Mdagl11 gene for regulating apple fruit size and application thereof

Abstract

The application provides an MdAGL11 gene for regulating apple fruit size and application thereof, and the nucleotide sequence of the MdAGL11 gene is shown as SEQ ID NO. 1. The application proves that overexpression of the MdAGL11 gene significantly reduces the apple fruit size, and silencing of the MdAGL11 gene significantly increases the apple fruit size by constructing overexpression vectors and silencing vectors of the gene MdAGL11, and the application can be used for apple fruit size regulation and apple fruit size trait related molecular breeding. The MdAGL11 gene can also be used for early prediction of apple fruit size, and the expression level of the reporter gene MdAGL11 can be detected to judge the apple fruit size difference, distinguish large fruit type varieties and small fruit type varieties, achieve the purpose of quickly distinguishing the fruit size, realize identification of different fruit size resources, accelerate the breeding process, and has important application value for apple breeding development.

Description

Technical Field

[0001] This invention belongs to the field of biological breeding technology, specifically relating to the MdAGL11 gene that regulates the size of apple fruits and its application. Background Technology

[0002] my country ranks first in the world in both apple cultivation area and yield. Apples are rich in nutrients, containing various vitamins and dietary fiber. The Western saying, "An apple a day keeps the doctor away," fully demonstrates the nutritional value of apples. However, apples are perennial deciduous fruit trees. The breeding process, from hybridization to fruit production, is relatively long, generally requiring 5-8 years, which limits the development of apple breeding. The size of the apple fruit determines its market value; generally, larger apples of the same variety command higher prices. Fruit size is an important trait in apple breeding, but traditional methods are insufficient for quickly identifying or predicting differences in fruit size.

[0003] Therefore, under these circumstances, it is urgent to utilize molecular breeding techniques to screen candidate genes for differences in apple fruit size, enabling early prediction of fruit size traits and accelerating the breeding process. This is also the main approach that breeders are currently seeking to achieve breakthroughs in. Furthermore, current methods for detecting apple fruit size are still lacking. Detecting changes in the expression of relevant genes to determine differences in apple fruit size is an important approach, beneficial for early assessment of the fruit size traits in hybrid offspring and accelerating the apple breeding process. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to address the shortcomings of the prior art by providing an MdAGL11 gene that regulates apple fruit size and its application. Overexpression and silencing of the MdAGL11 gene in apples will decrease and increase apple fruit size, respectively. Therefore, the MdAGL11 gene can regulate apple fruit size, and by detecting changes in the expression of the MdAGL11 gene, it can be used to determine differences in apple fruit size, thereby achieving early prediction and accelerating the apple breeding process.

[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is: an MdAGL11 gene that regulates the size of apple fruit, wherein the nucleotide sequence of the MdAGL11 gene is shown in SEQ ID NO.1, and the amino acid sequence encoding the protein is shown in SEQ ID NO.2.

[0006] The present invention also provides an application of the MdAGL11 gene for regulating apple fruit size, wherein overexpression of the MdAGL11 gene significantly reduces the transverse diameter, longitudinal diameter and single fruit weight of apple fruit, while silencing the MdAGL11 gene significantly increases the transverse diameter, longitudinal diameter and single fruit weight of apple fruit.

[0007] This invention also provides another application of the MdAGL11 gene for molecular breeding related to apple fruit size traits.

[0008] This invention also provides another application of the MdAGL11 gene for early prediction of apple fruit size. Using MdAGL11 as a reporter gene, the expression level of the MdAGL11 gene in apple fruit is detected to determine the differences in apple fruit size, thereby achieving early prediction and accelerating the apple breeding process.

[0009] This invention, by adopting the above technical solutions, has significant technical effects:

[0010] 1. This invention provides a gene, MdAGL11, that regulates apple fruit size. By constructing the overexpression vector MdAGL11-OE and the silencing vector MdAGL11-AN, it was demonstrated that overexpression of the MdAGL11 gene significantly reduces apple fruit size, while silencing the MdAGL11 gene significantly increases apple fruit size. This gene can be used for apple fruit size regulation and molecular breeding related to apple fruit size traits.

[0011] 2. The MdAGL11 gene of this invention can also be used for early prediction of apple fruit size. By detecting the expression level of the reporter gene MdAGL11 in early apple fruits, the differences in apple fruit size can be judged, and large-fruited varieties and small-fruited varieties can be distinguished. This can achieve the purpose of quickly distinguishing fruit size, realize the identification of resources with different fruit sizes, accelerate the breeding process, and has important application value for the development of apple breeding.

[0012] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. Attached Figure Description

[0013] Figure 1 This invention relates to the acquisition and expression analysis of the MdAGL11 gene in Example 1, wherein (a) shows the phenotype of Longfeng (LF) and Longshuo (GLF) apples during development, and (b) shows the relative expression level of the MdAGL11 gene during fruit development of Longfeng and Longshuo apples.

[0014] Figure 2 The relative expression levels of MdAGL11 in fruits overexpressing the MdAGL11 gene in GLF apples (MdAGL11-OE) and silenced the MdAGL11 gene in LF apples (MdAGL11-AN) are shown in Example 3 of this invention.

[0015] Figure 3This is the fruit phenotype of the Longshuo (GLF) apple with overexpression of the MdAGL11 gene (MdAGL11-OE) and the Longfeng (LF) apple with silence of the MdAGL11 gene (MdAGL11-AN) in Example 3 of the present invention, bar = 10 mm;

[0016] Figure 4 The transverse diameter, longitudinal diameter, and single fruit weight of fruits that overexpress the MdAGL11 gene in Longshuo (GLF) apples (MdAGL11-OE) and silence the MdAGL11 gene in Longfeng (LF) apples (MdAGL11-AN) are described in Example 3 of this invention.

[0017] Figure 5 This is an analysis of the expression level of the reporter gene MdAGL11 in different apple varieties in Example 4 of the present invention. Detailed Implementation

[0018] Example 1

[0019] This example demonstrates the acquisition and identification of the MdAGL11 gene.

[0020] Transcriptome analysis of Longfeng (LF) and its large-fruited bud mutation Longshuo (GLF) revealed differentially expressed MdAGL11 gene.

[0021] The relative expression level of the MdAGL11 gene during the development of Longfeng (LF) and Longshuo (GLF) apple fruits was analyzed by quantitative real-time PCR (qRT-PCR). The detection method was as follows: using MdAGL11 as a reporter gene, the expression level of the MdAGL11 gene in apple fruits was analyzed by quantitative real-time PCR, and MdAction was selected as an internal reference gene to calculate the relative expression level of the gene. The specific steps included:

[0022] (1) RNA extraction and reverse transcription

[0023] RNA was extracted from apple fruits using the CTAB method. 0.2g of fruit sample, ground in liquid nitrogen, was placed in a 2mL centrifuge tube. 600μL of 4% CTAB (10mL 1M Tris-HCl buffer, 8.182g NaCl, 2g CTAB, 4mL EDTA) was added, followed by 20μL of β-mercaptoethanol. The centrifuge tube was placed in a 65℃ water bath for 20min. 600μL of isoamyl alcohol and chloroform (1:24) were added to the centrifuge tube, and the mixture was centrifuged at 12000rpm and 4℃ for 10min. The supernatant was aspirated, and an equal volume of isoamyl alcohol and chloroform (1:24) was added. The mixture was centrifuged at 12000rpm and 4℃ for 10min. 1 / 4 volume of LiCl was added to the supernatant, and the mixture was incubated at -20℃ for 12h. The mixture was then centrifuged again at 12000rpm. Centrifuge at 12000 rpm and 4℃ for 15 min; remove the liquid, add 600 μL of 75% ethanol to the centrifuge tube, mix thoroughly, and centrifuge at 12000 rpm and 4℃ for 10 min; remove the supernatant, add 600 μL of anhydrous ethanol to the centrifuge tube, mix thoroughly, and centrifuge at 12000 rpm and 4℃ for 10 min; remove the supernatant, place the centrifuge tube on ice for 2 min to allow the alcohol to evaporate, add 10 μL of 1 g / L DEPC water to the centrifuge tube to dissolve the RNA, and determine the RNA concentration using NanoDrop2000. Reverse transcribe 1 μg of RNA into cDNA using the M-MLV RTase cDNA Synthesis kit (D6130; TaKaRa, Shiga, Japan), following the manufacturer's instructions.

[0024] (2) Real-time PCR reaction

[0025] Gene expression primers, reporter gene MdAGL11 primers, and internal reference gene MdAction primers were designed using NCBI's Primer-BLAST online method, as shown in Table 1.

[0026] Table 1 Primer names and sequences for quantitative real-time PCR

[0027] MdAGL11-F TTCAAATGCTGCAGAACTCT MdAGL11-R GACCTGATTCTAGTAATGCC MdActin-F GGCTGGATTTGCTGGTGATG MdActin-R TGCTCACTATGCCGTGCTCA

[0028] The quantitative PCR reaction system consisted of 10 μL of SYBR Green qPCR Master Mix enzyme, which was purchased from Beijing TransGen Biotech Co., Ltd.

[0029] Table 2. Real-time PCR reaction system

[0030]

[0031]

[0032] The procedure for real-time PCR is as follows:

[0033] Table 3. Quantitative PCR reaction procedure

[0034]

[0035] Figure 1 (a) shows the phenotypes of Longfeng (LF) and Longshuo (GLF) apples during their development. Figure 1 (b) shows the relative expression levels of the MdAGL11 gene during fruit development in Longfeng (LF) and Longshuo (GLF) apples. ** indicates extremely significant differences (p<0.01), with the error bar being the standard deviation (SD) of three biological replicates. It was found that the expression level of the MdAGL11 gene during fruit development in Longshuo apples was significantly lower than that in Longfeng apples, and the trend was opposite to that of the fruit differences, indicating that the MdAGL11 gene may negatively regulate apple fruit size.

[0036] Example 2

[0037] This example demonstrates the cloning of the MdAGL11 gene and the MdAGL11 promoter.

[0038] 1. Design of primers for the MdAGL11 gene and MdAGL11 promoter

[0039] Total RNA was extracted from apple fruits and reverse transcribed using a reverse transcription kit to obtain cDNA. The full-length sequence of the MdAGL11 gene was located using transcriptome results (PRJNA551702). The MdAGL11 promoter sequence was found from the apple genome (https: / / iris.angers.inra.fr / gddh13 / ). Primer Premier 6 was used to design full-length primers and promoter primers for the MdAGL11 gene.

[0040] Table 4. Names and sequences of nucleotide primers for MdAGL11

[0041] MdAGL11-wF ATGGGGAGGGGAAAGATTGAAAT MdAGL11-wR TTACCCAAGATGGAGGTTCTTCT

[0042] Table 5. Names and sequences of MdAGL11 promoter primers

[0043] MdAGL11-pro-F CTTGAAGGGCATTTTAGTCAGG MdAGL11-pro-R CTTAATATCTGATTACTTTGAT

[0044] 2. PCR reaction

[0045] The PCR reaction volume is 50 μL:

[0046] Table 6 PCR reaction system

[0047]

[0048] The PCR reaction procedure is as follows:

[0049] Table 7 PCR reaction procedure

[0050]

[0051] After the reaction was complete, 0.5 μL of r Tap and 3 μL of dNTP Mixture were added to the product, and the mixture was placed in a 72°C metal bath for 20 min. The amplified fragment was analyzed by agarose gel electrophoresis.

[0052] 3. Purification and transformation of PCR products

[0053] The full-length MdAGL11 gene sequence and the MdAGL11 promoter product were purified using a PCR product purification kit (EG101-01, TransGen Biotech, Beijing) and ligated into the pEASY-T1 vector (TransgenBiotech, Beijing). The resulting vectors were transformed into *E. coli*. After colony PCR, positive colonies were cultured in liquid medium and sequenced at Shanghai Sangon Biotech Co., Ltd. (Shanghai, China). The full-length MdAGL11 gene sequence is shown in SEQ ID NO.1, and the MdAGL1 promoter sequence is shown in SEQ ID NO.3.

[0054] Example 3

[0055] This example is a verification of the expression function of the MdAGL11 gene.

[0056] 1. Construction of overexpression and silencing vectors

[0057] (1) Construction of overexpression vector

[0058] The cloned full-length fragment of the MdAGL11 gene was ligated into the pRI101 vector (35S promoter driven) containing NdeI and SacI restriction endonuclease sites using a seamless cloning kit (cat.no.D7010M, Beyotime, Shanghai) according to the instructions, to obtain the MdAGL11 gene overexpression vector MdAGL11-OE.

[0059] (2) Construction of Silent Carrier

[0060] The silencing vector was obtained by reverse ligation. The cloned full-length fragment of the MdAGL11 gene was ligated into the pRI101 vector (35S promoter driven) containing SacI and NdeI restriction endonuclease sites using a seamless cloning kit (cat.no.D7010M, Beyotime, Shanghai) according to the instructions, to obtain the MdAGL11 gene silencing vector MdAGL11-AN.

[0061] The primers used to construct the overexpression and silencing vectors are shown in Table 8.

[0062] Table 8 Primer Names and Sequences

[0063]

[0064]

[0065] 2. Apple genetic transformation

[0066] The constructed MdAGL11 gene overexpression vector MdAGL11-OE and silencing vector MdAGL11-AN were transformed into Agrobacterium, with the pRI101 empty vector used as a control. The vectors were plated on YEP solid medium (containing 50 μg / mL of Rif). -1 and Kana 50μg mL -1 The strain was incubated at 28℃ for 2-3 days. After growth, positive monoclonal antibodies were dissolved in 5 mL of YEP liquid medium (containing 50 μg / mL). -1 Kana and 50 μg mL -1 Incubate the culture in Rif (50 μg / mL) overnight at 28°C for 12 hours at 200 rpm. Transfer 100 μL of the culture to 50 mL of YEP liquid medium (Rif concentration 50 μg / mL). -1 Incubate at 28°C until the bacterial concentration (OD500) is reached. 600 When the concentration is 0.8, centrifuge at 7000 rpm for 5 min at 4°C and remove the supernatant. Resuspend the bacteria in 5 mL of H2O, then centrifuge the centrifuge tube at 7000 rpm for 5 min at 4°C, remove the supernatant, and add the injection suspension [1 mL of 1M MgCl2, 1 mL of 1M MES, and 100 μL of 100 mM Acetosyringone per 100 mL] to OD200. 600=0.8, injected into apple fruits 30 days after full bloom, to overexpress the MdAGL11 gene in Longshuo (GLF) apples (MdAGL11-OE) and silence the MdAGL11 gene in Longfeng (LF) apples (MdAGL11-AN). 25 days later, qRT-PCR was used to detect the relative expression levels of the MdAGL11 gene in overexpressed and silenced fruits, and the transverse diameter, longitudinal diameter, and single fruit weight were investigated.

[0067] The relative expression levels of MdAGL11 in fruits overexpressing the MdAGL11 gene (MdAGL11-OE) in Longshuo (GLF) apples and silenced MdAGL11 gene (MdAGL11-AN) in Longfeng (LF) apples were detected by qRT-PCR. The results are as follows: Figure 2 As shown; the fruit phenotypes of MdAGL11 gene overexpression (MdAGL11-OE) in Longshuo (GLF) apples and MdAGL11 gene silencing (MdAGL11-AN) in Longfeng (LF) apples are as follows. Figure 3 As shown, bar = 10 mm; the transverse diameter, longitudinal diameter, and single fruit weight of fruits overexpressing the MdAGL11 gene (MdAGL11-OE) in Longshuo (GLF) apples and those silenced by the MdAGL11 gene (MdAGL11-AN) in Longfeng (LF) apples were measured using digital vernier calipers and an electronic balance. The results are shown in the figure. Figure 4 As shown, ** indicates highly significant differences (p<0.01), and the error bar is the standard deviation (SD) of 10 biological replicates; the results show that overexpression of the MdAGL11 gene significantly reduced apple fruit size, while silencing of the MdAGL11 gene significantly increased apple fruit size.

[0068] Example 4

[0069] This example illustrates the expression analysis of the MdAGL11 gene in different apple varieties.

[0070] The apple varieties of different fruit sizes used in the experiment were collected from the Liaoning Provincial Fruit Tree Research Institute and Shenyang Agricultural University in Xiong Yue Town, Yingkou City, Liaoning Province, as shown in the table below:

[0071] Table 9. Apple Germplasm Resources

[0072] 1 Golden Red 1 Wangshanhong 2 Purple Fragrance 2 Cool fragrance 3 Kulun Sand Fruit 3 Dongguang 4 Red bell 4 Han Fu 5 Red Beyond the Great Wall 5 Golden Crown 6 Dragon Crown 6 Wang Lin

[0073] The expression levels of the reporter gene MdAGL11 in six large apple varieties and six small apple varieties were analyzed, and the results are as follows: Figure 5 As shown, the expression level of the MdAGL11 gene was significantly higher in six small-fruited varieties than in six large-fruited varieties, which can effectively distinguish between large-fruited and small-fruited apple varieties.

[0074] This invention provides an MdAGL11 gene that regulates fruit size. Transient functional verification shows that the MdAGL11 gene can regulate apple fruit size. By detecting the expression level of the reporter gene MdAGL11 in early apple fruits, differences in apple fruit size can be determined, large-fruited varieties can be distinguished from small-fruited varieties, and the purpose of quickly distinguishing fruit size can be achieved, enabling early prediction of fruit size traits and accelerating the breeding process.

[0075] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any way. Any simple modifications, alterations, and equivalent changes made to the above embodiments based on the inventive essence shall still fall within the protection scope of the present invention.

Claims

1. A kind MdAGL11 The application of genes is characterized by, The MdAGL11 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence encoding the protein is shown in SEQ ID NO.2; MdAGL11 Genes are used to regulate the size of apple fruits.

2. The application according to claim 1, characterized in that, overexpression MdAGL11 The gene significantly reduces the transverse diameter, longitudinal diameter, and single fruit weight of apples, while the silent gene... MdAGL11 The gene significantly increases the transverse diameter, longitudinal diameter, and single fruit weight of apples.

3. A kind MdAGL11 The application of genes is characterized by, The MdAGL11 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence encoding the protein is shown in SEQ ID NO.2; MdAGL11 Genes are used in molecular breeding related to apple fruit size traits.

4. A kind MdAGL11 The application of genes is characterized by, The MdAGL11 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence encoding the protein is shown in SEQ ID NO.2; MdAGL11 Genes are used for early prediction of apple fruit size.

5. The application according to claim 4, characterized in that, by MdAGL11 As a reporter gene, it is detected in apple fruit. MdAGL11 Gene expression levels can be used to determine differences in apple fruit size, thereby enabling early prediction and accelerating the apple breeding process.

Images