Promoter pgj1 for root-specific expression and use thereof

Abstract

The present application relates to the technical field of plant breeding, and provides a root-specific expression promoter Pgj1 and application thereof, wherein the nucleotide sequence of the promoter Pgj1 is shown as SEQ ID NO. 1. The promoter Pgj1 provided in the present application can be specifically expressed in soybean roots, and a target gene driven by the promoter can be specifically expressed in soybean roots. The promoter has high application value in plant gene expression regulation research and soybean breeding improvement.

Description

Technical Field

[0001] This invention relates to the field of plant breeding technology, and in particular to a root-specific expression promoter Pgj1 and its applications. Background Technology

[0002] Roots are vital organs for plant growth and development. The isolation and identification of root-specific promoters are of great significance for improving traits such as root morphology, nutrient absorption, abiotic stresses such as salt and drought, and root diseases and pests through engineering techniques.

[0003] Upstream promoters, as crucial elements in gene expression regulation, control gene expression under various spatial, temporal, and environmental conditions. Highly active promoters hold significant promise for applications in plant gene function research and genetic breeding. Currently, constitutive strong promoters are widely used in plant genetic engineering, such as the 35S promoter of cauliflower mosaic virus (CaMV) and the Ubiquitinqin promoter of maize. However, exogenous viral promoters pose potential biosafety risks, and endogenous constitutive promoters often fail to provide adequate control over the timing or location of target gene expression, leading to limited improvement effects or excessive accumulation of the target protein within the plant, thus hindering normal growth and development. These are obstacles currently hindering the use of constitutive strong promoters to initiate functional genes for targeted crop improvement through genetic engineering.

[0004] Therefore, isolating and obtaining promoters with specific expression characteristics is of particular importance for plant functional gene research and crop genetic improvement. Summary of the Invention

[0005] The purpose of this invention is to provide a root-specific promoter Pgj1 and its applications, overcoming the lack of existing endogenous specific promoters in soybean. This invention, through the study of soybean transcriptome data, screened for the gene Glyma.05G216000.1, which is specifically and abundantly expressed in roots, and cloned its promoter sequence, naming it Pgj1. Studies have shown that RT-qPCR detection revealed the highest expression abundance of the Glyma.05G216000.1 gene in soybean roots. Transplantation of the Pgj1-DsRed recombinant plasmid into soybeans yielded transgenic soybean plants. Further observation of the red fluorescence produced by the Pgj1 promoter initiating DsRed confirmed the root-specific expression characteristics of the Pgj1 promoter in soybean roots.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] The present invention provides a root-specific expression promoter Pgj1, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] This invention also provides the application of the aforementioned promoter Pgj1 in root-specific expression in plants.

[0009] The present invention also provides a primer set for amplifying the promoter Pgj1, the primer set including an upstream primer Pgj1-F1 and a downstream primer Pgj1-R1, the sequence of the upstream primer Pgj1-F1 is shown in SEQ ID NO.4, and the sequence of the downstream primer Pgj1-R1 is shown in SEQ ID NO.5.

[0010] The present invention also provides the application of the promoter Pgj1 in the construction of root-specific expression recombinant vectors.

[0011] The present invention also provides a root-specific expression recombinant vector, wherein the recombinant vector is a pCAMBIA3300 vector containing the promoter Pgj1.

[0012] The present invention also provides the application of the root-specific expression recombinant vector in the construction of root-specific expression recombinant bacteria.

[0013] The present invention also provides a root-specific expression recombinant bacterium, wherein the recombinant bacterium is Agrobacterium containing the root-specific expression recombinant vector.

[0014] The present invention also provides the application of the aforementioned root-specific expression recombinant bacteria in the construction of root-specific expression transgenic plants.

[0015] The present invention also provides a method for constructing a root-specific expression transgenic plant using the aforementioned root-specific expression recombinant bacteria, comprising the following steps: infecting a plant with the aforementioned root-specific expression recombinant bacteria to obtain the transgenic plant.

[0016] Preferably, the plant species is soybean.

[0017] This invention provides a root-specific expression promoter Pgj1 and its applications. The nucleotide sequence of promoter Pgj1 is shown in SEQ ID NO.1. The promoter Pgj1 provided by this invention can be specifically expressed in soybean roots, and the target gene driven by this promoter can achieve specific expression in soybean roots. This promoter has high application value in plant gene expression regulation research and soybean breeding improvement.

[0018] This invention, through the study of soybean transcriptome data, analyzed and screened to obtain the root-specific expression gene Glyma.05G216000.1. The DNA sequence 1518 bp upstream of its start site (named promoter Pgj1) was cloned from the soybean Williams 82 genome via PCR amplification. qRT-PCR analysis showed that the expression level of this gene in root tissue was significantly higher than in other tissues. By constructing a Pgj1-DsRed fusion expression vector and transforming it into soybean, tissue-specific detection showed that the DsRed red fluorescence signal was specifically enriched in roots, while no significant expression was detected in stems, leaves, or other organs. Compared with existing technologies, Pgj1 exhibits root tissue specificity, providing a key regulatory element for elucidating root development mechanisms and for stress-resistant genetic engineering breeding. Attached Figure Description

[0019] Figure 1 The results of RT-qPCR detection of the Glyma.05G216000.1 gene in different tissue sites;

[0020] Figure 2 The results of PCR gel electrophoresis for cloning promoter Pgj1;

[0021] Figure 3 Prediction of the cis-acting element for promoter Pgj1;

[0022] Figure 4 Results of Pgj1 activation of red fluorescent protein in different tissue sites;

[0023] Figure 5 To obtain the pCAMBIA3300-Pgj1-DsRed expression vector. Detailed Implementation

[0024] This invention provides a root-specific expression promoter Pgj1, the nucleotide sequence of which is shown in SEQ ID NO.1;

[0025] SEQ ID NO.1:

[0026]

[0027] This invention also provides the application of the aforementioned promoter Pgj1 in root-specific expression in plants.

[0028] The present invention also provides a primer set for amplifying the promoter Pgj1, the primer set comprising an upstream primer Pgj1-F1 and a downstream primer Pgj1-R1.

[0029] The sequence of the upstream primer Pgj1-F1 is shown in SEQ ID NO.4;

[0030] SEQ ID NO.4:

[0031] 5'-CCCACCATTTTTGTTTCCGC-3'

[0032] The sequence of the downstream primer Pgj1-R1 is shown in SEQ ID NO.5:

[0033] SEQ ID NO.5:

[0034] 5'-GCTGATAAATTGAAGTGTGTGTTGC-3'.

[0035] The present invention also provides the application of the promoter Pgj1 in the construction of root-specific expression recombinant vectors.

[0036] The present invention also provides a root-specific expression recombinant vector, wherein the recombinant vector is a pCAMBIA3300 vector containing the promoter Pgj1.

[0037] The present invention also provides the application of the root-specific expression recombinant vector in the construction of root-specific expression recombinant bacteria.

[0038] The present invention also provides a root-specific expression recombinant bacterium, wherein the recombinant bacterium is Agrobacterium containing the root-specific expression recombinant vector.

[0039] The present invention also provides the application of the aforementioned root-specific expression recombinant bacteria in the construction of root-specific expression transgenic plants.

[0040] The present invention also provides a method for constructing a root-specific expression transgenic plant using the aforementioned root-specific expression recombinant bacteria, comprising the following steps: infecting a plant with the aforementioned root-specific expression recombinant bacteria to obtain the transgenic plant.

[0041] In this invention, the plant species is soybean.

[0042] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0043] Unless otherwise specified, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Test methods in the following examples that do not specify specific experimental conditions are generally performed under conventional experimental conditions or according to the manufacturer's recommended experimental conditions. Unless otherwise specified, the reagents and raw materials used in this invention are commercially available.

[0044] The soybean root-specific promoter Pgj1 involved in this embodiment of the invention can be obtained by amplification from the soybean genome, and the soybean variety Williams 82 described in this invention can be obtained from the National Crop Germplasm Resource Platform (website: http: / / www.cgris.net / home).

[0045] The cloning vector pEASY-Blunt, the plant expression vector pCAMBIA3300, and Agrobacterium EHA105 involved in the embodiments of the present invention can be obtained through conventional commercial means.

[0046] Example 1: Transcriptional levels of the Glyma.05G216000.1 gene in different tissues

[0047] Based on soybean transcriptome data analysis, a gene strongly expressed in soybean roots, Glyma.05G216000.1 (SEQ ID NO.6), was selected. The expression levels of the candidate gene Glyma.05G216000.1 in different soybean tissues and organs were verified using real-time quantitative PCR.

[0048] SEQ ID NO.6:

[0049] ATGGCCTCGTTCAGTGCCACAAAACCTGCAAAGTGAGCTGCCAACAGGAAAACCAGCACGCCTCGTTTGGGCAGAAAGTTTCTGACTTGTTCAAAGGGCATCAACATAATGACCACAGCTCCAATTATGCCACCCAAACCAAAGTGCTTTCCCAGTCAGGGTCAGGGTTAGGCCCCTTCACCACCAAAACTCAA ACACAATGCGGTTGCCCCCAAACACATCTCAGTACCACTCATGGCTCCAACACAAAAGGCCATGGCCATGGCCAAGGGAGAATTAAGAGGGAGCACAAGAGGGATGCTGCAGAACATCAAGGATCGCTTATCAGGTGACACCAGCAGCGACAGCGAGAGCGACAACGAAACTTGCCACAAGAGGAAGGACTGA.

[0050] The specific method is as follows:

[0051] Total RNA was extracted from tissue samples of soybean plants at maturity, including roots, leaves, stems, pods, and seeds. Real-time quantitative PCR was performed using specific primers Glyma.05G216000.1-F1 / Glyma.05G216000.1-R1.

[0052] The detection instrument was an ABIPRISM 7500 Fast Real-Time PCR System (Applied Biosystems, CA, USA), and the internal reference gene was GmACT6 (GenBank No. NM_001289231). A 2... –ΔΔCT The relative expression level of a gene was detected using the Livak method.

[0053] The RT-qPCR program is as follows: 94℃, 10 min; (94℃, 45 s; 60℃, 45 s; 72℃, 30 s) 35 cycles; 72℃, 10 min.

[0054] The RT-qPCR system consisted of 10 μL SYBR Green PCR Master Mix, 2 μL cDNA, 0.2 μL forward primer, 0.2 μL reverse primer, and ddH2O added to a final volume of 20 μL.

[0055] The results showed that the Glyma.05G216000.1 gene had the highest expression level in roots, while its expression was almost undetectable in other tissues such as leaves and stems. Figure 1Consistent with transcriptome data, this confirms the root-specific expression characteristics of the Glyma.05G216000.1 gene. The quantitative primer sequences are as follows:

[0056] Glyma.05G216000.1-F1:

[0057] ACCACAGCTCCAATTATGCCAC(SEQ ID NO.2);

[0058] Glyma.05G216000.1-R1:

[0059] CAGCATCCCTCTCTTGTGCT (SEQ ID NO. 3).

[0060] Example 2: Cloning of the Glyma.05G216000.1 gene promoter Pgj1

[0061] Specific primers were designed based on the promoter sequence of the soybean Glyma.05G216000.1 gene for PCR amplification. The amplification products were separated by electrophoresis on a 1% agarose gel (electrophoresis results are shown below). Figure 2 (As shown). The agarose gel containing the amplification product was excised and collected into centrifuge tubes, recovered using the Omega Gel Extraction Kit, and cloned into the pEASY-Blunt vector (purchased from Beijing TransGen Biotech Co., Ltd.). The clones were then transformed into competent cells (DH5α), and positive clones were obtained through antibiotic selection. After verification by colony PCR, sequencing confirmed that the inserted DNA fragment was 1518 bp. After confirming that the sequence was correct, the inventors named this sequence fragment the root-specific promoter Pgj1, and its nucleotide sequence is shown in SEQ ID NO.1.

[0062] The PCR program was as follows: 95℃, 3 min; (95℃, 30 sec; 60℃, 30 sec; 72℃, 2 min;) 30 cycles; 72℃, 10 min.

[0063] The PCR amplification system of this invention is as follows: 25 μL of high-fidelity enzyme mix, 2 μL of template, 1 μL of forward primer, 1 μL of reverse primer, and ddH2O added to 50 μL.

[0064] The amplification primers for the promoter Pgj1 of the Glyma.05G216000.1 gene are:

[0065] Forward primer Pgj1-F1:

[0066] 5'-CCCACCATTTTTGTTTCCGC-3' (SEQ ID NO. 4);

[0067] Reverse primer Pgj1-R1:

[0068] 5'-GCTGATAAATTGAAGTGTGTGTTGC-3' (SEQ ID NO. 5).

[0069] Example 3: Analysis of the cis-component function of promoter Pgj1

[0070] The cis-elements of the promoter Pgj1 sequence cloned in Example 1 were analyzed using PlantPAN 4.0 online software. The results showed that the promoter sequence contained CAT-box (GGCCAATCT), G-box (CACGTG), TATA-box (TATAWA), MYC (CACGTG), etc. Figure 3 ).

[0071] Example 4: Obtaining transgenic soybeans containing the pCAMBIA3300-Pgj1-DsRed expression vector

[0072] In this method, pCAMBIA3300 (purchased from Beijing TransGen Biotech Co., Ltd.) was digested with EcoRI and HindIII and then ligated with the red fluorescent protein reporter gene DsRed to obtain pCAMBIA3300-DsRed.

[0073] The promoter Pgj1 fragment of the Glyma.05G216000.1 gene cloned in the pEASY-Blunt vector was seamlessly ligated into the pCAMBIA3300-DsRed expression vector to obtain the pCAMBIA3300-Pgj1-DsRed expression vector. Figure 5 The vector plasmid was introduced into EHA105 (purchased from Beijing TransGen Biotech Co., Ltd.) to obtain recombinant Agrobacterium. Agrobacterium-mediated transformation was performed using the Agrobacterium-mediated transformation method, and the transformed variety was Jiyu 86. The specific transformation process is as follows:

[0074] (1) Pick a single colony carrying Agrobacterium EHA105 and inoculate it in 5mLYEP liquid medium (100mg / L spectinomycin, 25mg / L rifampin) and incubate overnight at 28℃. The next day, expand the culture (50mLYEP) until the OD 600nm is 0.6. After centrifuging at 3000rpm for 10min, the bacterial cells are resuspended in liquid co-culture medium (B5 salt 0.321g / L, sucrose 30g / L, MES 3.9g / L, BAP 1.67mg / L, GA 30.25 mg / L, cysteine ​​400mg / L, DTT 154.2mg / L, AS 200μmol / L, pH 5.4) and adjust the OD 600nm to 0.5 for use.

[0075] (3) Agrobacterium infection

[0076] Soybean seeds were split open along the hilum using a scalpel, the skin was removed, and slight incisions were made at the cotyledon nodes. The prepared explants were then placed in resuspended Agrobacterium for 30 min of infection. The infected explants were then transferred to a co-culture medium (B5 salt 0.321 g / L, sucrose 30 g / L, MES 3.9 g / L, BAP 1.67 mg / L, GA 30.25 mg / L, cysteine ​​400 mg / L, DTT 154.2 mg / L, AS 200 μmol / L, agar powder 5 g / L, pH 5.4) and incubated in the dark at 23°C for 4 days.

[0077] (4) Adventitious bud induction

[0078] After co-culturing the explants for 4 days, they were transferred to induction medium (B5 salt 3.21 g / L, sucrose 30 g / L, MES 0.59 g / L, BAP 1.67 mg / L, cephalosporin 250 mg / L, Timentin 100 mg / L, glufosinate 5 mg / L, agar powder 8 g / L, pH 5.7). The cotyledonary nodes and hypocotyl portions of the explants were inserted into the medium with the adaxial surface facing upwards at a 45° angle to the horizontal plane. The explants were cultured at 25°C under 16 / 8h light / dark conditions for approximately 2 weeks. The explants were then removed, and excess hypocotyl portions were trimmed, leaving only 5 mm. The explants were then transferred to fresh induction medium and cultured for another 2 weeks under the same conditions.

[0079] (5) Bud elongation

[0080] The induced shoot clusters (with cotyledon tissue removed) were transferred to shoot elongation medium (MS salt 4.43 g / L, sucrose 30 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, IAA 0.1 mg / L, GA 0.5 mg / L, zeatin 1.0 mg / L, cephalosporin 250 mg / L, Timentin 100 mg / L, glufosinate 5 mg / L, agar powder 8 g / L, pH 5.7) and cultured at 25°C with a 16 / 8 h light / dark cycle. Subculture was performed every 2 weeks.

[0081] (6) Rooting

[0082] When the resistant shoots reach 5cm in length, cut them off and soak them in IBA (1mg / L) for 30 seconds. Then transfer them to rooting medium (MS salt 4.43g / L, sucrose 20g / L, MES 0.59g / L, aspartic acid 50mg / L, L-glutamic acid 50mg / L, IBA 1.0mg / L, plant gel 3g / L, pH 5.6) for further cultivation. Once robust roots have developed, transplant them into a greenhouse for further growth and fruiting.

[0083] Using specific primers for promoter Pgj1, PCR detection was performed on T1 generation transgenic soybeans. Combined with herbicide screening, transgenic soybeans with promoter Pgj1 promoting DsRed were obtained and red fluorescence was observed.

[0084] Example 5: Observation of red fluorescence in different parts of pCAMBIA3300-Pgj1-DsRed transgenic soybean plants

[0085] The root-specific expression of T1 generation transgenic soybean plants was analyzed using the LUYOR-3415RG dual-wavelength fluorescence imaging system. The results showed that red fluorescence was only observed in the roots of T1 generation transgenic soybeans. Figure 4 This indicates that the promoter Pgj1 is specifically expressed in the root.

[0086] As can be seen from the above embodiments, the present invention provides a root-specific expression promoter Pgj1 and its applications. The nucleotide sequence of the promoter Pgj1 is shown in SEQ ID NO.1. The promoter Pgj1 provided by the present invention can be specifically expressed in soybean roots, and the target gene driven by this promoter can achieve specific expression in soybean roots. This promoter has high application value in plant gene expression regulation research and soybean breeding improvement.

[0087] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of promoter Pgj1 in soybean root-specific expression, characterized in that, The nucleotide sequence of the promoter Pgj1 is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The amplification primer set for the promoter Pgj1 includes an upstream primer Pgj1-F1 and a downstream primer Pgj1-R1. The sequence of the upstream primer Pgj1-F1 is shown in SEQ ID NO.4, and the sequence of the downstream primer Pgj1-R1 is shown in SEQ ID NO.

5.

3. The application of a soybean root-specific expression recombinant vector in the construction of soybean root-specific expression recombinant bacteria, characterized in that, The recombinant vector is a pCAMBIA3300 vector containing the promoter Pgj1 described in claim 1.

4. The application of a soybean root-specific expression recombinant bacterium in the construction of soybean root-specific expression transgenic soybeans, characterized in that, The recombinant bacteria is Agrobacterium containing the soybean root-specific expression recombinant vector described in claim 3.

5. A method for constructing transgenic soybean with root-specific expression using the soybean root-specific expression recombinant bacteria of claim 4, characterized in that, Includes the following steps: Soybeans were infected with the soybean root-specific recombinant bacteria described in claim 4.

Images