Adenine deaminases, base editor fusion proteins comprising the same, and base editor systems and applications thereof

Abstract

The present application provides adenine deaminase, base editor fusion protein and base editor system comprising the same and application thereof. The adenine deaminase comprises one or more of the following sequences: (a) an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3; (b) an amino acid sequence having at least 80% identity with the amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3; (c) an amino acid sequence with 1 or more amino acid residues added to, substituted for, deleted from, or inserted into the amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3; or (d) an amino acid sequence encoded by a nucleotide sequence hybridizing to a polynucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO: 3 under stringent conditions. The adenine base editor system of the present application can effectively narrow the editing window while maintaining high editing activity; and keep a very low INDEL ratio, improving safety.

Description

Technical Field

[0001] This invention belongs to the field of gene editing, specifically relating to an adenine deaminase, an adenine base editor fusion protein containing the adenine deaminase, a base editor system, and their applications. Background Technology

[0002] Targeted editing of nucleic acid sequences, such as targeted cutting or editing of genomic DNA, is a promising method for gene function research and may also provide new treatments for human genetic diseases.

[0003] Currently, approximately 60% of known human genetic diseases are caused by single-base mutations. Of the 32,000 known pathogenic single-base mutations, the largest proportion is the G / C to A / T mutation, accounting for about 48%. The core components of currently available adenine base editors that convert A / T to G / C in genomic DNA all contain the TadA protein.

[0004] By fusing TadA (adenine deaminase) from *E. coli* with Cas9, and with the assistance of directed evolution and protein engineering, multiple rounds of evolution have resulted in the ABE series of adenine base editors capable of operating on DNA (e.g., ABE7.10 (Gaudelli NM, et al., Programmable baseediting of A·T to G·C in genomic DNA without DNA cleavage. *Nature*, 2017), ABE8.20 (Gaudelli NM, et al., Directed evolution of adenine base editors within created activity and therapeutic application. *Nat Biotechnol*, 2020, CN114072496 A), and ABE8e (Richter MF, et al., Phage-assisted evolution of an adenine base editor with improved Cas domain compatibility and...). The study also included the ABE8e mutant (CN115772512 A), which was generated by introducing one or two amino acid mutations. These TadA mutants showed very high amino acid sequence identity, with the largest difference from wild-type TadA being only 14 amino acid sites.

[0005] The field still needs to explore a larger protein space to obtain base editors with higher editing efficiency and specificity, as well as different editing window preferences, and to enrich the types of base editors to better meet the application needs of more indications. Summary of the Invention

[0006] Technical issues

[0007] The technical problem to be solved by this invention is to provide a novel, precise, and efficient adenine deaminase with a small editing window, an adenine base editor containing the adenine deaminase, and their applications. The adenine base editor of this invention can narrow the main editing window, maintain high editing efficiency, and has a low probability of insertion / deletion (INDEL) events, thus exhibiting high security.

[0008] Technical solution

[0009] On one hand, the present invention provides an adenine deaminase comprising one or more of the following sequences:

[0010] (a) An amino acid sequence as shown in SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3;

[0011] (b) An amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, and retaining the deamination activity of the amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3;

[0012] (c) An amino acid sequence in which one or more amino acid residues are added, substituted, deleted, or inserted in the amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, and which retains the deamination activity of the amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3; or,

[0013] (d) An amino acid sequence encoded by a nucleotide sequence, wherein the nucleotide sequence is hybridized under stringent conditions to a polynucleotide sequence encoding an amino acid sequence as shown in SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, and the amino acid sequence retains the deamination activity of the amino acid sequence as shown in SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, wherein the stringent conditions are moderately stringent, moderately-highly stringent, highly stringent, or very highly stringent.

[0014] In this invention, the expression "retaining deamination activity," such as "retaining deamination activity of the amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3," can mean that the adenine deaminase completely retains the deamination activity of the original sequence, or it can mean that the adenine deaminase partially retains the deamination activity of the original sequence, for example, retaining 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the deamination activity. In other embodiments, the adenine deaminase having the modified sequence may also have higher deamination activity than the adenine deaminase with the original sequence.

[0015] In this invention, “medium stringent conditions,” “medium-high stringent conditions,” “high stringent conditions,” or “very high stringent conditions” describe the conditions for nucleic acid hybridization and washing. For guidance on performing hybridization reactions, see Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1–6.3.6, which are incorporated herein by reference.

[0016] In some embodiments, the polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:1 is shown in SEQ ID NO:4, the polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:2 is shown in SEQ ID NO:5, and the polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:3 is shown in SEQ ID NO:6.

[0017] In some embodiments, the adenine deaminase may comprise an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3. In some embodiments, the adenine deaminase may comprise an amino acid sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or more mutations compared to the amino acid sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3. In some embodiments, compared to the amino acid sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, the adenine deaminase may contain at least 5, at least 10, at least 15, at least 20, at least 30, at least 40, or at least 50 identical consecutive amino acid residues. The aforementioned amino acid sequence may have the same or similar function or biological activity as the adenine deaminase.

[0018] The adenine deaminase provided by this invention can act on any polynucleotide, including DNA, RNA, and DNA-RNA hybrids. In some embodiments, the adenine deaminase can deaminate adenine (A), a target of a DNA-containing polynucleotide. In some embodiments, the adenine deaminase can deaminate adenine (A), a target of an RNA-containing polynucleotide.

[0019] On the other hand, the present invention provides an adenine base editor fusion protein comprising a nuclease and at least one adenine deaminase of the present invention.

[0020] In some embodiments, the adenine base editor fusion protein may further comprise a nuclear localization signal sequence. The nuclear localization signal sequence may be conventionally used in the art, for example, as shown in SEQ ID NO:7.

[0021] In some implementations, the nuclear localization signal sequence can be located at the N-terminus, C-terminus, or both ends of the base editor, or between the adenine deaminase and the nuclease. In some implementations, the nuclear localization signal sequence can be directly fused into the base editor, or fused into the base editor via a linker.

[0022] In some embodiments, the nuclease may be a Cas protein and its variants, as well as a protein such as TnpB.

[0023] In some embodiments, the Cas protein may be a Cas9 protein or a Cas12a protein, such as spCas9 from Saccharomyces cerevisiae, SaCas9 from Staphylococcus aureus, LbCas12a from Trichophytonceae bacteria, or enAsCas12a from Acidococcus spp. bacteria; the Cas protein variant may be VQRspCas9, VRERspCas9, spRY, spNG, SaCas9KKH, or SaCas9NG.

[0024] In some implementations, the Cas9 protein, i.e., the Cas9 nuclease, has a partially inactive DNA-cutting domain; that is, Cas9 is a cleavage enzyme, referred to as the "nCas9" protein. The nuclease-inactive Cas9 protein is interchangeably referred to as the "dCas9" protein. Methods for generating Cas9 proteins (or fragments thereof) with inactive DNA-cutting domains are known (see, e.g., Jinek et al., Science. 337:816821 (2012); Qi et al., "Repurposing CRISPR as an RNA Guided Platform for Sequence Specific Control of Genes"). Expression (2013) Cell.28; 152(5):117383, the entire contents of which are incorporated herein by reference. For example, the DNA cleavage domain of Cas9 is known to include two subdomains, the HNH nuclease subdomain and the RuvC1 subdomain. The HNH subdomain cleaves the strand complementary to the gRNA, while the RuvC1 subdomain cleaves the non-complementary strand. Mutations within these subdomains can silence the nuclease activity of Cas9. For example, the mutations D10A and H840A completely inactivate the nuclease activity of Streptococcus pyogenes Cas9 (Jinek et al., Science.337:816821(2012); Qi et al., Cell.28; 152(5):1173-83(2013)).

[0025] In some embodiments, the nucleotide sequence encoding the adenine base editor fusion protein may sequentially include a promoter-adenine deaminase-nuclease-polyadenylation signal (polyA), provided that it provides an editing efficiency similar to or not less than ABE8.20 (A>G); wherein the promoter and the polyA may be conventionally used in the art.

[0026] In some implementations, the promoter may be CMV, or other types of broad-spectrum promoters and tissue-specific promoters, such as CAG, PGK, EF1α; muscle-specific promoter Ctsk; liver-specific promoter Lp1, etc.

[0027] In some implementations, the polyA may be bovine growth hormone polyadenylation signal BGH polyA, or polyadenylation signals from other biological sources.

[0028] In another aspect, the present invention provides a polynucleotide that encodes the aforementioned adenine deaminase or the aforementioned adenine debase editor fusion protein.

[0029] In another aspect, the present invention provides a carrier comprising the aforementioned polynucleotides.

[0030] In some embodiments, the vector is a mammalian expression vector. In some embodiments, the expression vector may be one or more selected from adeno-associated virus, retroviral vector, adenovirus vector, lentiviral vector, Sendai virus vector, and herpesvirus vector.

[0031] In another aspect, the present invention provides a cell comprising one or more selected from the aforementioned adenine deaminase, the aforementioned adenine debase editor fusion protein, the aforementioned polynucleotide, and the aforementioned vector.

[0032] In some embodiments, the cell is a prokaryotic cell or a eukaryotic cell, for example, it may be a bacterial cell, a plant cell, an insect cell, a human cell, or a mammalian cell.

[0033] In another aspect, the present invention provides an adenine base editing system, comprising:

[0034] The aforementioned adenine deaminase; nuclease; and SgRNA, or

[0035] The aforementioned adenine base editor fusion protein; and SgRNA.

[0036] The description of nucleases is the same as above.

[0037] SgRNAs are used to accurately identify target gene sequences. Those skilled in the art can design rational and effective SgRNAs based on existing technologies and by selecting target regions through analysis of target gene information. The design of SgRNAs is not the innovation of this invention; therefore, it will not be described in detail to avoid obscuring the subject matter of this invention.

[0038] In some implementations, the SgRNA sequence is selected from the following sequences:

[0039] Site2-sense GAACACAAAGCATAGACTGC(SEQ ID NO:10) Site4-sense GTCATCTTAGTCATTACCTG(SEQ ID NO:11) Site8-sense GGTCGTAGCCAGTCCGAACCC(SEQ ID NO:12)

[0040] In another aspect, the present invention provides a pharmaceutical composition comprising one or more selected from the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned carrier, the aforementioned cell and the aforementioned adenine base editor system, and a pharmaceutically acceptable carrier.

[0041] In some embodiments, the pharmaceutically acceptable carrier may be a delivery carrier, such as a lipid, cationic lipid, or other polymer with drug delivery capabilities.

[0042] On the other hand, the present invention provides a kit comprising one or more selected from the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned vector, the aforementioned cells, and the aforementioned adenine base editor system.

[0043] In another aspect, the present invention provides a delivery system comprising one or more selected from the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned carrier, the aforementioned cell, and the aforementioned adenine base editor system; and a delivery medium.

[0044] In some implementations, the delivery medium may be nanoparticles, liposomes, exosomes, microvesicles, or cell-penetrating peptides, etc.

[0045] Furthermore, this invention provides a base editing method, which includes the following steps:

[0046] By expressing the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, or the aforementioned adenine base editing system in target cells, gene editing is achieved in the target cells under the guidance of SgRNA.

[0047] In some implementations, the target cell may refer to cells cultured in vitro or cells in vivo, examples of which include, but are not limited to, HEK293T cells, embryonic stem cells, T cells, etc.

[0048] In another aspect, the present invention provides the use of the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned vector, the aforementioned cell and the aforementioned adenine base editor system, the aforementioned pharmaceutical composition, the aforementioned kit or the aforementioned delivery system in the preparation of base editing drugs or tools.

[0049] In another aspect, the present invention provides the use of the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned vector, the aforementioned cell and the aforementioned adenine base editor system, the aforementioned pharmaceutical composition, the aforementioned kit or the aforementioned delivery system in the preparation of gene therapy drugs.

[0050] In another aspect, the present invention provides the use of the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned vector, the aforementioned cell and the aforementioned adenine base editor system, the aforementioned pharmaceutical composition, the aforementioned kit or the aforementioned delivery system in the construction of animal models and crop breeding.

[0051] Beneficial effects

[0052] The amino acid sequence of the adenine deaminase of this invention has low sequence similarity to that of existing adenine deaminases, greatly expanding the sequence diversity space of adenine deaminase and enriching the adenine base editor toolbox. The adenine base editor of this invention can effectively narrow the editing window while maintaining high editing activity; it also maintains a very low INDEL ratio, improving safety and promoting its application in precision medicine, animal disease model creation, crop genetics and breeding, etc., thus possessing great application value. Attached Figure Description

[0053] Figure 1 The image shows the ABE8.20-m plasmid.

[0054] Figure 2 This is a map of the pFYF1548 plasmid.

[0055] Figure 3 A comparison of the A>G base editing results achieved by various base editors at the endogenous target site2 site in HEK293T cells.

[0056] Figure 4 A comparison of the A>G base editing results achieved by various base editors at the endogenous target site4 site in HEK293T cells.

[0057] Figure 5 A comparison of the A>G base editing results achieved by various base editors at the endogenous target site8 site in HEK293T cells.

[0058] Figure 6 The results of A>G base editing achieved by the ABE10.3 base editor at the endogenous target site2 site in HEK293T cells were obtained. Detailed Implementation

[0059] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0060] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0061] The ABE8.20-m plasmid was purchased from addgene (Plasmid #136300), and its plasmid map can be found here. Figure 1 .

[0062] pFYF1548 plasmid was purchased from addgene (Plasmid #47508), and its plasmid map can be found here. Figure 2 .

[0063] pUC-GW-Amp plasmid was purchased from Anshengda.

[0064] The linearization primers used in the examples are shown in Table 1.

[0065] Table 1. ABE8.20-m linearization primers

[0066] ABE8-linear-for (forward primer) tctggtggttcttctggtggttctagcggca(SEQ ID NO:8) ABE8-linear-rev (reverse primer) ggtggcggctctccctatagtg(SEQ ID NO:9)

[0067] The SgRNA sequences used in the examples are shown in Table 2.

[0068] Table 2 SgRNA Sequence

[0069] Site2-sense GAACACAAAGCATAGACTGC(SEQ ID NO:10) Site4-sense GTCATCTTAGTCATTACCTG(SEQ ID NO:11) Site8-sense GGTCGTAGCCAGTCCGAACCC(SEQ ID NO:12)

[0070] The primers used for target identification in the examples are shown in Table 3.

[0071] Table 3. Primers for fragment amplification of SgRNA

[0072] Site2-for CCAGCCCCATCTGTCAAACT(SEQ ID NO:13) 20 Site2-rev TGAATGGATTCCTTGGAAACAATGA(SEQ ID NO:14) 25 Site4-for ACGTCTCATATGCCCCTTGG(SEQ ID NO:15) 20 Site4-rev ACGTAGGAATTTTGGTGGGACA(SEQ ID NO:16) 22 Site8-for GCTGCTGGAATACCGAGGAC(SEQ ID NO:17) 20 Site8-rev GCAACTCTCTTTTCTCCGGGA(SEQ ID NO:18) 21

[0073] Example 1

[0074] By replacing the TadA sequence in ABE8.20-m (hereinafter referred to as ABE8) with the new TadA sequences designed in this invention (SEQ ID NO:4 and SEQ ID NO:5 sequences, synthesized by Anshengda Company), new base editors are obtained, which are denoted as ABE10.1 and ABE10.2, respectively.

[0075] This embodiment was designed to compare the editing features of ABE8 with those of ABE10.1 and ABE10.2.

[0076] 1.1 Design and construction of ABE10.1 and ABE10.2 plasmids

[0077] 1) Preparation of insert fragments for homologous recombination

[0078] The pUC-GW-Amp plasmid containing a pre-designed fragment (SEQ ID NO:4 or SEQ ID NO:5) was synthesized by Anson Technology. The pre-designed fragments (SEQ ID NO:4 and SEQ ID NO:5) were amplified by PCR from the universal gene synthesis vector pUC-GW-Amp using the Novizan Phanta Max Super-Fidelity DNA Polymerase kit, and homologous arms were added for subsequent homologous recombination with the vector. The sequences of the homologous arms are: forward 5'-3' atacgactcactatagggagagccgccacc (SEQ ID NO:19), reverse 5'-3' tgccgctagaaccaccagaagaaccaccaga (SEQ ID NO:20).

[0079] The obtained PCR fragments were subjected to DNA electrophoresis, and the target fragment of about 500 bp was excised. Then, the fragments were purified by gel extraction using the TaKaRaMiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 to obtain the insert fragments for homologous recombination.

[0080] 2) Preparation of linearized base editing vectors

[0081] The ABE8.20-m vector ( was introduced using reverse PCR) Figure 1 The DNA fragments were linearized, exposing the ends of the homologous arms. Then, DNA electrophoresis was performed, the target fragment was excised, and purified using a gel to obtain the vector fragment for homologous recombination.

[0082] 3) Integration

[0083] Homologous recombination integration of the insert and vector fragments was performed using NEBbuilder HiFi DNA Assembly Master Mix, with a molar ratio of 1:10. The integration product was then transformed into trans-5α competent cells using full-gold chemiluminescence. The following day, 5-10 single clones were selected for Sanger sequencing identification. Clones that perfectly matched the designed sequence were amplified, and base editor plasmid DNA (i.e., ABE10.1 and ABE10.2 plasmids) was extracted for subsequent experiments.

[0084] 1.2 Construction of SgRNA expression vector (SgRNA plasmid)

[0085] Plasmid pFYF1548 was selected as the SgRNA expression backbone, and the original SgRNA was replaced with the target SgRNA. The downstream primer was GGTGTTTCGTCCTTTCCACAAG (SEQ ID NO:21), and the upstream primer was GTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC (SEQ ID NO:22) added to the 3' end of the SgRNA sequence corresponding to Site2-sense. The primers were phosphorylated at 5' using T4 PNK enzyme. Circular PCR was performed using the phosphorylated primers. To increase the number of positive clones, the PCR product was treated with DpnI enzyme, and the template plasmid was cleaved. After purification using a PCR clean-up kit, ligation was performed using T4 ligase. The ligation product was transformed into trans5 E. coli competent cells, plated, single clones were picked, cultured, and plasmid DNA was extracted and identified by Sanger sequencing. The SgRNA plasmid DNA that passed the sequencing alignment was used for subsequent experiments.

[0086] 1.3 Cell transfection

[0087] The ABE8.20-m, ABE10.1, and ABE10.2 plasmids were used as base editor plasmids and were used together with the above-mentioned SgRNA plasmids for cell transfection.

[0088] Day 1: Seed healthy HEK293T cells into 12-well plates, 7 x 10 cells per well. 4 Each cell was selected to ensure that the cell confluence was 40% by the time of the experiment the following day.

[0089] Day 2: Transfection was performed using lipo2000 reagent. The amount of transfection reagent used for each well was [amount missing].

[0090] Tube A: optiMEM 50μl+lipofectamine2000 5μl

[0091] Tube B: 50 μl of Opti-MEM + 1 μg DNA (0.5 μg base editor plasmid + 0.5 μg SgRNA plasmid)

[0092] Gently mix tubes A and B, let stand for 15 minutes, then evenly spot onto a 12-well plate and incubate for 6 hours. Observe the cell status during medium changes. Normally passage the cells on day 5, and collect the cells 72 hours after transfection.

[0093] 1.4 Genome extraction, target fragment amplification, and library preparation

[0094] 72 hours after cell transfection, genomic DNA was extracted from the cells using the Qiagen Tissue & Blood DNA Extraction Kit.

[0095] Amplicon libraries were then constructed using a two-step PCR method. The first PCR was used to extract the DNA fragment intended for editing. The Novizan Phanta Max Super-Fidelity DNA Polymerase kit was used, employing primers corresponding to the edited SgRNA (Table 3). Using the extracted cellular DNA as a template, PCR amplification was performed for 13 cycles to obtain the sequence near the editing site. The second PCR was used to add FastNGS adapter sequences to both ends. The forward primer added adapter read1 at the 5' end: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGA CAG-3' (SEQ ID NO:23), and the reverse primer added adapter read2 at the 5' end: 5'-GTCTCGTGGGCTCGG AGATGTGTATAAGAGACAG-3' (SEQ ID NO:24).

[0096] Using the product from the first reaction as a template, PCR amplification was performed for 13 cycles. Finally, the obtained PCR product was subjected to DNA electrophoresis, followed by gel recovery. The final product was sent to Keenon for high-throughput sequencing, with a sequencing depth of approximately 5000x.

[0097] 1.5 Next-Generation Sequencing Data Analysis and Statistics

[0098] Clean reads were obtained by removing adapter sequences using the trimmomatic program. Then, bowtie2 was used to match the paired-end reads to the hg38 genome. After the alignment file was converted to a new format using samtools, the sequencing depth and mutation information of each base position in the target region were calculated using the bam-readcount program. The mutation frequency and INDEL ratio were then statistically analyzed.

[0099] 1.6 Results Analysis

[0100] like Figure 3 As shown, the maximum editing activity site of ABE8 at site 2 is A5, and there are three base sites with an A to G editing ratio greater than 15%, namely A3, A5, and A7. The maximum editing activity site of ABE10.1 is A5, with a higher editing ratio than ABE8, and there are two base sites with an A to G editing ratio greater than 15%, namely A3 and A5. The maximum editing activity site of ABE10.2 is also A5, with a higher editing ratio than ABE8, and there is one base site with an A to G editing ratio greater than 15%, namely A5.

[0101] In addition, ABE10.1 and ABE10.2 maintained a low rate of INDEL events (Table 4).

[0102] The results showed that ABE10.1 and ABE10.2 had narrower editing windows and higher or similar editing activity, as well as a similarly low level of INDEL occurrence, compared to ABE8.20-m.

[0103] Table 4 shows the percentage of INDELs used by the editor in site2.

[0104] ABE8 0.08％ ABE10.1 0.14％ ABE10.2 0.12％ NC 0.00％

[0105] Example 2

[0106] This embodiment was designed to compare the editing characteristics of ABE8 with those of ABE10.1 and ABE10.2 at site4.

[0107] 2.1 Plasmid Design and Construction

[0108] In this embodiment, apart from synthesizing the sense and antisense strands of SgRNA (Table 2, site4-sense), the construction method of the SgRNA plasmid targeting site4 is as described in Example 1. The base editing vector construction method in this embodiment is as described in Example 1.

[0109] 2.2 Cell transfection

[0110] The cell transfection method in this embodiment is the same as that in Example 1.

[0111] 2.3 Target Fragment Amplification and Library Preparation

[0112] In this embodiment, the target fragment amplification and library preparation methods are as described in Example 1.

[0113] 2.4 Next-Generation Sequencing Data Analysis and Statistics

[0114] The data analysis and statistics methods in this embodiment are as described in Embodiment 1.

[0115] 2.5 Results Analysis

[0116] like Figure 4 As shown, the maximum editing activity site of ABE8 at site 4 is A4. The maximum editing activity site of ABE10.1 is also at A4, with a higher editing ratio than ABE8. The maximum editing activity site of ABE10.2 is also at A4, with a higher editing ratio than ABE8. The editing ratios of ABE8, ABE10.1, and ABE10.2 at site A9 are all relatively low.

[0117] Example 3

[0118] This embodiment was designed to compare the editing features of ABE8 with those of ABE10.1 and ABE10.2 in site8.

[0119] 2.1 Plasmid Design and Construction

[0120] In this embodiment, the SgRNA plasmid targeting site8 is constructed as described in Example 1. Except for the synthesis of the sense and antisense strands of the SgRNA (Table 2, site8-sense), the base editing vector is constructed as described in Example 1.

[0121] 2.2 Cell transfection

[0122] The cell transfection method in this embodiment is the same as that in Example 1.

[0123] 2.3 Target Fragment Amplification and Library Preparation

[0124] In this embodiment, the target fragment amplification and library preparation methods are as described in Example 1.

[0125] 2.4 Next-Generation Sequencing Data Analysis and Statistics

[0126] The data analysis and statistics methods in this embodiment are as described in Embodiment 1.

[0127] 2.5 Results Analysis

[0128] like Figure 5 As shown, the maximum editing activity site of ABE8 at site 8 is A7. The maximum editing activity site of ABE10.1 is also at A7, with a higher editing ratio than ABE8. The maximum editing activity site of ABE10.2 is also at A7, with a higher editing ratio than ABE8. The editing ratios of ABE8, ABE10.1, and ABE10.2 at sites A11 and A17 are all relatively low.

[0129] Example 4

[0130] Replacing the TadA sequence in ABE10.1 with the sequence SEQ ID NO:6 yields a new base editor, denoted as ABE10.3. This embodiment is designed to compare the editing characteristics of ABE8 and ABE10.3.

[0131] 2.1 Plasmid Design and Construction

[0132] In this embodiment, the SgRNA plasmid targeting site2 is constructed as described in Example 1. The base editing vector is constructed as described in Example 1, wherein the TadA sequence used is SEQ ID NO:6.

[0133] 2.2 Cell transfection

[0134] In this embodiment, the cell transfection method is the same as in Example 1, and the cell dosage is 2x10 cells per well. 5 Each cell.

[0135] 2.3 Target Fragment Amplification and Library Preparation

[0136] In this embodiment, the target fragment amplification and library preparation methods are as described in Example 1.

[0137] 2.4 Next-Generation Sequencing Data Analysis and Statistics

[0138] The data analysis and statistics methods in this embodiment are as described in Embodiment 1.

[0139] 2.5 Results Analysis

[0140] like Figure 6 As shown, the highest editing activity site of ABE10.3 is A5, with a higher editing ratio than ABE8, and the second highest editing activity site is A3, with a higher editing ratio than ABE8. The results indicate that ABE10.3 has higher or similar editing activity compared to ABE8.20-m, but the distribution of editing activity within the editing window differs.

[0141] Sequence information

[0142] SEQ ID NO:1

[0143]

[0144] SEQ ID NO:2

[0145]

[0146] SEQ ID NO:3

[0147]

[0148] SEQ ID NO:4

[0149]

[0150]

[0151] SEQ ID NO:5

[0152]

[0153] SEQ ID NO:6

[0154]

[0155] SEQ ID NO:7

[0156]

Claims

1. An adenine deaminase having the amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:

3.

2. The adenine deaminase according to claim 1, wherein, The polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:1 is shown in SEQ ID NO:4, the polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:2 is shown in SEQ ID NO:5, and the polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:3 is shown in SEQ ID NO:

6.

3. An adenine base editor fusion protein comprising a nuclease and at least one adenine deaminase as described in claim 1 or 2.

4. The adenine base editor fusion protein according to claim 3, further comprising a nuclear localization signal sequence.

5. The adenine base editor fusion protein according to claim 4, wherein, The nuclear positioning signal sequence is as shown in SEQ ID NO:

7.

6. The adenine base editor fusion protein according to any one of claims 3 to 5, wherein, The nuclease is selected from Cas protein and its variants, as well as TnpB protein.

7. The adenine base editor fusion protein according to any one of claims 3 to 5, wherein, The nucleotide sequence encoding the adenine base editor fusion protein contains, in sequence, a promoter-adenine deaminase-nuclease-polyadenylation signal.

8. A polynucleotide encoding an adenine deaminase as described in claim 1 or 2, or an adenine abase editor fusion protein as described in any one of claims 3 to 7.

9. A vector comprising the polynucleotide as described in claim 8.

10. A cell comprising one or more selected from the group consisting of adenine deaminase as claimed in claim 1 or 2, adenine abase editor fusion protein as claimed in any one of claims 3 to 7, polynucleotide as claimed in claim 8, and vector as claimed in claim 9, wherein, The cells are prokaryotic cells, plant cells, insect cells, HEK293T cells, or T cells.

11. An adenine base editing system, comprising: adenine deaminase as described in claim 1 or 2; nuclease; and SgRNA, or The adenine base editor fusion protein as described in any one of claims 3-6; and SgRNA.

12. A pharmaceutical composition comprising one or more selected from the adenine deaminase of claim 1 or 2, the adenine base editor fusion protein of any one of claims 3 to 7, the polynucleotide of claim 8, the carrier of claim 9, the cell of claim 10, and the adenine base editor system of claim 11, and a pharmaceutically acceptable carrier.

13. A kit comprising one or more selected from the adenine deaminase of claim 1 or 2, the adenine base editor fusion protein of any one of claims 3 to 7, the polynucleotide of claim 8, the vector of claim 9, the cell of claim 10, and the adenine base editor system of claim 11.

14. A delivery system comprising one or more selected from the adenine deaminase of claim 1 or 2, the adenine base editor fusion protein of any one of claims 3 to 7, the polynucleotide of claim 8, the vector of claim 9, the cell of claim 10, and the adenine base editor system of claim 11; and a delivery medium.

15. A base editing method, comprising the following steps: By expressing the adenine deaminase as described in claim 1 or 2, the adenine base editor fusion protein as described in any one of claims 3 to 7, or the adenine base editing system as described in claim 11 in target cells, gene editing occurs in the target cells under the guidance of SgRNA. The base editing method described herein is not for disease diagnosis or treatment purposes.

16. Use of the adenine deaminase of claim 1 or 2, the adenine base editor fusion protein of any one of claims 3 to 7, the polynucleotide of claim 8, the vector of claim 9, the cell of claim 10, the adenine base editor system of claim 11, the pharmaceutical composition of claim 12, the kit of claim 13, and the delivery system of claim 14 in the preparation of base editing drugs or tools, the preparation of gene therapy drugs, the construction of animal models, or crop breeding.

Images