Recombinant yarrowia lipolytica with high sclareol production and preparation method and application thereof

CN120330072BActive Publication Date: 2026-08-18EAST CHINA UNIV OF SCI & TECH +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510477188.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-16
Publication Date
2026-08-18
Estimated Expiration
2045-04-16

AI Technical Summary

Technical Problem

产油酵母解脂耶氏酵母(Yarrowia lipolytica)能利用葡萄糖、果糖、甘油等多种廉价碳源,具有充足的乙酰辅酶A库和外源蛋白分泌能力且被公认为是安全微生物(generallyregarded as safe,GRAS),但目前重组解脂耶氏酵母发酵制备香紫苏醇的产量较低,因此亟需开发高产香紫苏醇的解脂耶氏酵母基因工程菌

Benefits of technology

[0022]This invention analyzes the metabolic principles of *Yarrowia lipolytica* and regulates the key metabolic pathways for the production of perillaldehyde. Eight recombinant strains, CJ-1, CJ-2, CJ-3, CJ-4, CJ-5, CJ-6, CJ-7, and CJ-8, were designed and constructed. CJ-1 overexpresses the tPaGGPPS gene and the SsSL gene; CJ-2 overexpresses the tPaGGPPS gene and two copies of the SsSL gene (SsSCS and SsLPPS); CJ-3 overexpresses the tPaGGPPS gene, two copies of the SsSL gene, the ERG19 gene, and the ERG13 gene; CJ-4 overexpresses the tPaGGPPS gene, two copies of the SsSL gene, the ERG19 gene, the ERG13 gene, the ERG12 gene, and the ERG8 gene; and CJ-5 overexpresses tPaGGPPS. The CJ-6 gene overexpresses the tPaGGPPS gene, two copies of the SsSL gene, ERG19, ERG13, ERG12, ERG8, and CAT2 gene while simultaneously knocking out the DGA2 gene; the CJ-7 gene overexpresses the tPaGGPPS gene, three copies of the SsSL gene, ERG19, ERG13, ERG12, ERG8, and CAT2 gene while simultaneously knocking out the DGA2 gene; and the CJ-8 gene overexpresses the tPaGGPPS gene, four copies of the SsSL gene, ERG19, ERG13, ERG12, ERG8, and CAT2 gene while simultaneously knocking out the DGA2 gene. Compared to the initial strain *Yarrowia lipolytica* Po1f-tHEI and the recombinant strain CJ-1-CJ-7, the recombinant strain CJ-8 showed a significantly enhanced ability to ferment and synthesize perillaldehyde, achieving a perillaldehyde yield of 2747.50 mg/L. In summary, the recombinant *Yarrowia lipolytica* strain provided by this invention significantly improves the fermentation capacity for perillaldehyde production, and its use in perillaldehyde fermentation can substantially increase perillaldehyde yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330072B_ABST
    Figure CN120330072B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of genetic engineering, and particularly relates to a recombinant Yarrowia lipolytica strain for high-yield sclareol production, a preparation method and application thereof. By analyzing the metabolic principle of Yarrowia lipolytica, the key metabolic pathway for producing sclareol is regulated, and eight recombinant strains are designed and constructed, wherein the CJ-8 overexpresses tPaGGPPS gene, four copies of SsSL gene, ERG19 gene, ERG13 gene, ERG12 gene, ERG8 gene and CAT2 gene, and simultaneously knocks out DGA2 gene. Compared with the initial strain and the other seven recombinant strains, the CJ-8 can ferment and synthesize sclareol, and the synthesis capacity is significantly improved. The sclareol yield of the CJ-8 reaches 2747.50 mg / L. In conclusion, the use of the recombinant Yarrowia lipolytica strain provided by the present application for sclareol fermentation production can greatly improve the yield of sclareol.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a recombinant Yersinia lipolytica strain that produces high levels of perillaldehyde, its preparation method, and its applications. Background Technology

[0002] Sclareol (C 20 H 36 O2), scientifically named (1R,2R,8aS)-decahydro-1-(3-hydroxy-3-methyl-4-pentenyl)-2,5,5,8a-tetramethyl-2-naphthol, is a hemisperidane-type diterpenol compound. It is a white crystalline powder at room temperature with a faint ambergris odor. It is relatively stable in alkaline environments and is mainly found in nature in Salvia sclarea (Southern European sage). Currently, sclarin is mainly extracted industrially from the flowers and leaves of Salvia sclarea, a Lamiaceae herb native to Southern Europe, using steam distillation and extraction methods. However, the content of sclarin in Salvia sclarea, the main plant source of sclarin, is not high. As an important plant-derived fragrance and flavoring agent, sclarin is a raw material for the synthesis of ambergris ether, a substitute for ambergris. It also has anti-inflammatory, antibacterial, anticancer, and choleretic effects, and is widely used in the food, cosmetics, and pharmaceutical industries, making it of significant value.

[0003] The extraction method of perillaldehyde from Southern European tanshinone requires a large amount of raw materials, which can easily lead to a waste of plant resources. Southern European tanshinone has a long growth cycle and is easily affected by external factors such as geographical environment and climate change. Moreover, the chemical composition of the plant is complex, making it difficult to obtain pure perillaldehyde products. This results in high costs and low yields and purity of commonly used extraction and separation methods.

[0004] Microbial fermentation has a short growth cycle, can be carried out around the clock, and has a stable yield, which can meet the growing market demand. The oil-producing yeast *Yarrowia lipolytica* can utilize various inexpensive carbon sources such as glucose, fructose, and glycerol, has an ample supply of acetyl-CoA and the ability to secrete exogenous proteins, and is generally recognized as a safe microorganism (GRAS). However, the current yield of recombinant *Yarrowia lipolytica* fermentation for the production of perillaldehyde is low. Therefore, there is an urgent need to develop genetically engineered *Yarrowia lipolytica* strains that produce high-yield perillaldehyde. Summary of the Invention

[0005] The purpose of this invention is to provide a recombinant *Yarrowia lipolytica* strain with high perillaldehyde production, its preparation method, and its applications, thereby addressing the problems existing in the prior art. The recombinant *Yarrowia lipolytica* strain provided by this invention significantly enhances the fermentation capacity for perillaldehyde production, and its use in perillaldehyde fermentation can substantially increase the yield of perillaldehyde.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a recombinant Yarrowialipolytica strain that produces high levels of perillaldehyde. The initial strain of the recombinant Yarrowialipolytica strain is Yarrowialipolytica, which is then introduced into an expression cassette containing the following genes: tPaGGPPS (geranyl pyrophosphate synthase), SsSCS (perillaldehyde synthase), SsLPPS (lysine pyrophosphate diol ester synthase), ERG19 (mevalonate pyrophosphate decarboxylase), ERG13 (3-hydroxy-3-methylglutaryl-CoA synthase), ERG12 (mevalonate kinase), ERG8 (mevalonate phosphate kinase), and CAT2 (carnitine O-acetyltransferase). Simultaneously, the DGA2 (diacylglycerol acyltransferase) gene is knocked out to obtain the recombinant Yarrowialipolytica strain.

[0008] The nucleotide sequence of the geraniol pyrophosphate synthase tPaGGPPS gene is shown in SEQ ID NO.1; the nucleotide sequence of the perilla syringol synthase SsSCS gene is shown in SEQ ID NO.2; and the nucleotide sequence of the lysine pyrophosphate diol ester synthase SsLPPS gene is shown in SEQ ID NO.3.

[0009] Preferably, the copy number of the perilla syrup synthase SsSCS gene is 4 copies, and the copy number of the lysine pyrophosphate diol synthase SsLPPS gene is 4 copies.

[0010] Preferably, the accession number of the mevalonate pyrophosphate decarboxylase ERG19 gene is GeneID: 2907970, the accession number of the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 gene is GeneID: 2907642, the accession number of the mevalonate kinase ERG12 gene is GeneID: 2906793, the accession number of the mevalonate phosphate kinase ERG8 gene is GeneID: 2912386, the accession number of the carnitine O-acetyltransferase CAT2 gene is GeneID: 2906787, and the accession number of the diacylglycerol acyltransferase DGA2 gene is GeneID: 2910950.

[0011] Preferably, the Yarrowia lipolytica strain is Yarrowia lipolytica Po1f-tHEI.

[0012] Preferably, the promoter of the expression box is PFBAin, Php4d, or PTEFI, and the terminator is Tsynth7t or Txpr2t.

[0013] This invention provides a method for constructing the above-mentioned engineered bacteria, comprising the following steps:

[0014] Expression cassettes containing the geraniol pyrophosphate synthase tPaGGPPS gene, perillyl alcohol synthase SsSCS gene, lysine pyrophosphate diol ester synthase SsLPPS gene, mevalonate pyrophosphate decarboxylase ERG19 gene, 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 gene, mevalonate kinase ERG12 gene, mevalonate phosphate kinase ERG8 gene, and carnitine O-acetyltransferase CAT2 gene were introduced into the initial strain in plasmid form, and the diacylglycerol acyltransferase DGA2 gene was knocked out to obtain the recombinant Yersinia lipolytica.

[0015] Preferably, the copy number of the perilla syringe synthase SsSCS gene is 4 copies, and the copy number of the lysine pyrophosphate diol synthase SsLPPS gene is 4 copies.

[0016] The accession number for the mevalonate pyrophosphate decarboxylase ERG19 gene is GeneID: 2907970, the accession number for the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 gene is GeneID: 2907642, the accession number for the mevalonate kinase ERG12 gene is GeneID: 2906793, the accession number for the mevalonate phosphate kinase ERG8 gene is GeneID: 2912386, the accession number for the carnitine O-acetyltransferase CAT2 gene is GeneID: 2906787, and the accession number for the diacylglycerol acyltransferase DGA2 gene is GeneID: 2910950.

[0017] Preferably, the *Yarrowia lipolytica* strain is *Yarrowia lipolytica* Po1f-tHEI;

[0018] The promoter of the expression box is PFBAin, Php4d, or PTEFI, and the terminator is Tsynth7t or Txpr2t.

[0019] This invention provides the application of the above-mentioned recombinant Yersinia lipolytica in the production of perillaldehyde.

[0020] This invention provides a method for producing perillaldehyde, comprising the step of fermenting perillaldehyde using the aforementioned recombinant Yersinia lipolytica.

[0021] The present invention discloses the following technical effects:

[0022] This invention analyzes the metabolic principles of *Yarrowia lipolytica* and regulates the key metabolic pathways for the production of perillaldehyde. Eight recombinant strains, CJ-1, CJ-2, CJ-3, CJ-4, CJ-5, CJ-6, CJ-7, and CJ-8, were designed and constructed. CJ-1 overexpresses the tPaGGPPS gene and the SsSL gene; CJ-2 overexpresses the tPaGGPPS gene and two copies of the SsSL gene (SsSCS and SsLPPS); CJ-3 overexpresses the tPaGGPPS gene, two copies of the SsSL gene, the ERG19 gene, and the ERG13 gene; CJ-4 overexpresses the tPaGGPPS gene, two copies of the SsSL gene, the ERG19 gene, the ERG13 gene, the ERG12 gene, and the ERG8 gene; and CJ-5 overexpresses tPaGGPPS. The CJ-6 gene overexpresses the tPaGGPPS gene, two copies of the SsSL gene, ERG19, ERG13, ERG12, ERG8, and CAT2 gene while simultaneously knocking out the DGA2 gene; the CJ-7 gene overexpresses the tPaGGPPS gene, three copies of the SsSL gene, ERG19, ERG13, ERG12, ERG8, and CAT2 gene while simultaneously knocking out the DGA2 gene; and the CJ-8 gene overexpresses the tPaGGPPS gene, four copies of the SsSL gene, ERG19, ERG13, ERG12, ERG8, and CAT2 gene while simultaneously knocking out the DGA2 gene. Compared to the initial strain *Yarrowia lipolytica* Po1f-tHEI and the recombinant strain CJ-1-CJ-7, the recombinant strain CJ-8 showed a significantly enhanced ability to ferment and synthesize perillaldehyde, achieving a perillaldehyde yield of 2747.50 mg / L. In summary, the recombinant *Yarrowia lipolytica* strain provided by this invention significantly improves the fermentation capacity for perillaldehyde production, and its use in perillaldehyde fermentation can substantially increase perillaldehyde yield. Attached Figure Description

[0023] Figure 1 A diagram illustrating the biosynthetic metabolic pathway of perillol in Yersinia lipophila;

[0024] Figure 2 GC-MS spectra of perillaldehyde standard and perillaldehyde produced by fermentation of (a) recombinant strain CJ-8 and (b) for 6 days. Detailed Implementation

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0028] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0029] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0030] This invention analyzes the metabolic mechanisms of Yarrowia lipolytica. Figure 1 By regulating the key metabolic pathways of perillaldehyde production from Yersinia lipolytica, eight recombinant strains were designed and constructed to increase the yield of perillaldehyde produced by Yersinia lipolytica fermentation. Details are as follows:

[0031] The culture medium formulations used in the following examples are as follows:

[0032] Yeast selection medium YNB-URA: 10 g / L glucose, 6.7 g / L LeastNitrogen Base (YNB), 0.5 g / L uracil (URA), and 20 g / L agar powder.

[0033] Yeast selection medium YNB: 10 g / L glucose, 6.7 g / L YeastNitrogen Base (YNB) and 20 g / L agar powder.

[0034] YPD liquid medium: 20 g / L glucose, 20 g / L peptone and 10 g / L yeast extract.

[0035] YPD solid medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract and 20 g / L agar powder.

[0036] YPD fermentation medium: 60 g / L glucose, 40 g / L peptone and 20 g / L yeast extract.

[0037] 5-FOA-YPD solid medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, 1 g / L 5-fluoroorotic acid (5-FOA) and 20 g / L agar powder.

[0038] The NCBI accession numbers of the genes appearing in the following examples are shown in Table 1:

[0039] Table 1

[0040]

[0041] The gerany-gerany pyrophosphate synthase tPaGGPPS gene is derived from *Pseudomonas sclerotiorum*, a fungus that rots fruit and is accessed in NCBI under accession number A2PZA5. It retains amino acid sequences 390 to 719 of PaGGPPS and was obtained through codon optimization. Its nucleotide sequence is shown in SEQ ID No. 1, specifically: ATGCTGTCCACCGGCCTGTCCCTGTCCCCCGTGCACTCTAACGAGGGCAAGGACCTGCAGCGAGTCGACACCGACCACATCTTCTTCGAGAAGGCCGTGCTGGAGGCCCCCTACGACTACATCGCCTCCATGCCCTCTAAGGGCGTCCGAGACCAGTTCATCGACGCCCTCAACGACTGGCTGCGAGTCCCCGACGTGAAGGTCGGCAAGATCAAGGACGCCGTGCGAGTCCTGCACAACTCTTCTCTGCTCCTGGACGACTTCCAGGACAACTCCCCCCTGCGACGAGGCAAGCCCTCCACCCACAACATCTTCGGTTCCGCCCAGACCGTCAACACCGCCACCTACTCCATCATTAAGGCCATCGGTCAGATCATGGAGTTCTCCGCCGGCGAGTCCGTCCAGGAAGTCATGAACTCCATCATGATCCTGTTCCAGGGCCAGGCCATGGACCTGTTCTGGACCTACAACGGCCACGTCCCCTCCGAGGAGGAGTACTACCGAATGATCGACCAAAAGACCGGCCAGCTGTTCTCCATCGCCACCTCTCTGCTCCTGAACGCCGCCGACAACGAGATCCCTCGAACCAAGATCCAGTCCTGTCTGCACCGACTGACCCGACTGCTGGGCCGATGCTTCCAGATCCGAGATGACTACCAGAACCTGGTCTCCGCCGACTACACCAAGCAGAAGGGTTTCTGCGAGGACCTGGACGAGGGCAAGTGGTCCCTGGCCCTGATCCACATGATCCACAAGCAGCGATCCCACATGGCCCTGCTGAACGTGCTGTCCACCGGCCGAAAGCACGGTGGCATGACCCTCGAGCAGAAGCAGTTCGTGCTGGACATCATCGAGGAGGAGAAGTCCCTGGACTACACTCGATCTGTGATGATGGACCTGCACGTCCAGCTGCGAGCTGAGATTGGTCGAATTGAAATTCTGCTGGATTCCCCTAACCCTGCTATGAGACTTCTTTTGGAGCTGCTGCGAGTCTGA, a total of 996 bp.

[0042]

[0043]

[0044] Example 1

[0045] Construction of recombinant plasmids:

[0046] 1. Construction of recombinant plasmid pINA1269-tPaGGPPS-SsSL

[0047] The recombinant plasmid pINA1269-tPaGGPPS-SsSL is based on pINA1269, which is digested with Kpn I and Pml I restriction endonucleases and then inserted into the tPaGGPPS-Tsynth7t-PFBAin-SsSL expression cassette.

[0048] Using tsynth7t-FBAin-F and SsSCS-FBAin-R as primers and Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, the SsSL expression cassette (P) was amplified. FBAin -SsSCS-GGG-SsLPPS-T xpr2t The promoter PFBAin of Yarrowia lipolytica Po1fΔku70 is Tsynth7-PFBAin-SsSCS. Yarrowia lipolytica Po1fΔku70 has a GenBank accession number of GCA_009372015.1 and is committed to being distributed for 20 years.

[0049] The nucleotide sequences of exogenous tPaGGPPS, SsSCS, and SsLPPS were codon-optimized and inserted into plasmid pUC57 by Sangon Biotech (Shanghai) Co., Ltd., resulting in the corresponding template plasmids, namely pUC57-tPaGGPPS, pUC57-SsSCS, and pUC57-SsLPPS. The nucleotide sequences of tPaGGPPS, SsSCS, and SsLPPS are shown in SEQ ID No. 1-SEQ ID No. 3.

[0050] Using primers hp4d-tPaGGPPS-F, tsynth7t-tPaGGPPS-R, tsynth7t-R, and FBAin-tsynth7t-R, and the pUC57-tPaGGPPS plasmid as a template, the tPaGGPPS gene, bearing homologous arms of the promoter Php4d and the terminator Tsynth7t at both ends, was amplified, i.e., hp4d-tPaGGPPS-Tsynth7t. Using primers FBAin-SsSCS-F and SsLPPS-GGG-SsSCS-R, and the pUC57-SsSCS plasmid as a template, the SsSCS gene, bearing homologous arms of the promoter PFBAin, the SsLPPS gene, and the linker sequence at both ends, was amplified, i.e., PFBAin-SsSCS-GGG-SsLPPS. Using SsSCS-GGG-SsLPPS-F and xpr2t-SsLPPS-R as primers and pUC57-SsLPPS plasmid as template, the SsLPPS gene with SsSCS gene, linker sequence and Txpr2t homologous arm at both ends was amplified, namely SsSCS-GGG-SsLPPS-Txpr2t.

[0051] After double digestion of the pINA1269 plasmid with restriction endonucleases Kpn I and Pml I from Takara and Thermo Fisher Scientific, the plasmid was then processed using [a specific enzyme / method / technology - likely a specific product / technology] from Beijing TransGen Biotech Co., Ltd. The PCRPurification Kit is used to purify and recover linearized pINA1269 plasmid.

[0052] Using Beijing Quanshijin Biotechnology Co., Ltd. The Basic Seamless Cloning and Assembly Kit was used to seamlessly clone the linearized pINA1269 plasmid and its fragments (hp4d-tPaGGPPS-Tsynth7t, tPaGGPPS-Tsynth7t-PFBAin, PFBAin-SsSCS-GGG-SsLPPS, and SsSCS-GGG-SsLPPS-Txpr2t) to obtain a recombinant vector. This vector was then transformed into E. coli DH5α competent cells. The recombinant plasmid pINA1269-tPaGGPPS-SsSL was obtained by ampicillin-resistant plate selection and colony PCR and sequencing verification.

[0053] 2. Construction of recombinant plasmid pCRISPRyl-D069::SsSL

[0054] pCRISPRyl-D069 backbone construction method: The plasmid pCRISPRyl (purchased) was double-digested with SacII and NotI restriction endonucleases, purified, and recovered to obtain the linearized vector pCRISPRyl. This linearized vector was then seamlessly cloned with a pre-designed sgRNA (SEQ ID NO.48, GCTGCCATGTCATATCCACG) targeting the D069 site, along with its expression cassette and upstream and downstream homologous arms, to obtain the vector pCRISPRyl-D069. The specific steps are as follows:

[0055] Using Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, primers CU-SacII-uHAD069-F (SEQ ID NO.55, ttttcttttttttctgtacagacgcgtccgcggcgcatgtcggccagttaggctctac) and dHA-SpeI-uHAD069-R (SEQ ID NO.56, gacagcatagcagccactagtgttgatagtcaagtcactggagagatggt) were used to amplify the upper 1000bp of the sgRNA sequence at the D069 site as the upper homologous arm uHAD069; primers uHA-SpeI-dHAD069-F (SEQ ID NO.57, caggtgacttgactatcaacactagtggctgctatgctgtctgcaacaagt) and sgRNA-dHAD069-R (SEQ ID NO.56) were used to amplify the upper 1000bp of the sgRNA sequence at the D069 site as the upper homologous arm uHAD069. The lower 1000bp of the sgRNA sequence at the D069 site was amplified using the formula NO.58, gttgtgtcaacttttgcaactggggtcatcttggtgacaagctgctgggc, serving as the lower homologous arm dHAD069. Using plasmid pUC-sgRNAPro+Ter (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) as a template, primers dHAD069-sgPro-F (SEQ ID NO.59, cagcagcttgtcaccaagatgaccccagttgcaaaagttgacacaactct) and D069sgRNA-sgPro-R (SEQ ID NO.60, ctagctctaaaaccgtggatatgacatggcagcacgtcaacctgcgccgacccggaat) were used to amplify the sgRNA promoter and the sgRNA module at the D069 site. The sgRNA and its sgRNA terminator module were amplified using primers D069sgRNA-F (SEQ ID NO.61, gctgccatgtcatatccacggttttagagctagaaatagcaagttaaaataaggctag) and CU-NotI-D069sgTer-R (SEQ ID NO.62, ccacctgacgtctttagcggccgcattcttcgactctagaggatctgggcctcgtgat).The above four fragments were seamlessly cloned and ligated with the linearized vector pCRISPRyl, which was double-digested with SacII and NotI, to obtain the plasmid pCRISPRyl-D069. After digestion with SpeI restriction endonuclease, the plasmid was purified and recovered to obtain the linearized pCRISPRyl-D069 vector.

[0056] The recombinant plasmid pCRISPRyl-D069::SsSL is based on pCRISPRyl-D069, digested with SpeI restriction endonuclease, and then inserted into the SsSL expression cassette (P). TEFin -SsSCS-GGG-SsLPPS-T xpr2t ).

[0057] Using uHAD069-TEFin-F and SsSCS-TEFin-R as primers and Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, the promoter PTEFin of the SsSL expression cassette was amplified.

[0058] Using the recombinant plasmid pINA1269-tPaGGPPS-SsSL from step 1 as a template, and using TEFin-SsSCS-F and dHAD069-xpr2t-R as primers, the SsSL fusion gene with homologous arms of promoters PTEFI and dHAD069 at both ends was amplified.

[0059] After digesting the pCRISPRyl-D069 plasmid with the restriction endonuclease SpeI from Takara Bio, it was then processed using [a specific enzyme / method / technology] from Beijing TransGen Biotech Co., Ltd. The PCR Purification Kit was used to recover linearized pCRISPRyl-D069 plasmid.

[0060] Using Beijing Quanshijin Biotechnology Co., Ltd. The Basic Seamless Cloning and Assembly Kit was used to seamlessly clone the linearized pCRISPRyl-D069 plasmid, the promoter PTEFI, and the SsSL fusion gene. The resulting recombinant vector was then transformed into E. coli DH5α competent cells. The recombinant plasmid pCRISPRyl-D069::SsSL was obtained by ampicillin-resistant plate selection and colony PCR and sequencing verification.

[0061] 3. Construction of recombinant plasmid pCRISPRyl-D17::ERG19+ERG13

[0062] pCRISPRyl-D17 backbone construction method: The plasmid pCRISPRyl (purchased) was double-digested with SacII and NotI restriction endonucleases, purified, and recovered to obtain the linearized vector pCRISPRyl. This linearized vector was then seamlessly cloned with a pre-designed sgRNA (SEQ ID NO.49, TCCGTAATATAGGTGACGAC) targeting the D17 site, along with its expression cassette and upstream and downstream homologous arms, to obtain the vector pCRISPRyl-D17. The specific steps are as follows:

[0063] Using Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, primers CU-SacII-uHAD17-F (SEQ ID NO. 63, tttttttctgtacagacgcgtccgcggatcttctaagtccactatatcacccctccaa) and dHA-SpeI-uHAD17-R (SEQ ID NO. 64, gcttccgtaatataggtgaactagtgatagaagactagcttggacaggaaaaacatgt) were used to amplify the upper 1000bp of the sgRNA sequence at the D17 site as the upper homologous arm uHAD17; primers uHA-SpeI-dHAD17-F (SEQ ID NO. 65, ccaagctagtcttctatcactagttcacctatattacggaagcagtggtactcaagct) and sgRNA-dHAD17-R (SEQ ID NO. 64) were used. The lower 1000bp of the sgRNA sequence at the D17 site was amplified using the plasmid pUC-sgRNAPro+Ter (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) as a lower homologous arm dHAD17. Then, using primers dHAD17-sgPro-F (SEQ ID NO. 67, ccaaggccatctgccagacgatcccagttgcaaaagttgacacaactctagatct) and D17sgRNA-sgPro-R (SEQ ID NO. 68, ctagctctaaaacgtcgtcacctatattacggaacgtcaacctgcgccgacccggaat) to amplify the sgRNA promoter and the sgRNA module at the D17 site. The sgRNA and its sgRNA terminator module were amplified using primers D17sgRNA-F (SEQ ID NO.69, tccgtaatataggtgacgacgttttagagctagaaatagcaagttaaaataaggctag) and CU-NotI-D17sgTer-R (SEQ ID NO.70, ccacctgacgtctttagcggccgcattcTtcgactctagaggatctgggcctcgtgat).The above four fragments were seamlessly cloned and ligated with the linearized vector pCRISPRyl, which was double-digested with SacII and NotI, to obtain the plasmid pCRISPRyl-D17. After digestion with SpeI restriction endonuclease, the plasmid was purified and recovered to obtain the linearized pCRISPRyl-D17 vector.

[0064] The recombinant plasmid pCRISPRyl-D17::ERG19+ERG13 is based on pCRISPRyl-D17, digested with SpeI restriction endonuclease, and then inserted into the ERG19 expression cassette (P). FBAin -ERG19-Tsynth7t) and ERG13 expression cassette (P TEFin -ERG13-T xpr2t ).

[0065] Using uHAD17-FBAin-F and ERG19-FBAin-R as primers and Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, the promoter PFBAin of the ERG19 expression cassette was amplified. Using Tsynth7-TEFin-F and ERG13-TEFin-R as primers and Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, the promoter PTEFin of the ERG13 expression cassette was amplified. Using ERG13-xpr2t-F and dHAD17-xpr2t-R as primers and Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, the terminator Txpr2t of the ERG13 expression cassette was amplified.

[0066] Using Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, primers FBAin-ERG19-F, tsynth7t-ERG19-R, tsynth7t-R, and TEFin-tsynth7t-R were used to amplify the ERG19 gene, which has homologous arms for the promoter PFBAin and the terminator Tsynth7t at both ends, respectively. Similarly, using Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, primers TEFin-ERG13-F and xpr2t-ERG13-R were used to amplify the ERG13 gene, which has homologous arms for the promoter PTEFI and the terminator Txpr2t at both ends, respectively.

[0067] After digesting the pCRISPRyl-D17 plasmid with the restriction endonuclease SpeI from Takara Bio, it was then processed using [a specific enzyme / method / technology] from Beijing TransGen Biotech Co., Ltd. The PCR Purification Kit was used to recover linearized pCRISPRyl-D17 plasmid.

[0068] Using Beijing Quanshijin Biotechnology Co., Ltd. The Basic Seamless Cloning and Assembly Kit was used to seamlessly clone the linearized pCRISPRyl-D17 plasmid, ERG19 gene, ERG13 gene, and their components (promoter PFBAin and terminator Tsynth7t). The resulting recombinant vector was then transformed into E. coli DH5α competent cells. The recombinant plasmid pCRISPRyl-D17::ERG19+ERG13 was obtained by screening with ampicillin-resistant plates and verifying the results through colony PCR and sequencing.

[0069] 4. Construction of recombinant plasmid pCRISPRyl-E153::ERG12+ERG8

[0070] pCRISPRyl-E153 backbone construction method: The plasmid pCRISPRyl (purchased) was double-digested with SacII and NotI restriction endonucleases, purified, and recovered to obtain the linearized vector pCRISPRyl. This linearized vector was then seamlessly cloned with a pre-designed sgRNA (SEQ ID NO.50, GTAGAGGTACGAAACAACAC) targeting the E153 site, along with its expression cassette and upstream and downstream homologous arms, to obtain the vector pCRISPRyl-E153. The specific steps are as follows:

[0071] Using Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, primers CU-SacII-uHAE153-F (SEQ ID NO.71, tttttcttttttttctgtacagacgcgtccgcggcttgacgagctgtgagcgggccaga) and dHA-SpeI-uHAE153-R (SEQ ID NO.72, cgtatctagatcaagcacattttcccactagttgttgttgagagtgcgtttggtgtcct) were used to amplify the upper 1000bp of the E153 site sgRNA sequence as the upper homologous arm uHAE153; primers uHA-SpeI-dHAE153-F (SEQ ID NO.71, tttttcttttttttctgtacagacgcgttcct) were used to amplify the upper 1000bp of the E153 site sgRNA sequence as the upper homologous arm uHAE153; primers uHA-SpeI-dHAE153-F (SEQ ID NO.72, dHA-SpeI-dHAE153-R) were used to amplify the upper 1000bp of the E153 site sgRNA sequence as the upper homologous arm uHAE153. NO.73, gcactctcaacaacaactagtgggaaaatgtgcttgatctagatacgcgattctg) and sgRNA-dHAE153-R (SEQ ID NO.74, cagatctagagttgtgtcaacttttgcaactgggaaatggggccgcgactttgcctccc) amplify the lower 1000bp of the sgRNA sequence at the E153 site as the lower homologous arm dHAE153. Using plasmid pUC-sgRNAPro+Ter (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) as a template, primers dHAE153-sgPro-F (SEQ ID NO.75, cccagttgcaaaagttgacacaactctagatctgc) and E153sgRNA-sgPro-R (SEQ ID NO.76, ctagctctaaaacgtgttgtttcgtacctctacacgtcaacctgcgccgacccggaat) were used to amplify the sgRNA promoter and the sgRNA module at the E153 site. The sgRNA and its sgRNA terminator module were amplified using primers E153sgRNA-F (SEQ ID NO.77, tagaggtacgaaacaacacgttttagagctagaaatagcaagttaaaataaggctagt) and CU-NotI-E153sgTer-R (SEQ ID NO.78, ccacctgacgtctttagcggccgcattcttcgactctagaggatctgggcctcgtgat).The above four fragments were seamlessly cloned and ligated with the linearized vector pCRISPRyl, which was double-digested with SacII and NotI, to obtain the plasmid pCRISPRyl-E153. After digestion with SpeI restriction endonuclease, the plasmid was purified and recovered to obtain the linearized pCRISPRyl-E153 vector.

[0072] The recombinant plasmid pCRISPRyl-E153::ERG12+ERG8 is based on pCRISPRyl-E153, digested with SpeI restriction endonuclease, and then inserted into the ERG12 expression cassette (P). FBAin -ERG12-Tsynth7t) and ERG8 expression cassette (P TEFin -ERG8-T xpr2t ).

[0073] Using uHAE153-FBAin-F and ERG12-FBAin-R as primers and Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, the promoter PFBAin of the ERG12 expression cassette was amplified. Using Tsynth7-TEFin-F and ERG8-TEFin-R as primers and Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, the promoter PTEFin of the ERG8 expression cassette was amplified. Using ERG8-xpr2t-F and dHAE153-xpr2t-R as primers and Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, the terminator Txpr2t of the ERG8 expression cassette was amplified.

[0074] Using Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, primers FBAin-ERG12-F, tsynth7t-ERG12-R, tsynth7t-R, and TEFin-tsynth7t-R were used to amplify the ERG12 gene, which has homologous arms for the promoter PFBAin and the terminator Tsynth7t at both ends, respectively. Similarly, using Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, primers TEFin-ERG8-F and xpr2t-ERG8-R were used to amplify the ERG8 gene, which has homologous arms for the promoter PTEFI and the terminator Txpr2t at both ends, respectively.

[0075] After digesting the pCRISPRyl-E153 plasmid with the restriction endonuclease SpeI from Takara Bio, the plasmid was then processed using [a specific enzyme / method / technology] from Beijing TransGen Biotech Co., Ltd. The PCR Purification Kit was used to recover linearized pCRISPRyl-E153 plasmid.

[0076] Using Beijing Quanshijin Biotechnology Co., Ltd. The Basic Seamless Cloning and Assembly Kit was used to seamlessly clone the linearized pCRISPRyl-E153 plasmid, ERG12 gene, ERG8 gene, and all elements (promoter PFBAin and terminator Tsynth7t). The resulting recombinant vector was then transformed into E. coli DH5α competent cells. The recombinant plasmid pCRISPRyl-E153::ERG12+ERG8 was obtained by screening with ampicillin-resistant plates and verifying the results through colony PCR and sequencing.

[0077] 5. Construction of recombinant plasmid pCRISPRyl-EXG2::CAT2

[0078] pCRISPRyl-EXG2 backbone construction method: The plasmid pCRISPRyl (purchased) was double-digested with SacII and NotI restriction endonucleases, purified, and recovered to obtain the linearized vector pCRISPRyl. This linearized vector was then seamlessly cloned with a pre-designed sgRNA (SEQ ID NO.51, GCCGATCTTGAGGCTCTCAA) targeting the EXG2 site, along with its expression cassette and upstream and downstream homologous arms, to obtain the vector pCRISPRyl-EXG2. The specific steps are as follows:

[0079] Using Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, primers CU-SacII-uHAEXG2-F (SEQ ID NO.79, ttcttttttttctgtacagacgcgtccgcggcgtacaatatctgccgtcctcgtaatac) and dHA-SpeI-uHAEXG2-R (SEQ ID NO.80, acactcatgctggacactcgtgtctcgactagtcgagtgtggtggtgttgtgtgaggag) were used to amplify the upper 1000bp of the EXG2 site sgRNA sequence as the upper homologous arm uHAEXG2; primers uHA-SpeI-dHAEXG2-F (SEQ ID NO.81, caccacactcgactagtcgagacacgagtgtccagcatgagtgtc) and sgRNA-dHAEXG2-R (SEQ ID NO.79) were used to amplify the upper 1000bp of the EXG2 site sgRNA sequence as the upper homologous arm uHAEXG2; primers uHA-SpeI-dHAEXG2-F (SEQ ID NO.81, caccacactcgactagtcgagacacgagtgtccagcatgagtgtc) and sgRNA-dHAEXG2-R (SEQ ID NO.79) were used to amplify the upper 1000bp of the EXG2 site sgRNA sequence as the upper homologous arm uHAEXG2. The lower 1000bp of the EXG2 site sgRNA sequence was amplified using the formula NO.82 (tctagagttgtgtcaacttttgcaactgggctgctggcgtttttgaaaacagttccttg) as the lower homologous arm dHAEXG2. Then, using plasmid pUC-sgRNAPro+Ter (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) as a template, primers dHAEXG2-sgPro-F (SEQ ID NO.83, caaaaacgccagcagcccagttgcaaaagttgacacaactctagatc) and EXG2sgRNA-sgPro-R (SEQ ID NO.84, tctagctctaaaacttgagagcctcaagatcggcacgtcaacctgcgccgacccggaat) were used to amplify the sgRNA promoter and the EXG2 site sgRNA module. The sgRNA and its sgRNA terminator module were amplified using primers EXG2sgRNA-F (SEQ ID NO.85, tgccgatcttgaggctctcaagttttagagctagaaatagcaagttaaaataaggctag) and CU-NotI-EXG2sgTer-R (SEQ ID NO.86, ccacctgacgtctttagcggccgcattcttcgactctagaggatctgggcctcgtgat).The above four fragments were seamlessly cloned and ligated with the linearized vector pCRISPRyl, which was double-digested with SacII and NotI, to obtain the plasmid pCRISPRyl-EXG2. The plasmid was then purified and recovered after digestion with SpeI restriction endonuclease to obtain the linearized pCRISPRyl-EXG2 vector.

[0080] The recombinant plasmid pCRISPRyl-EXG2::CAT2 is based on pCRISPRyl-EXG2, digested with SpeI restriction endonuclease, and then inserted into the CAT2 expression cassette (P). TEFin -CAT2-T xpr2t ).

[0081] Using uHAEXG2-TEFin-F and CAT2-TEFin-R as primers and Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, the promoter PTEFin of the CAT2 expression cassette was amplified. Using CAT2-xpr2t-F and dHAEXG2-xpr2t-R as primers and Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, the terminator Txpr2t of the CAT2 expression cassette was amplified.

[0082] Using Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, the CAT2 gene with homologous arms of promoter PTEFI and terminator Txpr2t at both ends was amplified using TEFin-CAT2-F and xpr2t-CAT2-R primers.

[0083] After digesting the pCRISPRyl-EXG2 plasmid with the restriction endonuclease SpeI from Takara Bio, it was then processed using [a specific enzyme / method / technology] from Beijing TransGen Biotech Co., Ltd. The PCR Purification Kit was used to recover linearized pCRISPRyl-EXG2 plasmid.

[0084] Using Beijing Quanshijin Biotechnology Co., Ltd. The Basic Seamless Cloning and Assembly Kit was used to seamlessly clone the linearized pCRISPRyl-EXG2 plasmid and the CAT2 gene and its components (promoter PTEFI and terminator Txpr2) to obtain a recombinant vector. This vector was then transformed into E. coli DH5α competent cells, screened by ampicillin-resistant plates, and verified by colony PCR and sequencing to obtain the recombinant plasmid pCRISPRyl-EXG2::CAT2.

[0085] 6. The empty vector plasmid pCRISPRyl-DGA2(dHADGA2-SpeI-uHADGA2) was preserved in the laboratory.

[0086] Construction method of pCRISPRyl-DGA2 empty vector plasmid: The plasmid pCRISPRyl (purchased) was purified and recovered after double digestion with two restriction endonucleases, SacII and NotI, to obtain the linearized vector pCRISPRyl. This linearized vector was then seamlessly cloned with a pre-designed sgRNA (SEQ ID NO.52, GGATGTTATGTCGTGAACGG) targeting the DGA2 site, along with its expression cassette and upstream and downstream homologous arms, to obtain the vector pCRISPRyl-DGA2. The specific steps are as follows:

[0087] Using Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, primers CU-SacII-uHADGA2-F (SEQ ID NO. 87, tttttcttttttttctgtacagacgcgtccgcggatgtacggcgaaggagcgataatcg) and dHA-SpeI-uHADGA2-R (SEQ ID NO. 88, gctactgatgagtgttatgactagtaggtggtgttggtaaatatagcttaactgttatc) were used to amplify the upper 1000bp of the sgRNA sequence at the DGA2 site as the upper homologous arm uHADGA2; primers uHA-SpeI-dHADGA2-F (SEQ ID NO. 89, aagctatatttaccaacaccacctactagtcataacactcatcagtagcctttacagtg) and sgRNA-dHADGA2-R (SEQ ID NO. 88) were used to amplify the upper 1000bp of the sgRNA sequence at the DGA2 site as the upper homologous arm uHADGA2; primers uHA-SpeI-dHADGA2-F (SEQ ID NO. 89, aagctatatttaccaacaccacctactagtcataacactcatcagtagcctttacagtg) and sgRNA-dHADGA2-R (SEQ ID NO. 88) were used to amplify the upper 1000bp of the sgRNA sequence at the DGA2 site as the upper homologous arm uHADGA2. The lower 1000bp of the DGA2 site sgRNA sequence was amplified using the plasmid pUC-sgRNAPro+Ter (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) as a lower homologous arm dHADGA2. Then, using primers dHADGA2-sgPro-F (SEQ ID NO.91, ctcaggctaattacttctaatgcgcccagttgcaaaagttgacacaactctagatctgc) and DGA2sgRNA-sgPro-R (SEQ ID NO.92, tctagctctaaaacccgttcacgacataacatccacgtcaacctgcgccgacccggaat) to amplify the sgRNA promoter and the sgRNA module at the DGA2 site. The sgRNA and its sgRNA terminator module were amplified using primers DGA2sgRNA-F (SEQ ID NO.93, cgtggatgttatgtcgtgaacgggttttagagctagaaatagcaagttaaaataaggct) and CU-NotI-DGA2sgTer-R (SEQ ID NO.94, gccacctgacgtctttagcggccgcattcttcgactctagaggatctgggcctcgtga).The above four fragments were seamlessly cloned and ligated with the linearized vector pCRISPRyl, which was double-digested with SacII and NotI, to obtain the plasmid pCRISPRyl-DGA2.

[0088] 7. Construction of recombinant plasmid pCRISPRyl-AXP::SsSL

[0089] pCRISPRyl-AXP backbone construction method: The plasmid pCRISPRyl (purchased) was double-digested with SacII and NotI restriction endonucleases, purified, and recovered to obtain the linearized vector pCRISPRyl. This linearized vector was then seamlessly cloned with a pre-designed sgRNA (SEQ ID NO.53, GATACTCCTGGACGTCCAGA) targeting the AXP site, along with its expression cassette and upstream and downstream homologous arms, to obtain the vector pCRISPRyl-AXP. The specific steps are as follows:

[0090] Using Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, primers CU-SacII-uHAAXP-F (SEQ ID NO. 95, tcttttttttctgtacagacgcgtccgcgggaacggcaccagctggttaatgtggggt) and dHA-SpeI-uHAAXP-R (SEQ ID NO. 96, ttttctggtacaaccacttttactagtttcgacctggtcctcagtcattgcctctggt) were used to amplify the upper 1000bp of the sgRNA sequence at the AXP site as the upper homologous arm uHAAXP; primers uHA-SpeI-dHAAXP-F (SEQ ID NO. 97, actgaggaccaggtcgaaactagtaaaagtggttgtaccagaaaacagatccacaagt) and sgRNA-dHAAXP-R (SEQ ID NO. 96) were used to amplify the upper 1000bp of the sgRNA sequence at the AXP site as the upper homologous arm uHAAXP. The lower 1000bp of the AXP site sgRNA sequence was amplified using the plasmid pUC-sgRNAPro+Ter (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) as a lower homologous arm dHAAXP. Then, using primers dHAAXP-sgPro-F (SEQ ID NO. 99, caggttcaacattgttggatgcaattcccagttgcaaaagttgacacaactctaga) and AXPsgRNA-sgPro-R (SEQ ID NO. 100, ctaaaactctggacgtccaggagtatcacgtcaacctgcgccgacccgga) to amplify the sgRNA promoter and AXP site sgRNA module. The sgRNA and its sgRNA terminator module were amplified using primers AXPsgRNA-F (SEQ ID NO.101, atactcctggacgtccagagttttagagctagaaatagcaagttaaaataaggctagt) and CU-NotI-AXPsgTer-R (SEQ ID NO.102, ccacctgacgtctttagcggccgcattcttcgactctagaggatctgggcctcgtgat).The above four fragments were seamlessly cloned and ligated with the linearized vector pCRISPRyl, which was double-digested with SacII and NotI, to obtain the plasmid pCRISPRyl-AXP. After digestion with SpeI restriction endonuclease, the pCRISPRyl-AXP vector was purified and recovered to obtain the linearized vector.

[0091] Primers (uHAAXP-TEFin-F and dHAAXP-xpr2t-R) were designed based on the AXP site of Yarrowia lipolytica, and the remaining steps were the same as those for the construction of recombinant plasmid pCRISPRyl-D069::SsSL.

[0092] 8. Construction of recombinant plasmid pCRISPRyl-F262::SsSL

[0093] pCRISPRyl-F262 backbone construction method: The plasmid pCRISPRyl (purchased) was double-digested with SacII and NotI restriction endonucleases, purified, and recovered to obtain the linearized vector pCRISPRyl. This linearized vector was then seamlessly cloned with a pre-designed sgRNA (SEQ ID NO.54, ACTGCTCTAGAGACTTCCGA) targeting the F262 site, along with its expression cassette and upstream and downstream homologous arms, to obtain the vector pCRISPRyl-F262. The specific steps are as follows:

[0094] Using Yarrowia lipolytica Po1fΔku70 genomic DNA as a template, primers CU-SacII-uHAF262-F (SEQ ID NO.103, cttttttttctgtacagacgcgtccgcggagatggaagagtgtgtttgattctgttcat) and dHA-SpeI-uHAF262-R (SEQ ID NO.104, gtactgtagactcgtgggcactagttgatctaaaccgtcccaaagccgttc) were used to amplify the upper 1000bp of the sgRNA sequence at the F262 site as the upper homologous arm uHAF262; primers uHA-SpeI-dHAF262-F (SEQ ID NO.105, cggtttagatcaactagtgcccacgagtctacagtacgaatacc) and sgRNA-dHAF262-R (SEQ ID NO.104) were used to amplify the upper 1000bp of the sgRNA sequence at the F262 site as the upper homologous arm uHAF262; primers uHA-SpeI-dHAF262-F (SEQ ID NO.105, cggtttagatcaactagtgcccacgagtctacagtacgaatacc) and sgRNA-dHAF262-R (SEQ ID NO.105) were used to amplify the sgRNA sequence at the F262 site as the upper homologous arm uHAF262. The lower 1000bp of the sgRNA sequence at the F262 site was amplified using the plasmid pUC-sgRNAPro+Ter (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) as a lower homologous arm dHAF262. Then, using primers dHAF262-sgPro-F (SEQ ID NO.107, cccagttgcaaaagttgacacaactctagatctgc) and F262sgRNA-sgPro-R (SEQ ID NO.108, ctagctctaaaactcggaagtctctagagcagtacgtcaacctgcgccgacccggaat) to amplify the sgRNA promoter and the sgRNA module at the F262 site. The sgRNA and its sgRNA terminator module were amplified using primers F262sgRNA-F (SEQ ID NO.109, acgtactgctctagagacttccgagttttagagctagaaatagcaagttaaaataaggc) and CU-NotI-F262sgTer-R (SEQ ID NO.110, ccacctgacgtctttagcggccgcattcTtcgactctagaggatctgggcctcgtgat).The above four fragments were seamlessly cloned and ligated with the linearized vector pCRISPRyl, which was double-digested with SacII and NotI, to obtain the plasmid pCRISPRyl-F262. After digestion with SpeI restriction endonuclease, the plasmid was purified and recovered to obtain the linearized pCRISPRyl-F262 vector.

[0095] Primers (uHAF262-TEFin-F and dHAF262-xpr2t-R) were designed based on the F262 site of Yarrowia lipolytica, and the remaining steps were the same as those for the construction of recombinant plasmid pCRISPRyl-D069::SsSL.

[0096] In this embodiment, the PCR amplification systems for each recombinant plasmid construction process are shown in Table 2, the double enzyme digestion systems are shown in Table 3, and the seamless cloning systems are shown in Table 4. The PCR amplification reaction program is as follows: pre-denaturation 95℃, 10 min; denaturation 95℃, 20 s; annealing 62℃, 20 s; extension 72℃, 1 min / kb; cycle to 2, 5 cycles; denaturation 95℃, 15 s; annealing 60℃, 15 s; extension 72℃, 1 min / kb; cycle to 6, 15 cycles; denaturation 95℃, 15 s; annealing 58℃, 15 s; extension 72℃, 1 min / kb; cycle to 10, 11 cycles; final extension 72℃, 10 min; cooling and storage at 12℃, 5 min.

[0097] Table 2 PCR amplification system

[0098] Primer F 2μL Primer R 2μL 2×PhantaMaxBuffer 25μL dNTPMix 1μL Gene template 1μL PhantaMaxSuper-FidelityDNAPolymeras 1μL Ultrapure water 18μL

[0099] Table 3. Double enzyme digestion system

[0100] plasmid 50μL Ultrapure water 40μL Buffer 10μL Restriction endonuclease KpnI 3μL Restriction endonuclease PmlI 3μL

[0101] Table 4. Seamless Cloning System

[0102] 2×BasicAssemblyMix 6μL Linearized plasmid backbone 2μL Inserted gene fragment 4μL

[0103] In this embodiment, the gene insertion details of each recombinant plasmid are shown in Table 5, and the primers used in the construction process are shown in Table 6.

[0104] Table 5. Inserted sequences in each recombinant plasmid

[0105]

[0106] Table 6 Primer Names

[0107]

[0108]

[0109]

[0110]

[0111] Example 2 Construction of recombinant bacteria

[0112] The competent cells and recombinant plasmids corresponding to each recombinant bacterium are shown in Table 7.

[0113] Table 7. Competent cells and recombinant plasmids corresponding to each recombinant bacterium.

[0114] CJ-1 YarrowialipolyticaPo1f-tHEI pINA1269-tPaGGPPS-SsSL CJ-2 CJ-1 pCRISPRyl-D069::SsSL CJ-3 CJ-2 pCRISPRyl-D17::ERG19+ERG13 CJ-4 CJ-3 pCRISPRyl-E153::ERG12+ERG8 CJ-5 CJ-4 pCRISPRyl-EXG2::CAT2 CJ-6 CJ-5 pCRISPRyl-DGA2 CJ-7 CJ-6 pCRISPRyl-AXP::SsSL CJ-8 CJ-7 pCRISPRyl-F262::SsSL

[0115] 1. Construction of recombinant strain CJ-1

[0116] As shown in Table 7, the pINA1269-tPaGGPPS-SsSL constructed in Example 1 was introduced into *Yarrowia lipolytica* Po1f-tHEI (this strain is disclosed in "Constructing a green oleaginous yeast cell factory for sustainable production of the plant-derived diterpenoid sclareol," with a commitment to release it for 20 years; in this literature, the strain is named Po1f-Δku70,ΔIntC::tHMC,ΔSCP2::ERG20; this strain is also disclosed in Chinese patent application with publication number "CN116656518A," and is recombinant strain 1 in Example 2 of that application), to obtain recombinant strain CJ-1. The specific method is as follows:

[0117] (1) After digesting the pINA1269-tPaGGPPS-SsSL plasmid with the restriction endonuclease BsrGI from Takara, the plasmid was processed using the enzyme from Beijing TransGen Biotech Co., Ltd. The PCR Purification Kit was used to recover the linearized pINA1269-tPaGGPPS-SsSL plasmid.

[0118] (2) Yarrowia lipolytica Po1f-tHEI was cultured in YPD liquid medium for 24 h and then used to prepare competent cells.

[0119] (3) The linearized recombinant plasmid was transformed into competent Yarrowialipolytica Po1f-tHEI cells using the Zymogen Frozen EZ YeastTransformation Kit II from Zymo Research Corporation, and then plated for screening. YNB-URA yeast screening medium was used for screening.

[0120] 2. Construction of recombinant strain CJ-2

[0121] As shown in Table 7, the pCRISPRyl-D069::SsSL constructed in Example 1 was introduced into the competent cells of recombinant bacteria CJ-1 to obtain recombinant bacteria CJ-2. The specific method is as follows:

[0122] (1) Recombinant bacteria CJ-1 was cultured in YPD liquid medium for 24 hours and then used to prepare competent cells.

[0123] (2) The recombinant plasmid pCRISPRyl-D069::SsSL was transformed into competent cells of recombinant strain CJ-1 using the Zymogen Frozen EZ YeastTransformation Kit II from Zymo Research Corporation, and then plated for screening. YNB screening medium was used. Positive clones identified by PCR were activated and streaked onto plates containing 5-FOA-YPD, and incubated at 30°C for 3 days. Single colonies were streaked simultaneously onto both YNB-URA and YNB screening media to observe cell growth. Single colonies that grew on YNB-URA but not on YNB were re-identified by PCR. Positive clones containing the free knock-in / knockout plasmid containing URA were successfully discarded and named recombinant strain CJ-2.

[0124] 3. Construction of recombinant strain CJ-3

[0125] As shown in Table 7, the pCRISPRyl-D17::ERG19+ERG13 constructed in Example 1 was introduced into the competent cells of recombinant bacteria CJ-2 to obtain recombinant bacteria CJ-3. The specific method is as follows:

[0126] (1) Recombinant bacteria CJ-2 was cultured in YPD liquid medium for 24 hours and then used to prepare competent cells.

[0127] (2) The recombinant plasmid pCRISPRyl-D17::ERG19+ERG13 was transformed into competent cells of recombinant strain CJ-2 using the Zymogen Frozen EZ YeastTransformation Kit II from Zymo Research Corporation, and then plated for screening. YNB yeast selection medium was used for screening. Positive clones identified by PCR were activated and streaked onto plates containing 5-FOA-YPD, and incubated at 30°C for 3 days. Single colonies were streaked simultaneously on YNB-URA and YNB plates to observe cell growth. Single colonies that grew on YNB-URA but not on YNB were re-identified by PCR. Positive clones containing the free knock-in / knockout plasmid containing URA were successfully discarded and named recombinant strain CJ-3.

[0128] 4. Construction of recombinant strain CJ-4

[0129] As shown in Table 7, the pCRISPRyl-E153::ERG12+ERG8 constructed in Example 1 was introduced into the competent cells of recombinant bacteria CJ-3 to obtain recombinant bacteria CJ-4. The specific method is as follows:

[0130] (1) Recombinant bacteria CJ-3 was cultured in YPD liquid medium for 24 hours and then used to prepare competent cells.

[0131] (2) The recombinant plasmid pCRISPRyl-E153::ERG12+ERG8 was transformed into competent cells of recombinant strain CJ-3 using the Zymogen Frozen EZ YeastTransformation Kit II from Zymo Research Corporation, and then plated for screening. YNB yeast selection medium was used for screening. Positive clones identified by PCR were activated and streaked onto plates containing 5-FOA-YPD, and incubated at 30°C for 3 days. Single colonies were streaked simultaneously onto both YNB-URA and YNB yeast selection medium plates to observe cell growth. Single colonies that grew on YNB-URA but not on YNB were re-identified by PCR. Positive clones containing the free knock-in / knockout plasmid containing URA were successfully discarded and named recombinant strain CJ-4.

[0132] 5. Construction of recombinant strain CJ-5

[0133] As shown in Table 7, the pCRISPRyl-EXG2::CAT2 constructed in Example 1 was introduced into the competent cells of recombinant bacteria CJ-4 to obtain recombinant bacteria CJ-5. The specific method is as follows:

[0134] (1) Recombinant bacteria CJ-4 was cultured in YPD liquid medium for 24 hours and then used to prepare competent cells.

[0135] (2) The recombinant plasmid pCRISPRyl-EXG2::CAT2 was transformed into competent CJ-4 cells using the Zymogen Frozen EZ YeastTransformation Kit II from Zymo Research Corporation, and then plated for screening. YNB yeast selection medium was used for screening. Positive clones identified by PCR were activated and streaked onto plates containing 5-FOA-YPD, and incubated at 30°C for 3 days. Single colonies were streaked simultaneously onto both YNB-URA and YNB yeast selection medium plates to observe cell growth. Single colonies that grew on YNB-URA but not on YNB were re-identified by PCR. Positive clones containing the free knock-in / knockout plasmid containing URA were successfully discarded and named recombinant CJ-5.

[0136] 6. Construction of recombinant strain CJ-6

[0137] As shown in Table 7, pCRISPRyl-DGA2 stored in the laboratory was introduced into competent cells of recombinant bacteria CJ-5 to obtain recombinant bacteria CJ-6. The specific method is as follows:

[0138] (1) Recombinant bacteria CJ-5 was cultured in YPD liquid medium for 24 hours and then used to prepare competent cells.

[0139] (2) The empty vector plasmid pCRISPRyl-DGA2 was transformed into recombinant CJ-5 competent cells using the Zymogen Frozen EZ YeastTransformation Kit II from Zymo Research Corporation, and then plated for screening. YNB yeast selection medium was used for screening. Positive clones identified by PCR were activated and streaked onto plates containing 5-FOA-YPD, and incubated at 30°C for 3 days. Single colonies were streaked simultaneously onto both YNB-URA and YNB yeast selection medium plates to observe cell growth. Single colonies that grew on YNB-URA but not on YNB were re-identified by PCR. Positive clones containing the free knock-in / knockout plasmid containing URA were successfully discarded and named recombinant CJ-6.

[0140] 7. Construction of recombinant strain CJ-7

[0141] As shown in Table 7, the pCRISPRyl-AXP::SsSL constructed in Example 1 was introduced into the competent cells of recombinant bacteria CJ-6 to obtain recombinant bacteria CJ-7. The specific method is as follows:

[0142] (1) Recombinant bacteria CJ-6 was cultured in YPD liquid medium for 24 hours and then used to prepare competent cells.

[0143] (2) The recombinant plasmid pCRISPRyl-AXP::SsSL was transformed into competent CJ-6 cells using the Zymogen Frozen EZ YeastTransformation Kit II from Zymo Research Corporation, and then plated for screening. YNB yeast selection medium was used for screening. Positive clones identified by PCR were activated and streaked onto plates containing 5-FOA-YPD, and incubated at 30°C for 3 days. Single colonies were streaked simultaneously onto both YNB-URA and YNB yeast selection medium plates to observe cell growth. Single colonies that grew on YNB-URA but not on YNB were re-identified by PCR. Positive clones containing the free knock-in / knockout plasmid containing URA were successfully discarded and named recombinant CJ-7.

[0144] 8. Construction of recombinant strain CJ-8

[0145] As shown in Table 7, the pCRISPRyl-F262::SsSL constructed in Example 1 was introduced into the competent cells of recombinant bacteria CJ-7 to obtain recombinant bacteria CJ-8. The specific method is as follows:

[0146] (1) Recombinant bacteria CJ-7 was cultured in YPD liquid medium for 24 hours and then used to prepare competent cells.

[0147] (2) The recombinant plasmid pCRISPRyl-F262::SsSL was transformed into competent CJ-7 cells using the Zymogen Frozen EZ YeastTransformation Kit II from Zymo Research Corporation, and then plated for screening. YNB yeast selection medium was used for screening. Positive clones identified by PCR were activated and streaked onto plates containing 5-FOA-YPD, and incubated at 30°C for 3 days. Single colonies were streaked simultaneously onto both YNB-URA and YNB yeast selection medium plates to observe cell growth. Single colonies that grew on YNB-URA but not on YNB were re-identified by PCR. Positive clones containing the free knock-in / knockout plasmid containing URA were successfully discarded and named recombinant CJ-8.

[0148] Example 3

[0149] 1. Fermentation culture and product processing of engineered yeast

[0150] Fermentation culture of engineered yeast:

[0151] The recombinant bacteria CJ-1, CJ-2, CJ-3, CJ-4, CJ-5, CJ-6, CJ-7, and CJ-8 constructed in Example 2 were used to produce perillaldehyde through fermentation. The specific method is as follows: The recombinant bacteria were activated, streaked onto YPD solid medium, and cultured at 30°C for 36 hours to obtain single colonies. Multiple single colonies were picked and inoculated into 5 mL of YPD fermentation medium and cultured for 30 hours to obtain seed culture (OD). 600 =6), then with the initial OD 600 An inoculum of 0.5 g was inoculated into 50 mL of YPD fermentation medium. After fermentation at 30 °C and 220 rpm for 12 h, 10% of the fermentation liquid volume of n-dodecane was added, and the mixture was cultured with shaking for another 6 days.

[0152] Treatment of fermentation products:

[0153] After fermentation, the fermentation broth was transferred to a 50 mL centrifuge tube, centrifuged at 7500 rpm for 8 min, and the top organic phase was collected for later use.

[0154] 2. Qualitative and quantitative analysis of perillyl alcohol

[0155] Perillyl alcohol detection:

[0156] The fermentation products of each recombinant strain were diluted 10 times with n-dodecane, filtered through an oil-based nylon membrane (0.22 μm), and detected by gas chromatography-mass spectrometry (GC-MS).

[0157] GC-MS detection conditions: Injector temperature 250℃, injection volume 1μL, splitless; Column: Agilent HP-5ms (30m×250μm×0.25μm); Chromatographic conditions: Initial temperature 60℃, increased to 160℃ at a rate of 10℃ / min, held for 1 min, then increased to 280℃ at a rate of 40℃ / min, held for 4 min. The entire gas chromatographic program lasted 18 min. Qualitative and quantitative analysis was performed using perillaldehyde standards.

[0158] The GC-MS results are shown in Table 8. The recombinant strain CJ-8 produced the highest yield of perillaldehyde, reaching 2747.50 mg / L, meaning 2747.50 mg of perillaldehyde was produced per liter of fermentation broth. The GC-MS chromatogram of perillaldehyde produced by recombinant strain CJ-8 after 6 days of fermentation is shown in Table 8. Figure 2 The results in Table 8 show that strain CJ-8 has a significantly enhanced ability to produce perillyl alcohol, indicating that the production of perillyl alcohol can be significantly increased by introducing truncated geraniol pyrophosphate synthase tPaGGPPS, multiple copy expression of SsSL fusion protein, enhancing the ERG19, ERG13, ERG12 and ERG8 genes in the MVA pathway, and regulating acetyl-CoA metabolic flux.

[0159] Table 8. Perillyl alcohol yield from different strains

[0160] Yarrowia lipolytica Po1f-tHEI 0 CJ-1 29.83 CJ-2 342.68 CJ-3 445.93 CJ-4 858.11 CJ-5 931.30 CJ-6 1113.17 CJ-7 1898.56 CJ-8 2747.50

[0161] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A recombinant lipophilic yeast that produces high levels of perillaldehyde (Yersinia lipolytica) Yarrowia lipolytica ) bacteria, characterized in that, Using *Yersinia lipolytica* as the initial strain, an expression cassette containing the genes tPaGGPPS (geranyl geranyl pyrophosphate synthase), SsSCS (perillyl alcohol synthase), SsLPPS (lysine pyrophosphate diol ester synthase), ERG19 (mevalonate pyrophosphate decarboxylase), ERG13 (3-hydroxy-3-methylglutaryl-CoA synthase), ERG12 (mevalonate kinase), ERG8 (mevalonate phosphate kinase), and CAT2 (carnitine O-acetyltransferase) was introduced, while the diacylglycerol acyltransferase DGA2 gene was knocked out to obtain the recombinant *Yersinia lipolytica*. The nucleotide sequence of the geraniol pyrophosphate synthase tPaGGPPS gene is shown in SEQ ID NO.1; the nucleotide sequence of the perillyl alcohol synthase SsSCS gene is shown in SEQ ID NO.2; and the nucleotide sequence of the lysine pyrophosphate diol ester synthase SsLPPS gene is shown in SEQ ID NO.

3. The copy number of the perilla syrup synthase SsSCS gene is 4 copies, and the copy number of the lysine pyrophosphate diol synthase SsLPPS gene is 4 copies. The accession number for the mevalonate pyrophosphate decarboxylase ERG19 gene is GenBank: 2907970; the accession number for the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 gene is GenBank: 2907642; the accession number for the mevalonate kinase ERG12 gene is GenBank: 2906793; the accession number for the mevalonate phosphate kinase ERG8 gene is GenBank: 2912386; the accession number for the carnitine O-acetyltransferase CAT2 gene is GenBank: 2906787; and the accession number for the diacylglycerol acyltransferase DGA2 gene is GenBank: 2910950. The initial strain was Yersinia lipophila Po1f-tHEI.

2. The recombinant Yersinia lipolyticis according to claim 1, characterized in that, The promoter of the expression box is PFBAin, Php4d, or PTEFI, and the terminator is Tsynth7t or Txpr2t.

3. The method for constructing recombinant Yersinia lipophila according to claim 1, characterized in that, Includes the following steps: The expression cassette containing the geraniol pyrophosphate synthase tPaGGPPS gene, perillyl alcohol synthase SsSCS gene, lysine pyrophosphate diol ester synthase SsLPPS gene, mevalonate pyrophosphate decarboxylase ERG19 gene, 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 gene, mevalonate kinase ERG12 gene, mevalonate phosphate kinase ERG8 gene, and carnitine O-acetyltransferase CAT2 gene was introduced into the initial strain in plasmid form, and the diacylglycerol acyltransferase DGA2 gene was knocked out to obtain the recombinant Yersinia lipolytica. The copy number of the perilla syrup synthase SsSCS gene is 4 copies, and the copy number of the lysine pyrophosphate diol synthase SsLPPS gene is 4 copies. The accession number for the mevalonate pyrophosphate decarboxylase ERG19 gene is GenBank: 2907970; the accession number for the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 gene is GenBank: 2907642; the accession number for the mevalonate kinase ERG12 gene is GenBank: 2906793; the accession number for the mevalonate phosphate kinase ERG8 gene is GenBank: 2912386; the accession number for the carnitine O-acetyltransferase CAT2 gene is GenBank: 2906787; and the accession number for the diacylglycerol acyltransferase DGA2 gene is GenBank: 2910950. The initial strain was *Yarrowia lipophila* Po1f-tHEI; The promoter of the expression box is PFBAin, Php4d, or PTEFI, and the terminator is Tsynth7t or Txpr2t.

4. The application of the recombinant Yersinia lipolytica according to claim 1 or 2 in the production of perillaldehyde.

5. A method for producing perillyl alcohol, characterized in that, The step includes the production of perillaldehyde by fermentation using the recombinant Yersinia lipophila as described in claim 1 or 2.

Citation Information

Patent Citations

  • Recombinant yarrowia lipolytica with high yield of beta-elemene as well as construction method and application of recombinant yarrowia lipolytica

    CN116656518A

  • Recombinant yarrowia lipolytica with high yield of beta-elemene as well as construction method and application thereof

    CN117660516A

  • Recombinant yarrowia lipolytica capable of efficiently and rapidly producing sclareol as well as construction method and application of recombinant yarrowia lipolytica

    CN119351238A