Application of soybean rubisco activase encoding gene GmRCA03

Abstract

The application discloses application of a soybean Rubisco activase coding gene GmRCA03.The application of the soybean Rubisco activase coding gene GmRCA03 shown in SEQ ID NO.1 in genetic engineering modification of soybean photosynthetic rate and seed yield is disclosed.Overexpression of the GmRCA03 gene can improve the photosynthetic rate and seed yield of soybean.Mutation of the gene can reduce the photosynthetic rate and seed yield of soybean.Overexpression of the GmRCA03 gene can reduce the lodging rate, improve the photosynthetic rate and seed yield in a soybean-corn strip interplanting mode.The soybean Rubisco activase coding gene GmRCA03 can be transformed into soybean through genetic engineering, and finally positively regulates the photosynthetic rate and seed yield of soybean.

Description

Technical Field

[0001] This invention relates to the application of the soybean Rubisco activator gene GmRCA03, and belongs to the field of genetic engineering. Background Technology

[0002] Soybeans, originating in China, are rich in plant oils and proteins and are one of the world's five major crops. As a C3 crop, soybeans have a lower photosynthetic rate compared to C4 crops, making it crucial to increase their yield. Photosynthesis is the fundamental source of life's matter and energy, laying the foundation for crop biomass and yield. Ribulose-1,5-bisphosphate carboxylase / oxygenase (Rubisco), as a key rate-limiting enzyme determining carbon assimilation efficiency in photosynthesis, plays a vital role. However, Rubisco's catalytic rate is relatively low and easily inhibited by intracellular metabolites and environmental factors. Rubisco activase (RCA) is responsible for catalyzing and maintaining Rubisco in its active state. RCA uses energy generated from ATP hydrolysis to induce a conformational change in Rubisco, causing its catalytic site to open. This process triggers the release of inhibitory sugar phosphate derivatives, thereby increasing Rubisco activity. Therefore, RCA is considered a promising target for improving carbon dioxide fixation and increasing plant productivity.

[0003] To date, three types of RCA have been identified: green, red (also known as CbbX), and CbbQO. All three types belong to the AAA+ superfamily (ATPases associated with various cellular activities). Green RCA is widely distributed in all higher plants, algae, and cyanobacteria. Red RCA is specifically found in red-lineage phytoplankton and Proteobacteria. CbbQO RCA is widely distributed in chemoautotrophic Proteobacteria. These three RCA types differ significantly in their major sequences and mechanisms, indicating convergent evolution. In plants, RCA is encoded by the nucleus and synthesized in the cytoplasm. It is then transported to the chloroplast with the assistance of a transport peptide at its N-terminus, which is cleaved upon entry into the plastid. Most plants possess two RCA isoforms: a longer α-isoform and a shorter β-isoform. These two isoforms differ only at the C-terminus. Specifically, unlike the β-isoform, the α-isoform has a C-terminal extension containing redox-sensitive Cys residues. Both isoforms contain two conserved ATP-binding domains, with GGKGQGKS playing a crucial role in Rubisco activation and ATP hydrolysis, while LFIND is associated with subunit aggregation. We found that overexpression of the soybean Rubisco activator gene GmRCA03 increases soybean photosynthetic rate and seed yield, while mutation of this gene decreases both. The superior haplotype of the GmRCA03 gene exhibits high photosynthetic rate, high 100-seed weight, and high seed yield. This discovery provides a foundation for future breeding programs aimed at high photosynthetic efficiency and high yield in soybean. Summary of the Invention

[0004] The purpose of this invention is to disclose the genetic engineering application of the soybean Rubisco activator gene GmRCA03.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] The following are one or more applications of the soybean Rubisco activator gene GmRCA03 shown in SEQ ID NO.1: (A1) Application in improving the photosynthetic rate of soybean;

[0007] (A2) Applications in increasing seed yield;

[0008] (A3) Reduce soybean lodging rate.

[0009] The application is achieved by overexpressing the GmRCA03 gene.

[0010] Any one or more of the following applications of the recombinant expression vector overexpressing the soybean Rubisco activator gene GmRCA03:

[0011] (B1) Application in improving soybean photosynthetic rate;

[0012] (B2) Applications in increasing seed yield;

[0013] (B3) Reduce soybean lodging rate.

[0014] This gene is primarily expressed in soybean leaves, with almost no expression in other tissues. Subcellular localization analysis revealed that GmRCA03 is located in chloroplasts, while GmRCA03 without its N-terminal transport peptide is located in the cytoplasm. Overexpression of GmRCA03 increases photosynthetic rate and seed yield in soybeans, while mutation of this gene decreases photosynthetic rate and seed yield. Superior haplotypes of GmRCA03 exhibit high photosynthetic rate, high 100-seed weight, and high seed yield.

[0015] Beneficial effects

[0016] GmRCA03 is a soybean Rubisco activator gene, and its family is involved in the activation of Rubisco proteins in plants. In soybean, we found that GmRCA03 positively regulates photosynthetic rate and seed yield. Expression analysis showed that GmRCA03 is mainly expressed in soybean leaves. Subcellular localization analysis showed that GmRCA03 is located in chloroplasts, while GmRCA03 without its N-terminal transport peptide is located in the cytoplasm. Functional validation further confirmed that this gene positively regulates soybean photosynthetic rate and seed yield. Therefore, GmRCA03 can serve as a target for regulating soybean photosynthetic rate and seed yield, and can be used for breeding soybeans with high photosynthetic efficiency and high yield. Attached Figure Description

[0017] Figure 1 Agarose gel electrophoresis image of PCR clone GmRCA03. Target fragment size: 1425 bp. Marker: DL2000.

[0018] Figure 2 .GmRCA03 tissue expression pattern. N=3.

[0019] Figure 3 Subcellular localization analysis of GmRCA03 protein and GmRCA03 protein without the N-terminal transport peptide. GFP, GFP fluorescence; Chloroplast, chloroplast autofluorescence; Merge, fusion protein; 35S-GFP, empty vector control; 35S:GmRCA03-GFP, GmRCA03 protein with GFP tag; 35S:GmRCA03(-)-GFP, GmRCA03 protein with GFP tag and N-terminal transport peptide removed. Scale bar: 10 μm.

[0020] Figure 4Overexpression of GmRCA03 improves photosynthetic rate and seed yield in soybean. (A) Representative plant photographs of wild-type (Jack), GmRCA03 overexpressing lines OE-15, and OE-17 under field conditions. Scale bar = 10 cm. (B) Representative plant photographs of wild-type (Jack), OE-15, and OE-17 under field conditions at harvest. Scale bar = 10 cm. (C)-(E) Comparison of net photosynthetic rate (C), 100-seed weight (D), and seed yield per plant (E) of wild-type, OE-15, and OE-17 lines under field conditions in 2019, 2021 (D), and 2023 (E). (F) Comparison of seed yield per plot of wild-type (Jack), OE-15, and OE-17 plants under field conditions in 2023. The significance test was a Duncan multiple test; different letters represent significant differences of P < 0.05. Standard error (SEM).

[0021] Figure 5 The GmRCA03 mutation reduces soybean photosynthetic rate and seed yield. (A) Structure of the GmRCA03 gene and mutation locations in the two mutants gmrca03-1 and gmrca03-2. (B) Photographs of representative wild-type (W82), gmrca03-1, and gmrca03-2 plants under field conditions. Scale bar = 10cm. (C) Photographs of representative wild-type (W82), gmrca03-1, and gmrca03-2 plants under field conditions at harvest. Scale bar = 10cm. (D) Comparison of net photosynthetic rate among wild-type (W82), gmrca03-1, and gmrca03-2 plants. (E) Comparison of seed yield per plant among wild-type (W82), gmrca03-1, and gmrca03-2 plants. Two-tailed test, **: P < 0.01; ***: P < 0.001. The error bars represent ±SEM.

[0022] Figure 6 Overexpression of GmRCA03 reduced lodging rate and increased photosynthetic rate and seed yield in a soybean-maize strip intercropping pattern. (A) Comparison of net photosynthetic rate (A) and seed yield per plant (B) between wild-type (Jack) and GmRCA03-overexpressing line OE-17 in a soybean-maize strip intercropping pattern. (C) Comparison of lodging rate between Jack and OE-17 at four stages in a soybean-maize strip intercropping pattern. 1, 2, 3, and 4 represent stages V6, R2, R4, and R6, respectively. Two-tailed test, *: P < 0.05; **: P < 0.01. Error bars represent ±SEM. Detailed Implementation

[0023] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0024] Unless otherwise specified, the methods used in the following embodiments are conventional methods.

[0025] Example 1

[0026] 1) Cloning of the soybean Rubisco activator gene GmRCA03

[0027] Using the soybean variety Kefeng No. 1 as the research object, its leaves were ground, and the ground sample was added to a 1.5 mL EP tube containing lysis buffer. After thorough shaking, it was transferred to another 1.5 mL EP tube to extract total RNA (using Total RNA Kit, Tiangen, Beijing, China). The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis, and the RNA content was determined by spectrophotometry. Using the obtained total RNA as a template, reverse transcription was performed according to the TaKaRa Primer Script kit provided by TaKaRa Corporation, Japan. TM The cDNA first strand was synthesized by reverse transcription according to the instructions of the RT reagent kit (Japan). PCR amplification was then performed, with the following procedure: 95°C pre-denaturation for 3 minutes; 95°C denaturation for 15 seconds; 58°C annealing for 15 seconds; 72°C extension for 45 seconds, for a total of 35 cycles; finally, incubation at 72°C for 5 minutes, followed by cooling to 4°C for isothermal treatment, thus obtaining the cDNA of Kefeng No. 1.

[0028] The gene corresponding to GmRCA03 (Glyma.03g068100, Gene ID: 100795298) was found from the NCBI database and the Phytozome v13 soybean database. Specific primers were designed based on the nucleotide sequences provided in the databases: F1: atgacagatcctcagtccaattt and R1: tcacattgaactctccccatcatgt. The gene was amplified from the coding region (CDS) sequence of the soybean variety Kefeng No. 1 and cloned by PCR. Subsequently, the PCR product was purified by gel extraction, ligated, and transformed. Positive single clones were selected for sequencing. Finally, the complete coding region CDS sequence of the soybean GmRCA03 gene was obtained, with a length of 1425 bp. The coding region sequence is shown in SEQ ID NO. 1, with a size of 1425 bp. Figure 1 The amino acid sequence is shown in SEQ ID NO.2.

[0029] 2) Tissue expression analysis of GmRCA03

[0030] To identify the expression level of GmRCA03 in different tissues, we collected root, stem, leaf, flower, pod, and seed samples from the soybean variety Kefeng No. 1 at different developmental stages. Roots, stems, and leaves were collected at stage V4; mature flowers at stage R2; and seeds and pods were collected 15 days after flowering. All samples were flash-frozen in liquid nitrogen and stored at -80°C. Total RNA extraction was performed according to step 1. Using the total RNA obtained from each tissue as a template, cDNA was synthesized via reverse transcription. The primer sequences for quantitative real-time PCR of the GmRCA03 gene are shown in F2: ctcagagaggcccttcctct and R2: cctctacaacatttgaggaggg. When detecting changes in GmRCA03 gene expression in each tissue, the soybean internal reference gene Tubulin was used as an internal reference, with primer sequences shown in F3: ggagttcacagaggcaga and R3: cacttacgcatcacatagca, followed by real-time quantitative PCR.

[0031] GmRCA03 is mainly expressed in soybean leaves, with lower expression levels in roots, stems, flowers, pods, and seeds. Figure 2 The result indicates that GmRCA03 may play a role in the leaves.

[0032] Example 2

[0033] 1) Cloning of the soybean Rubisco activator gene GmRCA03

[0034] Using total RNA from soybean cultivar Kefeng No. 1 leaves as a template, cDNA was synthesized via reverse transcription, followed by PCR amplification. The primer sequences are as follows: F4: acaaatctat ctctctcgag atggccgcct cagtaccaa and R4: gctcaccatggatccaaatt tgtatgtgca gcttccatc. The procedure was as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds; 58℃ annealing for 15 seconds; 72℃ extension for 45 seconds, for a total of 35 cycles; finally, incubation at 72℃ for 5 minutes, followed by isothermal cooling to 4℃. Sequencing yielded the CDS sequence of the soybean GmRCA03 gene, which does not contain a stop codon. In addition, using primer sequences F5: acaaatctat ctctctcgag atgcaatgtg agcttgtctt tgcc and R4: gctcaccatggatccaaatttgtatgtgca gcttccatc, a PCR reaction was performed to obtain the GmRCA03 gene sequence (named GmRCA03(-)) without the N-terminal transport peptide and lacking a stop codon. The PCR program was as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds; 58℃ annealing for 15 seconds; 72℃ extension for 30 seconds, for a total of 35 cycles; finally, incubation at 72℃ for 5 minutes, followed by cooling to 4℃ for isothermal operation.

[0035] 2) Construction of subcellular localization vectors

[0036] In constructing the subcellular localization vector, the CDS sequence of the soybean GmRCA03 gene (without a stop codon) and GmRCA03(-) were inserted into the pAN580 expression vector containing a GFP tag. This vector is equipped with a 35S promoter, which can effectively induce the expression of the target gene GmRCA03 in the receptor. An empty pAN580 vector was used as a control group.

[0037] 3) Subcellular localization of GmRCA03

[0038] The vectors 35S:GmRCA03-GFP, 35S:GmRCA03(-)-GFP, and 35S:GFP were transformed into *E. coli*, followed by plasmid extraction. The plasmids were then transformed into *Arabidopsis thaliana* protoplasts, and after culturing for 12-18 hours, the localization of the reporter gene GFP was observed using a Leica TCS SP2 laser confocal microscope. GFP signal analysis showed that the GmRCA03-GFP fusion protein was located in chloroplasts, the GmRCA03(-)-GFP fusion protein was located in the cytoplasm, while the empty vector was located throughout the tobacco cell. Figure 3 ).

[0039] Example 3: Genetic Engineering Applications of Gene GmRCA03

[0040] 1) Cloning of the soybean Rubisco activator gene GmRCA03

[0041] Using total RNA from soybean cultivar Kefeng No. 1 leaves as a template, cDNA was synthesized via reverse transcription, followed by PCR amplification. The primer sequences are shown as follows: F4: acaaatctatctctctcgag atggccgcctcagtaccaa and R4: gctcaccatggatccaaatttgtatgtgcagcttccatc. The procedure was as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds; 58℃ annealing for 15 seconds; 72℃ extension for 45 seconds, for a total of 35 cycles; finally, incubation at 72℃ for 5 minutes, followed by isothermal cooling to 4℃. Sequencing yielded the CDS sequence of the soybean GmRCA03 gene with a complete coding region, shown in SEQ ID NO. 1.

[0042] 2) Construction of plant expression vectors

[0043] When constructing the gene overexpression vector, the coding sequence of GmRCA03 containing the complete ORF was inserted into the D60003 vector (Dabeinong Group) to obtain the recombinant vector D60003-GmRCA03. The specific primer sequences required for the PCR reaction are the same as in step 1 of Example 1).

[0044] 3) Creation of GmRCA03 overexpression in soybean

[0045] 1. The soybean cultivar Jack was transformed using the cotyledonary node transformation method. First, the leaf axils of soybean plants grown for 5-6 days were wounded. Then, the GmRCA03 overexpression vector obtained in step 2 was inoculated into the wounds in the soybean leaf axils and cultured at 25℃ for 4-5 days. Subsequently, the samples were washed with sterile ultrapure water and Wish-Liquid, and placed in SIM medium without glufosinate, cultured at 26℃ under light for 15 days to induce shoot emergence. After 15 days, the samples were transferred to SIM medium supplemented with 6 mg / L glufosinate. Subculture was then performed every 15 days, with the glufosinate dosage gradually reduced. When the shoots on the explants grew to approximately 6 cm, they were transferred to rooting medium and cultured for approximately 10 days to induce root development. Once the roots had fully developed, the plants were transplanted. DNA was extracted from the leaves of the transgenic plants. Transgenic plants were detected using overexpression identification primers F6: gctcctacaa atgccatcattgc and R6: tcacattgaactctccccatcatgt.

[0046] 4) GmRCA03 overexpression in soybeans increases photosynthetic rate and seed yield.

[0047] We selected two independent overexpression lines, OE-15 and OE-17, for phenotypic investigation. Compared with wild-type (WT) Jack, the net photosynthetic rate of the OE-15 and OE-17 lines was significantly increased by 6.2% and 9.6%, 9.3% and 14.3%, and 6.9% and 10.3% in pot conditions in 2019, field conditions in 2021, and field plot conditions in 2023, respectively. Phenotypic assessment of agronomic traits showed that GmRCA03 overexpressing plants generally grew better than WT plants. Furthermore, GmRCA03 overexpression significantly increased 100-seed weight, seed yield per plant, and plot yield. Figure 4 ).

[0048] Example 4: Genetic Engineering Applications of Gene GmRCA03

[0049] Soybean seeds with the GmRCA03 gene mutation were obtained from the iSoybean soybean mutant library (http: / / isoybean.org). This mutant library was obtained by Professor Song Qingxin's research group at Nanjing Agricultural University through ethyl methane sulfonate (EMS) mutagenesis. We selected two homozygous mutant lines for further study, named gmrca03-1 and gmrca03-2, respectively. These plants were planted at the Liuhe Experimental Base of Jiangsu Academy of Agricultural Sciences. At the R2 stage, photosynthetic rate was measured using a LI-6800XT photosynthesis system; individual plant yield was investigated at maturity. Under field conditions, the gmrca03 mutant showed weaker growth vigor than the WT mutant. Phenotypic analysis showed that the gmrca03 mutant significantly reduced photosynthetic rate and seed yield. The results indicate that mutations in the GmRCA03 gene reduce the photosynthetic rate and seed yield of soybean. Figure 5 ).

[0050] Example 5: Genetic Engineering Application of Gene GmRCA03

[0051] Wild-type control Jack and GmRCA03 overexpression material OE-17 were planted at the Liuhe Transgenic Experimental Base of Jiangsu Academy of Agricultural Sciences. The row ratio of maize to soybean was 2:2, with wide rows of 1.6 meters and narrow rows of 0.4 meters. The spacing between maize and soybean plants was 60 cm, and the plant spacing was 13-14 cm. The maize variety used was "Zhengdan 958". Lodging rate was investigated at V6, R2, R4, and R6 stages, photosynthetic rate was measured at R2 stage, and yield per plant was investigated at harvest. Compared with Jack, OE-17 plants showed a lower lodging rate and higher net photosynthetic rate and seed yield during the vegetative growth stage (V6) and the three reproductive growth stages (R2, R4, and R6). Figure 6 ).

Claims

1. The application of the soybean Rubisco activator gene GmRCA03 shown in SEQ ID NO. 1 in reducing soybean lodging rate, characterized in that, The application is achieved by overexpressing the GmRCA03 gene.

2. Application of the recombinant expression vector overexpressing the soybean Rubisco activator gene GmRCA03 as described in claim 1 to reduce soybean lodging rate.

Images