Soybean pod-specific expression promoter pjia and application thereof

Abstract

The application provides a soybean pod-specific expression promoter Pjia and application thereof, and belongs to the technical field of plant biological breeding. The nucleotide sequence of the soybean pod-specific expression promoter Pjia provided by the application is shown as SEQ ID NO. 4. A target gene driven by the promoter can realize specific expression in a soybean pod, provides a new element for improving the accuracy and safety of genetic engineering breeding, and lays a foundation for studying specific expression of disease-resistant genes in a soybean pod.

Description

Technical Field

[0001] This invention relates to the field of plant biobreeding technology, and in particular to the soybean pod-specific expression promoter Pjia and its applications. Background Technology

[0002] Soybeans, as an important grain and oil crop, are susceptible to diseases and pests such as pod blight and pod borer, which severely affect soybean yield and quality. Traditional transgenic technology often uses constitutive promoters such as CaMV 35S to address this production challenge. While these promoters can drive global gene expression, they can lead to increased metabolic burden and abnormal growth and development in the plant. In contrast, pod-specific promoters can precisely regulate the targeted expression of disease-resistant genes in the pod, effectively resisting targeted pests such as the pod borer while avoiding energy waste in non-target organs. This precise regulation technology provides an efficient solution for improving soybean disease and pest resistance, enhancing crop resistance while ensuring yield. Summary of the Invention

[0003] The purpose of this invention is to provide a soybean pod-specific expression promoter Pjia, which can drive the specific expression of the target gene in soybean pods, overcoming the lack of existing soybean endogenous specific promoters.

[0004] This invention provides a soybean pod-specific expression promoter Pjia, the nucleotide sequence of which is shown in SEQ ID NO.4.

[0005] Preferably, the primer set used to amplify the soybean pod-specific expression promoter Pjia is Pjia-F1 and Pjia-R1, the sequence of Pjia-F1 is shown in SEQ ID NO.5, and the sequence of Pjia-R1 is shown in SEQ ID NO.6.

[0006] The present invention also provides an expression cassette containing the soybean pod-specific expression promoter Pjia.

[0007] The present invention also provides the application of the shown promoter Pjia or the expression cassette in transgenic soybean.

[0008] Preferably, the method for constructing the genetically modified soybean includes the following steps:

[0009] (1) Construct an expression vector containing the soybean pod-specific expression promoter Pjia and the target gene;

[0010] (2) Transform the expression vector from step (1) into Agrobacterium;

[0011] (3) The soybean explants were infected with Agrobacterium from step (2), and transgenic soybean plants were obtained after culturing and rooting.

[0012] Preferably, the backbone of the expression vector in step (1) is the pCAMBIA3300 plasmid.

[0013] This invention cloned the soybean pod-specific expression promoter Pjia from the soybean variety Williams 82, fused it with the red fluorescent protein DsRed gene, and transferred it into soybeans. Observation of the red fluorescent protein coloration showed that it only appeared in soybean pods, indicating that the promoter is specifically expressed only in soybean pod tissue. Compared with the existing technology, this invention overcomes the current situation of the lack of endogenous specific promoters in soybeans and has important application value in gene function analysis and genetic improvement. Attached Figure Description

[0014] Figure 1 The relative expression levels of the Glyma.12G217300.1 gene at different sites in Example 1;

[0015] Figure 2 The results of PCR gel electrophoresis of the cloned promoter Pjia in Example 2;

[0016] Figure 3 This refers to the cis-elements acting as the promoter Pjia sequence in Example 3;

[0017] Figure 4 The image shows the pCAMBIA3300-Pjia-DsRed recombinant expression vector from Example 4.

[0018] Figure 5 The result of Pjia-initiated red fluorescent protein color development in the pod region in Example 5. Detailed Implementation

[0019] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0020] The soybean variety Williams 82 described in this invention can be obtained from the National Crop Germplasm Resources Platform (website: http: / / www.cgris.net / home).

[0021] Example 1: Transcriptional levels of the Glyma.12G217300.1 gene in different tissues

[0022] Based on transcriptome data analysis, a gene, Glyma.12G217300.1, which is strongly expressed in soybean pods, was selected. The expression levels of this candidate gene in different soybean tissues and organs were further validated using real-time quantitative PCR. Specifically, total RNA was extracted from root, leaf, stem, pod, and seed tissue samples from mature soybean plants. Real-time quantitative PCR was performed using specific primers Glyma.12G217300.1-F1 and Glyma.12G217300.1-R1. The instrument used was an ABI PRISM 7500 Fast Real-Time PCR System (Applied Biosystems, CA, USA), and the internal reference gene was GmACT6 (GenBank No. NM_001289231). A 2... –ΔΔCT The relative expression level of the gene was detected using the Livak method. The RT-qPCR system consisted of 10 μL SYBR Green PCRMaster Mix, 2 μL cDNA, 0.2 μL forward primer, 0.2 μL reverse primer, and ddH2O to a final volume of 20 μL. The RT-qPCR program was as follows: 94℃, 10 min; (94℃, 45 s; 60℃, 45 s; 72℃, 30 s) 35 cycles; 72℃, 10 min. Results are shown below. Figure 1 As shown.

[0023] The sequence of Glyma.12G217300.1 is shown in SEQ ID NO.1, and the specific sequence is as follows:

[0024] ATGGCACTTCGTTGCTTGGTGATGTCCCTTTCTGTTCTCTTCACTCTTGGTCTTGCGAGAGAAAGCCATGCCAGAGACGAAGATTTTTGGCATGCTGTTTGGCCAAACACTCCCATTCCAAGTTCATTGCGAGATCTTCTAAAGCCTGGCCCTGCAAGTGTTGAAATCGATGATCACCCTATGCAAATTGAAGAAACACAGTACCCGAAAACCTTCTTCTATAAAGAAGACCTTCATCCAGGCAAAACAATGAAAGTACAATTCAGCAAGCCTCCCTTTCAACAACCATGGGGTGTTGGTACATGGTTAAAGGAAATTAAAGACACTACTAAAGAAGGATATAGTTTTGAAGAGCTATGCATCAAGAAAGAAGCCATTGAGGGAGAAGAGAAGTTTTGTGCAAAATCCTTGGGAACAGTAATTGGTTTTGCCATTTCAAAGCTGGGAAAGAACATTCAAGTACTTTCAAGTTCCTTTGTCAATAAGCAAGACCAATACACTGTGGAAGGAGTGCAGAATCTTGGAGACAAAGCAGTGATGTGTCATAGGCTAAATTTCAGAACTGCAGTATTTTACTGCCATGAAGTCCGTGAAACAACAGCTTTCATGGTTCCATTGGTGGCTGGTGATGGAACCAAAACTCAGGCACTTGCTATTTGCCACTCAAATACTTCTGGAATGAATCATCAAATGCTTCATCAACTTATGGGAGTTGATCCTGGAACTAACCCTGTTTGCCATTTCCTTGGAAGCAAGGCCATTTTATGGGTACCCAATTTATCTGTGGACACTGCCTATCAGACCAACATTGTTGCTTAA;

[0025] The sequence of the specific primer Glyma.12G217300.1-F1 is shown in SEQ ID NO.2, and the specific sequence is: AGCCATTGAGGGAGAAGAGAAG;

[0026] The sequence of the specific primer Glyma.12G217300.1-R1 is shown in SEQ ID NO.3, and the specific sequence is: GTTTGTTTCACGGACTTCATGGC.

[0027] Depend on Figure 1 It can be seen that the expression level of the Glyma.12G217300.1 gene is highest in the pod, and its expression level is almost undetectable in other tissues such as leaves and stems, which confirms the specific expression characteristics of the Glyma.12G217300.1 gene in pod tissue.

[0028] Example 2: Cloning of the Glyma.12G217300.1 gene promoter Pjia

[0029] Based on the promoter sequence of the soybean Glyma.12G217300.1 genome, specific primers Pjia-F1 and Pjia-R1 were designed for PCR amplification. The amplification products were separated by electrophoresis on a 1% agarose gel (e.g., ...). Figure 2 (As shown). The agarose gel containing the target fragment was excised and collected into centrifuge tubes, recovered using the Omega Gel Extraction Kit, and cloned into the pEASY-Blunt vector (purchased from Beijing TransGen Biotech Co., Ltd.). The clones were then transformed into competent cells (DH5α), and positive clones were obtained through antibiotic selection. After colony PCR verification, sequencing confirmed that the inserted DNA fragment was 1487 bp. After sequence comparison confirmed that the sequence fragment was correct, it was named the pod-specific promoter Pjia.

[0030] The nucleotide sequence of the pod-specific promoter Pjia is shown in SEQ ID NO.4, and the specific sequence is as follows:

[0031]

[0032] The primer Pjia-F1 described above is shown in SEQ ID NO.5, and its specific sequence is as follows:

[0033] 5'-AATCCAGTGCTCTCTTGTCAAGG-3';

[0034] The primer Pjia-R1 described above is shown in SEQ ID NO.6, and its specific sequence is as follows:

[0035] 5'-TCTTGCAATTAATGAGTGTTAGCG-3'.

[0036] The PCR amplification system is as follows: 25 μL of high-fidelity enzyme mix, 2 μL of template, 1 μL of forward primer, 1 μL of reverse primer, and ddH2O added to a final volume of 50 μL.

[0037] The PCR amplification program of this invention is as follows: 95℃, 3 min; (95℃, 30 sec; 60℃, 30 sec; 72℃, 2 min;) 30 cycles; 72℃, 10 min.

[0038] Example 3: Analysis of the cis-component function of promoter Pjia

[0039] The cis-elements of the promoter Pjia sequence cloned in Example 2 were analyzed using PlantPAN 4.0 online software, and the results are as follows: Figure 3 As shown.

[0040] The results showed that the promoter sequence contained P-box (CCTTTTG), ABRE (CACGTGGC), O2-site (SEQ ID NO.7: TCCACGTAGA), ERE (AGCCGCC) and other elements.

[0041] Example 4: Obtaining transgenic soybeans containing the pCAMBIA3300-Pjia-DsRed recombinant expression vector

[0042] The pCAMBIA33001-GUS vector (purchased from Beijing TransGen Biotech Co., Ltd.) was digested with EcoRI and HindIII enzymes and then linked with the DsRed gene to obtain pCAMBIA33001-DsRed. The promoter Pjia fragment cloned from the pEASY-Blunt vector was seamlessly inserted into the pCAMBIA3300-DsRed expression vector to obtain the pCAMBIA3300-Pjia-DsRed recombinant expression vector (e.g., [image of pCAMBIA33001-GUS vector]). Figure 4As shown in the image, the recombinant expression vector was introduced into Agrobacterium EHA105 (purchased from Beijing TransGen Biotech Co., Ltd.) to obtain recombinant Agrobacterium. The transformation variety was Jiyu 86, and the specific transformation process is as follows:

[0043] (1) Pick a single colony carrying Agrobacterium EHA105 and inoculate it into 5mLYEP liquid medium (50mg / L spectinomycin, 25mg / L rifampin), and incubate overnight at 28°C. The next day, expand the culture (50mLYEP) to OD. 600nm The OD value was 0.6. After centrifugation at 3000 rpm for 10 min, the bacterial cells were resuspended in a liquid co-culture medium (B5 salt 0.321 g / L, sucrose 30 g / L, 2-morpholinoethanesulfonic acid (MES) 3.9 g / L, 6-benzylaminopurine (BAP) 1.67 mg / L, gibberellin (GA3) 0.25 mg / L, cysteine ​​400 mg / L, dithiothreitol (DTT) 154.2 mg / L, acetylsuccinone (AS) 200 μmol / L, pH 5.4), and the OD value was adjusted. 600nm Set aside until 0.5 is available.

[0044] (2) Agrobacterium infection

[0045] Soybean leaves were cut open along the hilum of the seed using a scalpel, the skin was removed, and slight incisions were made at the cotyledon nodes. The prepared explants were then placed in resuspended Agrobacterium for 30 min of infection. The infected explants were then transferred to a co-culture medium (B5 salt 0.321 g / L, sucrose 30 g / L, MES 3.9 g / L, BAP 1.67 mg / L, GA3 0.25 mg / L, cysteine ​​400 mg / L, DTT 154.2 mg / L, AS 200 μmol / L, agar powder 5 g / L, pH 5.4) and incubated in the dark at 23°C for 4 days.

[0046] (3) Adventitious bud induction

[0047] After co-culturing the explants for 4 days, they were transferred to induction medium (B5 salt 3.21 g / L, sucrose 30 g / L, MES 0.59 g / L, BAP 1.67 mg / L, cephalosporin 250 mg / L, timentin 100 mg / L, glufosinate 5 mg / L, agar powder 8 g / L, pH 5.7). The cotyledonary nodes and hypocotyl portions of the explants were inserted into the medium with the adaxial surface facing upwards at a 45° angle to the horizontal plane. The explants were cultured at 25°C under 16 / 8h light / dark conditions for approximately 2 weeks. The explants were then removed, and excess hypocotyl portions were trimmed, leaving only 5 mm. The explants were then transferred to fresh induction medium and cultured for another 2 weeks under the same conditions.

[0048] (4) Bud elongation

[0049] The induced shoot clusters (with cotyledon tissue removed) were transferred to shoot elongation medium (MS salt 4.43 g / L, sucrose 30 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, IAA 0.1 mg / L, GA3 0.5 mg / L, zeatin 1.0 mg / L, cephalosporin 250 mg / L, Timentin 100 mg / L, glufosinate 5 mg / L, agar powder 8 g / L, pH 5.7) and cultured at 25°C with a 16 / 8 h light / dark cycle. Subcultures were performed every 2 weeks.

[0050] (5) Rooting

[0051] When the resistant shoots grow to about 4cm, cut them off, soak them in IBA (1mg / L) for 30s, and then transfer them to rooting medium (MS salt 4.43g / L, sucrose 20g / L, MES 0.59g / L, aspartic acid 50mg / L, L-glutamic acid 50mg / L, IBA 1.0mg / L, plant gel 3g / L, pH 5.6) for further culture. Once they have grown strong roots, transplant them into a greenhouse to grow and bear fruit.

[0052] Using promoter-specific primers for Pjia, PCR detection was performed on T1 generation transgenic soybeans. Combined with herbicide screening, transgenic soybean plants containing pCAMBIA3300-Pjia-DsRed were obtained and red fluorescence was observed.

[0053] Example 5: Observation of red fluorescence in different parts of pCAMBIA3300-Pjia-DsRed transgenic soybean plants

[0054] Tissue-specific expression analysis of T1 generation transgenic pCAMBIA3300-Pjia-DsRed soybean plants was performed using the LUYOR-3415RG dual-wavelength fluorescence imaging system. The results are as follows: Figure 5 As shown.

[0055] The results showed that red fluorescence was present in the pods of the transgenic soybean plants, further verifying the specific expression of the promoter Pjia in the pod tissue.

[0056] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of a soybean pod-specific expression promoter Pjia in driving the specific expression of a target gene in soybean pods, characterized in that, The nucleotide sequence of the soybean pod-specific expression promoter Pjia is shown in SEQ ID NO.

4.

2. The application as described in claim 1, characterized in that, The primer sets used to amplify the soybean pod-specific expression promoter Pjia are Pjia-F1 and Pjia-R1, the sequence of Pjia-F1 is shown in SEQ ID NO.5, and the sequence of Pjia-R1 is shown in SEQ ID NO.

6.

3. The application of a soybean pod-specific expression promoter Pjia in the construction of transgenic soybeans, characterized in that, The nucleotide sequence of the soybean pod-specific expression promoter Pjia is shown in SEQ ID NO.

4. The specific expression promoter Pjia drives the specific expression of the target gene in soybean pods.

4. The application as described in claim 3, characterized in that, The method for constructing the genetically modified soybean includes the following steps: (1) Construct an expression vector containing the soybean pod-specific expression promoter Pjia and the target gene; (2) Transform the expression vector from step (1) into Agrobacterium; (3) The soybean explants were infected with Agrobacterium from step (2), and transgenic soybean plants were obtained after culturing and rooting.

5. The application as described in claim 4, characterized in that, The backbone of the expression vector in step (1) is the pCAMBIA3300 plasmid.

Images