analysis In this embodiment, a total of 100 salt-tolerant grass carp and 100 sensitive grass carp (obtained using the method in Example 1) were collected for genotyping. The SNaPshot SNP genotyping results were consistent with the sequencing results of the PCR products (i.e., PCR amplification of grass carp DNA using primers P1-P2). In the tolerant group, a total of 76 grass carp had the CT genotype, while in the sensitive group, only 20 grass carp had the CT genotype (Table 5). This indicates that the SNP site at position 3503 of the NKCC1 gene genome sequence SEQ ID NO:1 can provide a reliable basis for the identification of salt-tolerant grass carp. When the sample size is small, identification can be performed directly by sequencing the PCR products, which is fast and accurate. When the sample size is large, the SNaPshot method can be used to identify grass carp, which is low-cost and suitable for widespread use.

[0055] Table 5. SNaPshot SNP genotyping results

[0056] Example 3: Selection of Salt-Tolerant Grass Carp Because the grass carp used in the experiment were too small, intraperitoneal injection of electronic tags would severely reduce the survival rate and affect the experimental results. Therefore, in this example, the accuracy of the chi-square test was determined by detecting the gene frequencies of tolerant and intolerant grass carp. The specific experiment is as follows: I. Randomized Grass Carp Group Salt Tolerance Experiment 500 fast-growing grass carp bred by our unit were randomly selected for a salt tolerance experiment. The specific experimental procedure is shown in Example 1. In short, the grass carp were kept in an aquarium with a salinity of 12 ppt for 5 days (120 hours). The grass carp that died in the first 12 hours were considered to have poor salt tolerance, and the fish that were still alive after 120 hours were considered to have strong salt tolerance.

[0057] II. Genotyping The collected grass carp samples were genotyped using primers P1 and P2, and the genotyping method was the same as in Example 1.

[0058] III. Results Analysis At the end of the experiment, genotyping was performed on 30 tolerant and 30 intolerant grass carp. The results are shown in Table 6. The chi-square test showed that X-squared = 24.137 and p-value = 5.736e-06, indicating that this SNP has practical application value.

[0059] Table 6. Validation results of randomized population SNPs

[0060] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. A method for screening salt-tolerant grass carp, comprising detecting the genotype of SNP molecular markers in the genome of the grass carp to be tested, and determining the salt tolerance of the grass carp to be tested based on the genotype; The method includes the following steps: Using grass carp DNA as a template, PCR amplification was performed using P3 and P4 to obtain PCR amplification products. The PCR amplification product was treated with alkaline phosphatase to obtain product A; Product A was extended using P5. After the reaction was completed, sequencing analysis was performed to determine the genotype of the SNP molecular markers in the genome of the grass carp to be tested. The nucleotide sequence of P3 is 5'-GCCAACCTTGTGTGTTTGTC-3'; The nucleotide sequence of P4 is 5'-TTGTCACACGCTGTGCTTTG-3'; The nucleotide sequence of P5 is 5'-ctgactgactCATCTTCTCTCAGTTTATATG-3'; When the genotype of the SNP molecular marker is CT, it is a grass carp with strong salt tolerance; when the genotype of the SNP molecular marker is CC, it is a grass carp with weak salt tolerance.

2. The application of the method described in claim 1 in the breeding of salt-tolerant grass carp.

Images