Gene for regulating and controlling chlorophyll degradation and color generation of okra and application of gene

Abstract

The invention provides a gene for regulating and controlling chlorophyll degradation and color generation of okra and application of the gene, and belongs to the field of fruit and vegetable preservation. According to the invention, an ERF (Ethylene Response Factors) transcription factor AeABR1 is identified by analyzing the transcriptome data of the okra subjected to GA (Glycolic Acid) treatment; then, by constructing okra transient expression and arabidopsis thaliana transgenic lines, it is proved that the AeABR1 gene positively regulates and controls degradation of okra chlorophyll; furthermore, a real-time fluorescent quantitative experiment and a dual-luciferase experiment prove that the AeABR1 protein reduces the chlorophyll content of the okra by inducing chlorophyll to degrade expression of an AeCLH1 gene, and then participates in regulation and control of the color of the picked okra. In conclusion, the molecular action mechanism of the AeABR1 gene is preliminarily explored, and a new target gene and a certain theoretical basis are provided for the postharvest preservation of the okra.

Description

Technical Field

[0001] The present invention belongs to the field of fruit and vegetable preservation, and particularly relates to a gene for regulating chlorophyll degradation and color development in okra and its application. Background Art

[0002] Okra (Abelmoschus esculentus L. Moench) is a mallow vegetable native to India, and its tender pods are mainly eaten. It is now widely cultivated in tropical and subtropical regions such as Zhejiang, Fujian, and Hainan. Compared with ordinary vegetables, the tender pod fruits of okra are rich in proteins and viscous polysaccharides, etc., and have health care functions such as helping digestion, anti-fatigue, and enhancing the body's resistance, and are known as the "king of vegetables". Okra has a high water content, a large surface area, well-developed stomata, and is mostly harvested in high-temperature seasons. After harvesting, it is easy to cause water loss and accelerated respiratory consumption, resulting in fruit chlorophyll degradation and aging, which seriously affects its edible and commercial value. The fruit chlorophyll degradation and aging caused by chlorophyll metabolism are one of the most obvious characteristics during the postharvest storage of okra, which also becomes the main problem restricting the storage, transportation, and sales of okra.

[0003] During the process of fruit and vegetable ripening and senescence, they are regulated by various environmental factors and hormones. More and more studies have shown that the role of plant hormones depends on specific hormone combinations, rather than the independent activities of individual hormones. During the postharvest ripening and senescence of fruits and vegetables, exploring the key factors that cross-interact and regulate chlorophyll metabolism among different plant hormone signal factors is of great industrial significance for maintaining the color quality of fruits and vegetables after harvest.

[0004] Transcription factors (TFs) are a class of proteins located in the nucleus that can specifically interact with cis-acting elements in the non-coding region of genes, thereby directly regulating the expression of target genes. The research on the regulation of the chlorophyll metabolism pathway by transcription factors has been widely carried out. Arabidopsis ABF2 / 3 / 4 TFs regulate abscisic acid (ABA)-mediated chlorophyll metabolism and leaf senescence by binding to the promoter sequence of the NYE1 gene; Arabidopsis MYC2 / 3 / 4 proteins and NAC family members ANAC019 / 055 / 072 induce jasmonic acid (JA)-mediated chlorophyll metabolism by upregulating the expression of PAO, NYC1, and SGR1 genes. The AtERF17, SlERF16, and CitERF13 transcription factors activate the PPH gene, promoting chlorophyll metabolism in Arabidopsis, tomato, and sweet orange fruits. However, at present, the research on transcription factors involved in chlorophyll metabolism mainly focuses on model plants such as Arabidopsis, and key factors that integrate different plant hormone signals and regulate postharvest chlorophyll metabolism in fruits and vegetables are rarely found. Summary of the Invention

[0005] In view of the above deficiencies, the present invention provides a gene for regulating chlorophyll degradation and color development in okra and its application, belonging to the field of fruit and vegetable preservation. By analyzing the transcriptome data of okra after GA treatment, the present invention identified an ERF (Ethylene Response Factors) transcription factor AeABR1; then, by constructing transgenic lines of okra and Arabidopsis thaliana, it was confirmed that the AeABR1 gene positively regulates chlorophyll degradation in okra; further, the present invention used real-time fluorescence quantitative experiments and dual luciferase experiments to prove that the AeABR1 protein participates in the regulation of post-harvest color in okra by inducing the expression of the chlorophyll degradation gene AeCLH1 and reducing the chlorophyll content in okra. In summary, the present invention preliminarily explored the molecular mechanism of the AeABR1 gene, providing a new target gene and a certain theoretical basis for post-harvest preservation of okra.

[0006] To achieve the above object, the technical solutions adopted by the present invention are as follows:

[0007] On the one hand, the present invention provides the use of AeABR1 for preparing a preparation for regulating chlorophyll degradation and / or plant color development and / or plant preservation, wherein the AeABR1 comprises the AeABR1 gene and / or the AeABR1 protein, the AeABR1 gene comprises the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing, and the AeABR1 protein comprises the amino acid residue sequence shown in SEQ ID NO.2 in the sequence listing.

[0008] The present invention explored the function of the AeABR1 gene and proved its role in the chlorophyll degradation pathway. Plant color development refers to the phenomenon that plants present different colors within the visible light range through the interaction of specific pigments (such as chlorophyll), cell structures and environmental factors in their tissues or organs. Therefore, this gene can also be used to regulate plant color development. Moreover, plant preservation refers to the technical measures of delaying the senescence, wilting or spoilage process of plant organs (such as cut flowers, leaves, fruits, vegetables, etc.) and maintaining their physiological activity, morphological integrity, bright color and functional quality through physical, chemical or biological technology means. Its core goal is to extend the ornamental period, edible value or commercial life of plants after being separated from the mother body or harvested. Since the research object of the present invention is okra, it mainly makes the color of okra remain green for a long time after harvest by regulating the expression of the AeABR1 gene and / or the AeABR1 protein.

[0009] It should be understood that proteins are the medium through which genes exert their functions. That is, the AeABR1 gene can regulate chlorophyll degradation because it encodes an ERF-type transcription factor, which can bind to the promoters of multiple genes related to chlorophyll degradation, and then up-regulate or down-regulate the expression of the latter, promoting chlorophyll degradation, and then realizing the physiological function of the AeABR1 gene. Therefore, those skilled in the art can down-regulate the expression levels of the AeABR1 gene and / or the AeABR1 protein according to specific implementation manners, and all can achieve the purpose of delaying chlorophyll degradation and senescence.

[0010] In addition, in some ways, it is also necessary to accelerate the degradation of chlorophyll in plants, as follows:

[0011] 1. Resource recovery and recycling: First, recover nitrogen. Chlorophyll molecules contain 4 nitrogen atoms, and the nitrogen released after degradation (through magnesium-dechelatase, etc.) can be transported to new tissues (such as seeds and young leaves) for reuse, reducing resource waste; Second, the reuse of carbon skeletons: Chlorophyll decomposition products (such as chlorophyllide) can be converted into other metabolites (such as plant hormone precursors) and participate in the construction of new tissues;

[0012] 2. Avoid phototoxic damage: If chlorophyll remains in senescent tissues, reactive oxygen species (ROS) will be produced under strong light, resulting in cell damage. Degrading chlorophyll can reduce oxidative stress; Synchronize with the disassembly of photosystem protein complexes to prevent photodamage caused by dysfunctional pigments;

[0013] 3. Promote tissue remodeling: During the maturation process of cereal grains, chlorophyll degradation can avoid the remaining green color from affecting the dormancy and germination characteristics of seeds;

[0014] 4. Agriculture and food processing: Improve the quality of agricultural products: "Fixing the green" in tea processing promotes chlorophyll degradation, forming specific colors and flavors (such as green tea retaining some chlorophyll and black tea completely degrading); At the same time, moderately degrading chlorophyll (such as banana ripening) can improve the taste and marketability.

[0015] Therefore, the above-mentioned purposes can also be achieved by up-regulating the expression levels of the AeABR1 gene and / or the AeABR1 protein.

[0016] On the other hand, the present invention provides the use of AeABR1 for preparing a preparation for regulating the expression of genes related to chlorophyll degradation. The AeABR1 includes the AeABR1 gene and / or the AeABR1 protein. The AeABR1 gene includes the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing, and the AeABR1 protein includes the amino acid residue sequence shown in SEQ ID NO.2 in the sequence listing.

[0017] Furthermore, the chlorophyll degradation-related gene is any one or more of the genes AeCLH1, AeCLH2, AeNOL, AeSGR, AeNYC1, AeHCAR, AeRCCR, AePAO2, and AePAO4.

[0018] Furthermore, the AeCLH1 gene contains the nucleotide sequence shown in SEQ ID NO.3 of the sequence listing; the AeCLH2 gene contains the nucleotide sequence shown in SEQ ID NO.4 of the sequence listing; the AeNOL gene contains the nucleotide sequence shown in SEQ ID NO.5 of the sequence listing; the AeSGR gene contains the nucleotide sequence shown in SEQ ID NO.6 of the sequence listing; the AeNYC1 gene contains the nucleotide sequence shown in SEQ ID NO.7 of the sequence listing; the AeHCAR gene contains the nucleotide sequence shown in SEQ ID NO.8 of the sequence listing; the AeRCCR gene contains the nucleotide sequence shown in SEQ ID NO.9 of the sequence listing; the AePAO2 gene contains the nucleotide sequence shown in SEQ ID NO.10 of the sequence listing; the AePAO4 gene contains the nucleotide sequence shown in SEQ ID NO.11 of the sequence listing.

[0019] Furthermore, the chlorophyll degradation-related gene is AeCLH1, and the AeCLH1 gene contains the nucleotide sequence shown in SEQ ID NO.3 of the sequence listing.

[0020] After confirming the physiological function of the AeABR1 gene, the present invention used real-time fluorescence quantitative experiments to detect the mRNA expression levels of multiple chlorophyll degradation genes in okra overexpressing the AeABR1 gene, and found that the expression levels of the genes AeCLH1, AeNOL, AeSGR, AeNYC1, AeRCCR, AePAO2, and AePAO4 were all significantly increased; further combined with the analysis results of the gene promoter, it was initially considered that the AeABR1 protein might directly regulate the expression of the genes AeCLH1, AePAO, and AeNYC1, and this was verified using a dual-luciferase reporter system. It was found that the AeABR1 protein could only directly bind to the promoter of the AeCLH1 gene and up-regulate the expression level of the AeCLH1 gene.

[0021] On the other hand, the present invention provides the use of siRNA for preparing a preparation for regulating chlorophyll degradation and / or plant coloration and / or plant preservation, characterized in that the siRNA (siAeABR1s) targets the AeABR1 gene, and the AeABR1 gene contains the nucleotide sequence shown in SEQ ID NO.1 of the sequence listing.

[0022] Furthermore, the siRNA comprises nucleotide sequences shown in any one or more pairs of SEQ ID NO.40-SEQ ID NO.41, SEQ ID NO.42-SEQ ID NO.43, SEQ ID NO.44-SEQ ID NO.45, SEQ ID NO.46-SEQ ID NO.47, SEQ ID NO.48-SEQ ID NO.49 in the sequence listing. Preferably, SEQ ID NO.40-SEQ ID NO.41, SEQ ID NO.42-SEQ ID NO.43, and SEQ ID NO.44-SEQ ID NO.45.

[0023] Furthermore, the siRNA comprises the nucleotide sequence shown in SEQ ID NO.42-SEQ ID NO.43 in the sequence listing.

[0024] The present invention designed 5 pairs of siRNAs targeting the AeABR1 gene, and only 3 pairs of them can significantly down-regulate the expression level of the AeABR1 gene. Among them, after the okra leaves were treated with siAeABR1-2 (SEQ ID NO.42-SEQ ID NO.43), the leaf color was darker, and after being detached, the leaves remained green for a longer time. Therefore, it is preferred to apply this siRNA to okra fresh-keeping.

[0025] On the other hand, the present invention provides a method for regulating chlorophyll degradation and / or plant coloration and / or plant fresh-keeping, which refers to targeting and silencing and / or knocking out the AeABR1 gene, and the AeABR1 gene comprises the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing.

[0026] Furthermore, the above-mentioned siRNA is used to target and silence the AeABR1 gene.

[0027] The beneficial effects of the present invention include:

[0028] 1. The present invention preliminarily explored the molecular mechanism of action of the AeABR1 gene, providing a new target gene and a certain theoretical basis for postharvest fresh-keeping of okra;

[0029] 2. Designed multiple pairs of siRNAs targeting the AeABR1 gene, and screened out a pair with the best effect, which can be used in the field of postharvest okra fresh-keeping. Description of the Drawings

[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0031] Figure 1 : Effects of GA treatment on postharvest okra; among them, Figure A shows the phenotypes of okra stored for different times after GA treatment; Figure B shows the ethylene release of okra (n = 3) stored for different times after GA treatment; Figure C shows the expression levels of the AeABR1 gene in okra (n = 3) stored for different times after GA treatment; ** indicates that the p-value is less than 0.01, and *** indicates that the p-value is less than 0.001;

[0032] Figure 2 : Promoter analysis of genes related to chlorophyll degradation in okra;

[0033] Figure 3 : Correlation analysis of the expression level of the AeABR1 gene in okra with ethylene release and chlorophyll content; among them, ABR1 represents the expression level of the AeABR1 gene in okra, ETH represents the ethylene release of okra, and Tchl, Tchla, and Tchlb are the contents of total chlorophyll, chlorophyll a, and chlorophyll b in okra, respectively;

[0034] Figure 4 : Subcellular localization and transient expression analysis of AeABR1; among them, Figure 4 A is the subcellular localization of the AeABR1 protein; Figure 4 B is the phenotype observation of okra leaves (n = 3) with transient overexpression of the AeABR1 gene; Figure 4 C is the determination of the chlorophyll content of okra leaves (n = 3) with transient overexpression of the AeABR1 gene; Figure 4 D is the effect of transient overexpression of the AeABR1 gene on the expression levels of genes related to chlorophyll degradation (CCGs), * indicates that the p-value is less than 0.05, and *** indicates that the p-value is less than 0.001;

[0035] Figure 5 : Phenotypes of Arabidopsis thaliana overexpressing the AeABR1 gene line (n = 3) ( Figure 5 A), chlorophyll content ( Figure 5 B), and CCGs expression analysis ( Figure 5 C); among them, ** indicates that the p-value is less than 0.01, and *** indicates that the p-value is less than 0.001;

[0036] Figure 6:The okra AeABR1 protein induces the expression of the chlorophyll degradation gene AeCLH1; where n = 3, * indicates that the p-value is less than 0.05. Detailed implementation manners

[0037] The present invention will be further elaborated in detail below in conjunction with the accompanying drawings of the specification and specific embodiments. The embodiments are only used to explain the present invention and are not used to limit the scope of the present invention; based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of the present invention.

[0038] Unless otherwise specified, the test methods used in the following embodiments are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, are reagents and materials that can be obtained from commercial channels.

[0039] The professional terms involved in the present invention and their explanations are as follows:

[0040] 1. Transcription factor: A class of proteins located in the cell nucleus that can specifically interact with cis-acting elements in the non-coding region of genes, thereby directly regulating the expression of target genes.

[0041] 2. Abscisic acid: ABA, an important plant hormone, mainly involved in the regulation of plant growth and development and the response to adversity (such as drought, cold, salt stress, etc.).

[0042] 3. Gibberellin: GA, a plant hormone that can promote stem elongation, induce bolting and flowering of long-day plants under short-day conditions, promote seed germination, and promote parthenocarpy of plants.

[0043] 4. ERF transcription factor: Ethylene Response Factors, a class of transcription factors unique to plants, involved in the signal transduction process of plant growth and development and physiological and biochemical reactions.

[0044] Example 1: Identification of the AeABR1 gene

[0045] Previous studies have shown that gibberellin (GA) can effectively improve the browning phenomenon of fruits and vegetables after harvest. Therefore, in this example, the effect of GA on postharvest okra (Abelmoschus esculentus) was first verified, and the specific steps are as follows:

[0046] 1.1 Gibberellin treatment

[0047] Okra was harvested from a local farm in Ningbo. For this experiment, okra fruits with uniform size, uniform color, no mechanical damage, consistent relative maturity, no obvious diseases, at the commercial harvest stage, and with a fruit length of 10 - 12 cm were selected. They were randomly divided into two groups (treatment group and control group), with 150 fruits in each group. And the 150 okra were further divided into 3 small groups as 3 biological replicates for each treatment. Among them, the treatment method for the treatment group was as follows: The okra was immersed in a 10 g·L -1 GA (purchased from Shanghai Aladdin Co., Ltd., purity ≥95%) solution for 10 min; for the control group, the okra was immersed in distilled water for 10 min.

[0048] The treated okra was naturally air-dried (to remove surface moisture), bagged with 0.03 mm polyethylene fresh-keeping bags, with 10 okra in each bag. The okra was transferred to an incubator with a relative humidity of 90% and a constant temperature of 10°C for a total of 12 days, and samples were taken at 0, 3, 6, 9, and 12 days. There were 3 biological replicates at each sampling point, and each replicate contained 10 okra. First, the ethylene release amount of the okra was detected, and then the fruits were seeded and cut into small pieces, quickly frozen in liquid nitrogen, and stored at -80°C for a long time.

[0049] 1.2 Determination of ethylene release amount

[0050] Randomly select 10 okra fruits and put them in a 1.5 L airtight gas collection container, store for 3 h, collect the top gas sample and insert it through a rubber diaphragm into a gas chromatograph (GC-2014C, Shimadzu, Japan) equipped with a flame ionization detector (FID). The parameter settings of the gas chromatograph are as follows: a 30 m × 0.32 mm × 0.25 μm chromatographic column (Rtx-5MS, Shimadzu, Japan), column temperature 80°C, injector temperature 230°C, detector temperature 270°C, injection volume 1 mL. Calculate the ethylene release amount during the post-harvest storage period of the fruits, expressed in mL·kg -1 ·h -1 . The calculation formula is:

[0051] Ethylene release amount (mL·kg -1 ·h -1 ) = c × V × m -1 × t -1 × 10 -3

[0052] Where: c is the ethylene content in the sample gas determined by gas chromatography, μL / L; V is the volume of the airtight container space (L); m is the sample mass (kg); t is the determination time (h).

[0053] 1.3 Determination of chlorophyll content

[0054] Mix acetone and absolute ethanol in a volume ratio of 1:1 to prepare an extraction solution. Weigh 5 g of the okra fruit sample that has been ground into powder, and mix it evenly in 10 mL of acetone-ethanol (1:1) solution. Let it stand in the dark on ice for 30 min. After complete extraction, centrifuge at 4 °C and 12,000 g for 10 min. Use the mixed extraction solution as a blank to zero the instrument, take 1 mL of the supernatant, and measure its absorbance at 663 nm and 645 nm using a UV spectrophotometer to calculate the chlorophyll content in the sample, expressed in mg·kg -1 It is expressed as follows. The calculation formula is:

[0055] Chl a =(12.7D 663 - 2.59D 645 )×V / W;

[0056] Chl b =(22.9D 645 - 4.67D 663 )×V / W;

[0057] TChl = Chl a + Chl b

[0058] Where: Chl a , Chl b and TChl are the contents of chlorophyll a, chlorophyll b, and total chlorophyll, in mg·kg -1 ; D 663 and D 645 are the absorbance values of the extraction solution at wavelengths of 663 nm and 645 nm; V is the total volume of the final volume of the extraction solution, in mL; W is the weight of the sample taken, in g.

[0059] It can be seen from the results that compared with the control, after 12 days of gibberellin treatment, the chlorophyll content of okra fruits remained at a relatively high level, and the degree of browning was significantly lower than that of the control ( Figure 1 A), indicating that gibberellin is beneficial to maintaining the post-harvest quality of okra.

[0060] Ethylene is a plant hormone that mainly promotes the processes of ripening and senescence. If okra releases too much ethylene, it may accelerate its own ripening, resulting in a deteriorated texture, appearance of spots or browning, shortened storage time and quality; at the same time, it will also affect the preservation of other surrounding fruits and vegetables, leading to overall cargo losses. The experimental results showed that during the storage of okra, the ethylene release of the control group reached a peak on the 3rd day and then showed a downward trend, while the ethylene release of okra treated with GA was significantly lower than that of the control group on the 3rd, 6th, and 9th days ( Figure 1 B), and this result was consistent with the phenotype in Figure 1 A.

[0061] To further explore the molecular mechanism of GA-mediated chlorophyll degradation, RNA was extracted from okra (n = 3) that had been stored for different times (0 d, 3 d, 6 d, 9 d, and 12 d) after the above-mentioned control and GA treatment using a Polysaccharide Polyphenol Plant RNA Extraction Kit (Novizan, RC401), and sent to Guangzhou GeneDenovo Biotechnology Co., Ltd. for transcriptome sequencing and data analysis, thus identifying 926 differentially expressed genes (DEGs), among which 364 genes were up-regulated and 562 genes were down-regulated. Given the importance of abscisic acid (ABA) in leaf yellowing and the significant decrease in ethylene release in okra fruits after GA treatment ( Figure 1 B), and the presence of DRE motifs (binding motifs of ERF transcription factors) in the promoters of chlorophyll degradation-related genes (such as AeCLH1, AePAO, and AeNYC1) ( Figure 2 ), the present invention focuses on differentially expressed genes related to ethylene and ABA, and then discovers potential transcription factors AeABR1 (ABA repressor 1), AeERF114 (SEQ ID NO.81), and AeERF105 (SEQ ID NO.82) from the ERF family among these DEGs. Among them, the CDS (Coding Sequence) sequence of the AeABR1 gene is as shown in SEQ ID NO.1, and the amino acid sequence is as shown in SEQ ID NO.2. The full length of the AeABR1 gene is 1245 bp, encoding a protein composed of 414 amino acid residues, with a molecular weight of approximately 44.91 kDa and an isoelectric point of 6.32.

[0062] To preliminarily explore whether AeABR1, AeERF114, and AeERF105 play a role in okra chlorophyll degradation, in this example, real-time fluorescence quantitative primer pairs for the AeABR1, AeERF114, and AeERF105 genes, namely SEQ ID NO.12~SEQ ID NO.13, SEQ ID NO.14~SEQ ID NO.15, and SEQ ID NO.16~SEQ ID NO.17, were designed using Beacon Designer 7 software, and the RNA expression levels of the above genes in okra after different treatments were double-verified by PCR clone product sequencing and internal reference gene melting curve analysis. Among them, the real-time fluorescence quantitative PCR reaction system was a total of 20 μL, including 10 μL qPCR SYBR Green Master Mix (High Rox Plus) (Yeasen, China), 5 μL of cDNA (transcribed from okra RNA extracted above for transcriptome sequencing), 0.5 μL each of 10 μM primer pairs (SEQ ID NO.12 - SEQ ID NO.13 or SEQ ID NO.14 - SEQ ID NO.15 or SEQ ID NO.16 - SEQ ID NO.17), and 4 μL of ddH2O; the reaction procedure is as follows: pre-denaturation at 95°C for 5 min; 95°C for 15 s, 55°C for 30 s, 75°C for 15 s, and this step is carried out for 40 cycles. Meanwhile, the okra AeActin gene (GQ340770, primer pairs SEQ ID NO.18 and SEQ ID NO.19) is used as an internal reference, and the expression level of the AeABR1 gene is calculated based on relative quantification 2 -ΔCT method.

[0063] The results showed that ( Figure 1 C), in the middle and late stages of storage (i.e., after 6 days of storage), the expression level of the AeABR1 gene in the okra fruits of the control group gradually increased, while the expression levels of the AeABR1 gene in okra treated with GA and stored for 6 days and 9 days were significantly lower than those of the control group, indicating that GA inhibits the expression of the AeABR1 gene, suggesting that the AeABR1 gene promotes the browning process of okra. The degree of inhibition of GA on the expression of the AeERF114 and AeERF105 genes is much lower than that of GA on the AeABR1 gene, so the AeABR1 gene was selected as the subsequent research object.

[0064] Furthermore, in this example, the chlorophyll contents of okra (n = 3) stored for different times (0 d, 3 d, 6 d, 9 d, and 12 d) after being treated with distilled water or GA were also detected. The specific steps were the same as those described in step "1.3", and the relationships among the three factors of the expression level of the AeABR1 gene, ethylene release amount, and chlorophyll content were analyzed. Correlation analysis showed that the expression level of AeABR1 was also negatively correlated with the ethylene release amount (R = -0.362, P < 0.05) and chlorophyll content (R value range from -0.714 to -0.516, P < 0.05) ( Figure 3 ), further suggesting the potential correlation between the AeABR1 gene and chlorophyll degradation.

[0065] Example 2: Analyzing the function of the AeABR1 gene using transient expression technology

[0066] Example 1 Using transcriptome data, an AeABR1 gene related to chlorophyll degradation in okra was screened. In this example, the subcellular localization of the AeABR1 protein was first verified, and the specific operations were as follows: The full-length CDS sequence of the AeABR1 gene was amplified using the amplification primers SEQ ID NO.20 and SEQ ID NO.21 containing lic adapters and 2×Phanta Max Master Mix reagent (Vazyme, P515). The Lic technology was used to replace the traditional restriction enzyme digestion and ligation method for vector construction. T4 DNA polymerase (New England Biolabs, M0203) was used to add dATP to the target fragment; and the pCV-eGFP-N1 vector (with lic adapter) was digested with Fast digest ApaI enzyme to linearize it. After purification, T4 DNA polymerase (New England Biolabs, M0203) was used to add dTTP to the vector; the amplified CDS sequence of AeABR1 (added with dATP) was ligated into the linearized pCV-eGFP-N1 vector (added with dTTP) to obtain the pCV:AeABR1-eGFP binary expression vector; then, the binary recombinant plasmid was transformed into the EHA105 strain (Shanghai Weidi Biotechnology Co., Ltd., AE1010) by the freeze-thaw method, and glycerol bacteria were preserved; under the condition of 28 °C, the agrobacteria containing pCV:AeABR1-eGFP and the empty pCV-eGFP-N1 vector were activated twice, and then centrifuged at 5,000 rpm for 5 min at room temperature to collect the bacterial cells; the bacterial cells were suspended with the infection solution (10 mM MgCl2, 10 mM MES, 200 μM acetosyringone, pH = 5.6), and the concentration was adjusted to OD 600 = 1.0, and it was placed in the dark at room temperature for 4 h; the above resuspension was injected into the 4th to 5th leaves of Nicotiana benthamiana at 4 - 6 weeks old using a syringe, 100 μL of the bacterial solution was injected each time; after injection, Nicotiana benthamiana was placed in an artificial climate incubator with 16 h light / 8 h dark and 25 °C for 60 h, and then observed under a laser confocal microscope; a negative control was set in this experiment, that is, the okra leaves were infected with the agrobacterium containing the pCV-eGFP-N1 plasmid. The results showed that the GFP protein (control group) was expressed throughout the cells, such as the nucleus and cell membrane, indicating that the agrobacterium successfully infected the Nicotiana benthamiana leaves; while the vast majority of the AeABR1-GFP fusion protein was distributed in the nucleus ( Figure 4 A), and this result was consistent with the function of the transcription factor.

[0067] Next, to further explore the function of the AeABR1 gene, in this example, Agrobacterium containing the pCV:AeABR1-eGFP binary expression vector was transferred into okra leaves according to the above steps, with 150 μL of the bacterial solution injected each time; and the phenotypic changes of the leaves were observed 7 days later; at the same time, samples were taken, part of which was used for the determination of chlorophyll content, and the other part was stored at -80 °C for subsequent experiments such as RNA extraction, reverse transcription, and detection of the expression levels of genes related to chlorophyll degradation. Among them, the real-time fluorescence quantitative primers for genes related to chlorophyll degradation in okra are shown in Table 1, and the experimental steps for detecting chlorophyll content and the expression levels of the above genes are the same as those described above.

[0068] Table 1 Real-time fluorescence quantitative primers for genes related to chlorophyll degradation in okra

[0069] Gene Name sense(5’-3’) Sequence Number antisense(5’-3’) Sequence Number AeCLH1 TGTGCGTAAACGGGAAAGGT SEQ ID NO.22 GCAACGTCAGGTTCGTTCAC SEQ ID NO.23 AeCLH2 AGGGAGCCGATGAGAAGGAT SEQ ID NO.24 AATGCGGTCGTTTGAAGCTC SEQ ID NO.25 AeNOL ATCCCAGCAAGTGGATCGTG SEQ ID NO.26 GGTTTCGCCTTGCACCAAAT SEQ ID NO.27 AeSGR CTGGGAATGGCCTCAACCAT SEQ ID NO.28 CATGGGTGTGCATTGGTGAC SEQ ID NO.29 AeNYC1 GTCAAAAATGGCTGCAGTGAC SEQ ID NO.30 GCAACAGTAGAAAACGACTCC SEQ ID NO.31 AeHCAR GAGTCAAACTCCAATGCCAAG SEQ ID NO.32 CCTCCAGGGGGTATAGGCTT SEQ ID NO.33 AeRCCR GAAGGACGCATGGAGGAGATT SEQ ID NO.34 TCCTTCCTCGTCCACATTTC SEQ ID NO.35 AePAO2 TCATCATCAGCAGCAGAACGAG SEQ ID NO.36 CCAGAAGCTGAAATGGTGTGG SEQ ID NO.37 AePAO4 TCTTGCTACCATTCCTACGGTC SEQ ID NO.38 TTTGAAGCAAGGCTCTTCCG SEQ ID NO.39

[0070] Seven days after Agrobacterium infiltration, compared with the control on the left leaf, the transient overexpression of the AeABR1 gene caused accelerated chlorosis of the right leaf, characterized by obvious yellowing of the leaf ( Figure 4 B). Compared with the control group, the chlorophyll content in the leaf area with transient overexpression of the AeABR1 gene was significantly reduced ( Figure 4 C), and this result was consistent with the phenotype of okra leaves. In addition, in the leaf cells overexpressing the AeABR1 gene, the mRNA expression levels of genes related to chlorophyll degradation (CCGs, including AeCLH1, AeNOL, AeSGR, AeNYC1, AeRCCR, AePAO2, and AePAO4) were all significantly increased ( Figure 4 D), indicating that the AeABR1 gene promotes the degradation of chlorophyll in okra by directly or indirectly regulating the above genes related to chlorophyll degradation. Based on the experimental results of Example 1 and Example 2 above, it can be preliminarily concluded that the AeABR1 gene plays a positive regulatory role in the degradation of chlorophyll in okra.

[0071] To further verify the function of the AeABR1 gene and explore whether this gene can be applied to the post-harvest preservation of okra, in this example, multiple siRNAs targeting the silencing of the AeABR1 gene were designed (siAeABR1 is shown in Table 2 and was synthesized by Sangon Biotech (Shanghai) Co., Ltd.). Then, 50 nM of the above siRNA was injected or sprayed (in this example, injection was preferred) into the leaves of three-week-old okra, with 100 μL injected or sprayed each time. After 36 h, the silencing efficiency of siAeABR1 was identified (i.e., RNA was extracted, reverse transcribed, and the expression level of the AeABR1 gene was detected using real-time fluorescence quantitative experiments (n = 3)), and the leaf phenotypes were observed. The specific operations were the same as described above; meanwhile, a negative control (siGFP, sense: GCC AUG AUA UAG ACG UUG UTT, antisense: ACA ACG UCU AUA UCA UGG CTT) was set up.

[0072] Table 2 siRNAs targeting the silencing of the AeABR1 gene

[0073] Gene Name sense(5’-3’) Sequence Number antisense(5’-3’) Sequence Number siAeABR1-1 UAUUGUUGUUCAUCUUCGGCA SEQ ID NO.40 CCGAAGAUGAACAACAAUAUU SEQ ID NO.41 siAeABR1-2 AAAGAAGAAGAUAACAAUGGC SEQ ID NO.42 CAUUGUUAUCUUCUUCUUUAU SEQ ID NO.43 siAeABR1-3 AAGAAGAAGAUAACAAUGGCU SEQ ID NO.44 CCAUUGUUAUCUUCUUCUUUA SEQ ID NO.45 siAeABR1-4 UCAAUGAAAUGAACACUAGCC SEQ ID NO.46 CUAGUGUUCAUUUCAUUGAGU SEQ ID NO.47 siAeABR1-5 UUAGAAGAUUGGAAAUGGGUU SEQ ID NO.48 CCCAUUUCCAAUCUUCUAAUC SEQ ID NO.49

[0074] It can be seen from the experiments that only 3 pairs of siRNAs (siAeABR1-1 to 3) among the above 5 pairs of siAeABR1s can effectively down-regulate the expression of the target gene; further, compared with the control, the okra leaves treated with siAeABR1-1 to 3 were significantly greener in color, the chlorophyll content was 1.2 to 2 times that of the control, and the time for the leaves to remain green after being detached was significantly extended. This result not only further verified the physiological function of AeABR1s but also confirmed that this gene can be used as a target gene for okra preservation. Further, siAeABR1-2 (SEQ ID NO.42 to SEQ ID NO.43) had the best silencing effect, and the okra leaves treated with this siRNA were the greenest in color and had the highest chlorophyll content. Therefore, this siRNA was preferably used for the post-harvest preservation of okra.

[0075] Example 3: Analyzing the function of the AeABR1 gene using stable genetic techniques

[0076] To further clarify the biological function of the AeABR1 gene in the GA-mediated chlorophyll degradation process during the post-harvest of okra, in this example, an Arabidopsis overexpressing AeABR1 line was constructed by the floral dip method, and the specific steps are as follows:

[0077] 3.1 Obtaining the Agrobacterium liquid for infecting Arabidopsis

[0078] The EHA105 strain containing the pCV:AeABR1-eGFP plasmid was shaken and activated for two rounds, and then centrifuged at 5,000 rpm for 5 min at room temperature to collect the bacterial cells. The cells were suspended in the infection solution (5 g of sucrose, 90 mL of ddH2O, and 50 μL of Silwet L-77). The surfactant Silwet-77 was used to make the bacterial solution better adsorbed by Arabidopsis thaliana leaves. The concentration was adjusted to OD 600 = 0.8 for subsequent infection;

[0079] 3.2 Infecting Arabidopsis thaliana by the floral dip method

[0080] Five-week-old Arabidopsis thaliana plants were selected, and the fruit pods were removed, leaving the unopened inflorescences. The inflorescences of Arabidopsis thaliana were inverted and completely immersed in the above-mentioned infection solution. After 1 min of immersion, they were taken out. Each Arabidopsis thaliana plant was covered with a fresh-keeping bag to maintain moisture, placed horizontally in complete darkness, and the fresh-keeping bag was opened and the plants were set upright after 48 h. The Arabidopsis thaliana plants resumed normal growth. The above-mentioned infection operation was repeated after 7 days to improve the infection efficiency;

[0081] 3.3 Screening the above transgenic lines using kanamycin:

[0082] Prepare an MS solid screening medium containing 50 mg / L kanamycin but no sucrose (Phytotech Labs, USA, M519); vernalize the T0 generation of Arabidopsis transgenic seeds at 4 °C for 2 days, then place the T0 generation of transgenic seeds into a 2 mL centrifuge tube, disinfect with 75% ethanol for 5 min, and wash with sterile water 5 times for later use; sow the T0 generation of transgenic Arabidopsis in a laminar flow hood, that is, evenly spot the disinfected seeds on the above-prepared kanamycin-resistant MS screening medium with a pipette tip, and place it in an incubator at 23 °C with a 16 h light / 8 h dark cycle until the seeds germinate; after the first pair of true leaves of the seedlings unfold and take root, transplant the seedlings into a mixture of nutrient soil: vermiculite: perlite (4:3:1) for seedling cultivation, cover with a plastic film, and ensure growth for at least 10 days under 100% humidity. After the transplanted seedlings grow stably, open the ventilation holes of the plastic cover to allow Arabidopsis to grow normally under a humidity of more than 80%; after Arabidopsis pods, prepare to harvest the seeds, harvest the seeds of each plant separately and store them dry; continue to grow and screen the T1 generation of seeds on the MS solid medium containing kanamycin, and the seedlings with true leaves and roots growing on the plate are the T2 generation; continue to screen the T2 generation of seeds for kanamycin resistance to obtain a homozygous Arabidopsis transgenic line until all the T3 generation and subsequent plants growing on the resistant plate are green resistant seedlings. After the T3 generation of Arabidopsis transgenic lines are stably expressed, the Arabidopsis transgenic lines are used for subsequent experiments. Identify the positive lines overexpressing the AeABR1 gene by fluorescence quantitative PCR. The primer sequences used are SEQ ID NO.12 and SEQ ID NO.13, and Arabidopsis AtActin is selected as the internal reference, and its quantitative primers are SEQ ID NO.50 and SEQ ID NO.51. The remaining experimental steps are the same as those described in Example 1. After the resistance screening of the T0 generation of Arabidopsis seeds, 14 Arabidopsis plants were initially obtained. After identification by qPCR, 11 of them were positive plants, and three independent Arabidopsis positive transgenic lines (OE-2, OE-8, and OE-10) with high AeABR1 gene expression levels and positive rates were selected for subsequent experiments. Among them, the positive lines were ranked in descending order of AeABR1 gene mRNA expression level as: OE-2 > OE-10 > OE-8; the experiments included phenotypic observation of the leaves of 9-week-old Arabidopsis positive seedlings, detection of chlorophyll content and expression levels of chlorophyll degradation-related genes. The primers used to detect gene expression levels are shown in Table 3, and the internal reference gene is Atactin. The remaining steps are the same as those described in Example 1.

[0083] Table 3 Real-time fluorescence quantitative primers for chlorophyll degradation-related genes in Arabidopsis

[0084] Gene name sense(5’-3’) Sequence number antisense(5’-3’) Sequence number AtCLH1 TGCCGCAACATTAGACCCAT SEQ ID NO.52 CCAGCTCGAAAGATTCCGGT SEQ ID NO.53 AtCLH2 TCCGGTGTTGGCTTACCTTC SEQ ID NO.54 TAATGGGTTCCGAGCGGTTT SEQ ID NO.55 AtRCCR CCAGTCCATGGAAGACCACG SEQ ID NO.56 CGATTCTCCACCGTCGACAT SEQ ID NO.57 AtNOL TACTGGCAGAACGCTTTGGT SEQ ID NO.58 CGGAGGCGTCATAGGTTCTC SEQ ID NO.59 AtNYC1 AGGCCGATGGTTTGATGACC SEQ ID NO.60 ACGACAACCTCGTCCTGTTC SEQ ID NO.61 AtPAO GGAGTCACCAGACTACGACG SEQ ID NO.62 GCTGACTCTTACCATGCCGT SEQ ID NO.63 AtSGR1 TTGCAAGGTTGTTTGGACCG SEQ ID NO.64 TAGGGAGCGTTGAAGGATGC SEQ ID NO.65 AtSGR2 TACCGGAGCTACCTTGTCCT SEQ ID NO.66 CGCAACATTCTCATCCGCTG SEQ ID NO.67 AtPPH GGTTATCGGTGAGCCTGTGT SEQ ID NO.68 ACCCCAGAAAGGTGTTGCAT SEQ ID NO.69

[0085] Compared with the wild type (WT), Arabidopsis seedlings overexpressing the AeABR1 gene all showed a phenotype of leaf chlorosis. Among them, the chlorosis degree of the leaves of the OE-2 line with the highest expression level of the AeABR1 gene was the highest ( Figure 5 A). At the same time, the chlorophyll contents of three independent Arabidopsis overexpressing the AeABR1 gene lines were all significantly lower than those of the control. The experimental results corroborated the chlorosis phenotype of the transgenic Arabidopsis lines, and the chlorophyll content of the OE-2 line was the lowest. In addition, the results of real-time fluorescence quantitative analysis showed that overexpression of the AeABR1 gene led to a significant increase in the mRNA expression levels of chlorophyll degradation-related genes (such as AtCLH, AtRCCR, AtNOL, AtNYC1, AtPAO, AtSGR, and AtPPH genes) in Arabidopsis ( Figure 5 C).

[0086] In summary, the experimental results of Examples 1 to 3 confirmed that the AeABR1 gene induced the expression of chlorophyll degradation-related genes (such as CLH, RCCR, NOL, NYC1, PAO, and SGR genes) directly or indirectly, and then promoted the degradation of okra chlorophyll and regulated the color of okra. Therefore, the AeABR1 gene can be used as a target gene for postharvest okra preservation. Among them, the comprehensive effect of siAeABR1-2 is the best, so this siRNA is preferably applied to the field of okra preservation.

[0087] Example 4: Exploration of the molecular mechanism of action of the AeABR1 gene

[0088] Although Examples 1 to 3 clarified the physiological functions of the AeABR1 gene, its molecular mechanism of action is still unknown. At the same time, in the above examples, qPCR was used to detect the RNA expression levels of multiple chlorophyll degradation genes in okra and Arabidopsis overexpressing the AeABR1 gene lines, and it was found that the expression levels of CLH, RCCR, NOL, NYC1, PAO, and SGR genes were all significantly upregulated. Then, the promoters of these genes were analyzed, and it was found that only the promoters of AeCLH1, AePAO, and AeNYC1 genes contained the ERF transcription factor binding motif (DRE motif) ( Figure 2 ). Therefore, in this example, a dual-luciferase assay was used to explore the regulatory relationship between the transcription factor AeABR1 and the AeCLH1, AePAO, or AeNYC1 genes. The dual-luciferase reporter system contains firefly luciferase (F-Luc) and Renilla luciferase (R-Luc), which can be used to analyze the regulatory effect of transcription factors on the promoters of target genes. The specific operations are as follows:

[0089] Using the method of homologous recombination, the full-length CDS sequence of AeABR1 and the promoter sequences of AeCLH1 / AePAO / AeNYC1 genes (SEQ ID NO.70-72) were inserted into pGreenII 0800-LUC and pGreenII 62-SK vectors respectively to construct Effector and Reporter recombinant vectors. The primer sequences for constructing the above vectors are shown in Table 4, and the combination of pGreenII 0800-LUC empty vector and pGreenII 62-SK was used as a negative control; the above positive recombinant plasmids were transformed into GV3101 strain containing pSoup-p19 plasmid by the freeze-thaw method respectively, and glycerol bacteria were preserved. The positive transformed bacteria were activated twice, and the OD 600 of the bacterial solution was adjusted to about 0.2 with the infection solution, and it was placed at room temperature in the dark and allowed to stand for 4 h. The Effector and Reporter recombinant vector bacterial solutions were mixed at a volume ratio of 8:1, and the above resuspension was injected into the lower epidermis of the back of the leaves of Nicotiana benthamiana plants, and cultured in a climate chamber at 16 h light / 8 h dark, 25 °C for 3 d. Circular discs with a diameter of 1 cm in the injection area were taken, and the ratio of LUC and REN luciferase in the leaves was detected using a Dual-Luciferase Reporter Assay System (Yeasen, China).

[0090] Table 4 Primers required for constructing Effector and Reporter recombinant vectors

[0091]

[0092]

[0093] The dual-luciferase assay showed that( Figure 6 ), the AeABR1 protein could only directly bind to the promoter of the AeCLH1 gene, but not to the promoters of the AePAO or AeNYC1 genes; moreover, after the AeABR1 protein bound to the promoter of the AeCLH1 gene, it induced the expression of the AeCLH1 gene. In summary, the AeABR1 transcription factor regulated chlorophyll degradation and affected the postharvest quality of okra by activating the expression of the AeCLH1 gene.

[0094] The foregoing has shown and described the basic principles, main features and advantages of the present invention. For those skilled in the art, it is obvious that the present invention is not limited to the details of the above-described exemplary embodiments, and can be implemented in other specific forms without departing from the spirit or basic characteristics of the present invention. Therefore, from any point of view, the embodiments should be regarded as exemplary and non-limiting. The scope of the present invention is defined by the appended claims rather than the above description. Therefore, all changes falling within the meaning and scope of the equivalent elements of the claims are intended to be embraced by the present invention, and any reference signs in the claims should not be regarded as limiting the claims involved.

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

Claims

1. Use of AeABR1 for preparing a preparation for regulating chlorophyll degradation and / or plant coloration and / or plant preservation, characterized in that, The AeABR1 comprises the AeABR1 gene and / or the AeABR1 protein, the AeABR1 gene comprises the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing, and the AeABR1 protein comprises the amino acid residue sequence shown in SEQ ID NO.2 in the sequence listing.

2. Use of AeABR1 for preparing a preparation for regulating the expression of genes related to chlorophyll degradation, characterized in that, The AeABR1 comprises the AeABR1 gene and / or the AeABR1 protein, the AeABR1 gene comprises the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing, and the AeABR1 protein comprises the amino acid residue sequence shown in SEQ ID NO.2 in the sequence listing.

3. The use according to claim 2, wherein, The chlorophyll degradation-related gene is any one or more of the genes AeCLH1, AeCLH2, AeNOL, AeSGR, AeNYC1, AeHCAR, AeRCCR, AePAO2 and AePAO4.

4. The use according to claim 3, characterized in that, The AeCLH1 gene comprises the nucleotide sequence shown in SEQ ID NO.3 in the sequence listing; the AeCLH2 gene comprises the nucleotide sequence shown in SEQ ID NO.4 in the sequence listing; the AeNOL gene comprises the nucleotide sequence shown in SEQ ID NO.5 in the sequence listing; the AeSGR gene comprises the nucleotide sequence shown in SEQ ID NO.6 in the sequence listing; the AeNYC1 gene comprises the nucleotide sequence shown in SEQ ID NO.7 in the sequence listing; the AeHCAR gene comprises the nucleotide sequence shown in SEQ ID NO.8 in the sequence listing; the AeRCCR gene comprises the nucleotide sequence shown in SEQ ID NO.9 in the sequence listing; the AePAO2 gene comprises the nucleotide sequence shown in SEQ ID NO.10 in the sequence listing; the AePAO4 gene comprises the nucleotide sequence shown in SEQ ID NO.11 in the sequence listing.

5. The use according to claims 2 to 3, characterized in that, The chlorophyll degradation-related gene is AeCLH1, and the AeCLH1 gene comprises the nucleotide sequence shown in SEQ ID NO.3 in the sequence listing. Use of siRNA for preparing a preparation for regulating chlorophyll degradation and / or plant coloration and / or plant preservation, characterized in that, The siRNA targets the AeABR1 gene, and the AeABR1 gene comprises the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing.

7. The use according to claim 6, wherein, The siRNA comprises the nucleotide sequence shown in any one or more pairs of SEQ ID NO.40 - SEQ ID NO.41, SEQ ID NO.42 - SEQ ID NO.43, SEQ ID NO.44 - SEQ ID NO.45, SEQ ID NO.46 - SEQ ID NO.47, SEQ ID NO.48 - SEQ ID NO.49 in the sequence listing.

8. The use according to claim 6 to 7, characterized in that, The siRNA comprises the nucleotide sequence shown in SEQ ID NO.42 - SEQ ID NO.43 in the sequence listing.

9. A method for regulating chlorophyll degradation and / or plant coloration and / or plant preservation, characterized in that, The method refers to targeted silencing and / or knockout of the AeABR1 gene, and the AeABR1 gene comprises the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing.

10. The method according to claim 9, wherein, Use the siRNA described in any one of claims 6 to 8 to target and silence the AeABR1 gene.

Images