PeARF3, a Phalaenopsis gene used to regulate the growth of Phalaenopsis orchid spurs, and its applications.

By regulating the growth of Phalaenopsis orchid spurs through genetic engineering and utilizing PeARF3 silencing technology, the number and proportion of Phalaenopsis orchid spurs produced were significantly increased, solving the problem of unclear development mechanism of Phalaenopsis orchid spurs and enhancing their ornamental value.

CN120350018BActive Publication Date: 2026-07-17SHANGHAI NORMAL UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANGHAI NORMAL UNIVERSITY
Filing Date
2024-12-30
Publication Date
2026-07-17

AI Technical Summary

Technical Problem

The formation and development mechanism of the spur in Phalaenopsis orchids is still unclear, making it difficult to breed varieties with higher ornamental value.

Method used

Using genetic engineering techniques, the pCymMv viral plasmid was constructed using the PeARF3 gene from Phalaenopsis orchids and transformed into Agrobacterium rhizogenes EHA105 to silence the expression of PeARF3 in the Phalaenopsis orchid lip, and the growth of the flower spur was observed.

Benefits of technology

It significantly increased the quantity and proportion of Phalaenopsis orchids produced, providing a theoretical basis for the targeted improvement of Phalaenopsis orchids and enhancing their ornamental value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350018B_ABST
    Figure CN120350018B_ABST
Patent Text Reader

Abstract

This invention provides a Phalaenopsis orchid gene PeARF3 for regulating the growth of Phalaenopsis orchid spurs and its applications. The PeARF3 gene has the nucleotide sequence shown in SEQ ID NO.1. This invention explores the developmental mechanism of Phalaenopsis orchid spurs through genetic engineering and cultivates superior Phalaenopsis orchid varieties, thereby enhancing the ornamental value of Phalaenopsis orchids and providing a theoretical basis and new ideas for the targeted improvement of Phalaenopsis orchid varieties in the future.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a Phalaenopsis gene PeARF3 for regulating Phalaenopsis orchid spacing and its applications. Background Technology

[0002] Orchids possess unique shapes and structures, making them beloved not only in horticulture but also significant in biology. Phalaenopsis orchids, often called the "Queen of Orchids" among tropical orchids, are prized for their elegance, long blooming period, and suitability for beautifying living rooms and bedrooms. They have high ornamental value and are popular in both domestic and international markets. Orchid flowers play many roles in nature, including attracting pollinators, maintaining symbiotic relationships with insects, and securing a dominant ecological niche.

[0003] A spur is a cone-shaped or sac-like hollow protrusion extending from floral organs such as petals and sepals in angiosperms. It usually contains nectar and is also called a nectar spur. The spur plays an important biological role in plants, especially in its interaction with pollinators. The formation and development of the spur involves a series of complex cellular and molecular mechanisms. Studies have shown that the development of the spur can be roughly divided into two stages: first, cell division concentrates around the location of spur formation, forming the initial shape of the spur; subsequently, cell division gradually stops, and the spur grows through cell elongation until flowering. In terms of molecular mechanisms, some genes are believed to be involved in spur formation, such as members of the KNOTTED1-like homeobox (KNOX) gene family, which play an important role in regulating the morphogenesis of plant organs. However, it is not entirely clear which genes regulate spur formation in orchids. However, the presence of spurs is not universal in orchids; for example, *Angraecum* has long spurs, while *Phalaenopsis* lacks them. This may be related to a specific evolutionary history. Furthermore, as transcription factors, auxin-responsive factors (ARFs) regulate the expression of early auxin-responsive genes by specifically binding to auxin-responsive elements. ARF proteins contain three conserved domains: the DNA-binding domain (DBD), the intermediate region (MR), and Phox and Bem1 (PB1). Auxin plays a crucial role in flower development. In roses, silencing RhARF18 upregulated RhAG expression, leading to homologous conversion from petals to stamens. In columbine, studies have reported that AqARF6 and AqARF8 are involved in establishing flower spurs. ARF family transcription factors may play an important role in orchid flower spur establishment. Therefore, molecular biology-based breeding of Phalaenopsis orchids to cultivate those with beautiful and more ornamental flowers has attracted widespread attention from researchers. Summary of the Invention

[0004] The purpose of this invention is to provide a gene PeARF3 that regulates the growth of Phalaenopsis orchid spurs and its application. By using genetic engineering methods, this invention aims to explore the developmental mechanism of Phalaenopsis orchid spurs and cultivate superior Phalaenopsis orchid varieties, thereby making Phalaenopsis orchids more ornamental and providing a theoretical basis and new ideas for the targeted improvement of Phalaenopsis orchid varieties in the future.

[0005] The first aspect of the present invention provides a gene PeARF3 that regulates the growth of Phalaenopsis orchid spurs, said gene PeARF3 having the nucleotide sequence shown in SEQ ID NO.1.

[0006] A second aspect of the present invention provides a viral plasmid comprising the aforementioned gene PeARF3.

[0007] Furthermore, the viral plasmid is a pCymMv viral plasmid that includes the PeARF3 gene.

[0008] A third aspect of the present invention provides a recombinant transformant comprising the viral plasmid described above.

[0009] Furthermore, the recombinant transformant is Agrobacterium tumefaciens EHA105 containing the viral plasmid.

[0010] The fourth aspect of this invention provides the application of the above-mentioned gene PeARF3, viral plasmid, and recombinant transformant in regulating the growth of Phalaenopsis orchids.

[0011] The fifth aspect of this invention provides a method for regulating the growth of Phalaenopsis orchid spurs, including downregulating the expression of the gene PeARF3 in the Phalaenopsis orchid lip.

[0012] Furthermore, the expression of the PeARF3 gene in the Phalaenopsis orchid was downregulated, specifically including:

[0013] The PeARF3 gene was ligated into the pCymMv viral plasmid to construct the viral plasmid.

[0014] The viral plasmid was transformed into Agrobacterium tumefaciens EHA105 to obtain a recombinant transformant.

[0015] Phalaenopsis orchids were cultured by infecting Phalaenopsis orchid leaves with the recombinant transformant, resulting in Phalaenopsis orchids with downregulated expression of the PeARF3 gene.

[0016] Furthermore, the Phalaenopsis orchid mentioned is the 'Cherry Tomato' Phalaenopsis orchid.

[0017] Furthermore, the cultivation process includes: shading the Phalaenopsis orchids for 12 hours, then restoring them to light, and cultivating them at 23°C to observe the growth of the flower spurs.

[0018] Compared with existing technologies, this invention utilizes the PeARF3 gene of Phalaenopsis orchids to explore the development mechanism of Phalaenopsis orchid buds through genetic engineering and to cultivate superior Phalaenopsis orchid varieties, thereby making Phalaenopsis orchids more ornamental and providing a theoretical basis and new ideas for the targeted improvement of Phalaenopsis orchid varieties in the future. Attached Figure Description

[0019] Figure 1 Phylogenetic tree of ARF3;

[0020] Figure 2 The amino acid sequences of PeARF3 were compared with those of homologous proteins in Arabidopsis thaliana, rice, and maize.

[0021] Figure 3 The expression of PeARF3 in various organs of the lip;

[0022] Figure 4 The growth of flower spurs after the pCymMv-PeARF3 vector was transferred into Phalaenopsis orchids;

[0023] Figure 5 The proportion of flowers with regenerated flower spurs on the lip of Phalaenopsis orchids after the pCymMv-PeARF3 vector was transferred into Phalaenopsis orchids;

[0024] Figure 6 The expression levels of CP protein-coding genes and PeARF3 in various organs of EV and pCymMv-PeARF3;

[0025] Figure 7 Expression of polarity-related genes in the lip region of CymMv-PeARF3 compared to the control line. Detailed Implementation

[0026] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0027] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in Sambrook et al., *Molecular Cloning: A Laboratory Manual* (New York: Cold Spring Harbor Laboratories Press, 1989), or as recommended by the manufacturer. Unless otherwise specified, all reagents used were commercially available or publicly available.

[0028] Example 1: Obtaining the PeARF3 gene from Phalaenopsis orchids

[0029] Total RNA was extracted from cherry tomato and Phalaenopsis orchid leaves using the RNAplant kit (commercially available) following the instructions of the RNAprep Pure Plant Plus Kit (Polysaccharides & Polyphenolics-rich). The total RNA was then reverse transcribed into cDNA using a reverse transcription kit (commercially available). Primers were designed based on the genome sequencing results (5'→3'F (SEQ ID NO.2): ATGGGGATCGATCTGAACACG; 3'→5'R (SEQ ID NO.3): TCAGCAAGCTCCGGGAGATTAA). An RT-PCR method was used to amplify a 2160 bp band from the cDNA. The PCR product was recovered, and the gene PeARF3 was obtained, its nucleotide sequence of which is shown in SEQ ID NO.1.

[0030] Example 2: PeARF3 gene sequence analysis

[0031] To clarify the phylogenetic relationship between the PeARF3 gene and homologous genes in model plants, we downloaded the amino acid sequence of PeARF3 from cherry tomato and Phalaenopsis orchids from NCBI, performed a homologous sequence search for the PeARF3 gene in NCBI, and used MEGA software to align the encoding amino acids of the homologous sequences and construct a phylogenetic tree. Figure 1 Analysis of the homology between PeARF3 and ARF family members in Arabidopsis thaliana, rice, and maize showed that PeARF3 had a high similarity to AtARF3 in Arabidopsis thaliana, with a homology of approximately 34.87%. Figure 2 ).

[0032] Example 3: PeARF3 gene expression analysis

[0033] To characterize the expression of PeARF3 in various tissues of the lip of the Phalaenopsis orchid 'Cherry Tomato', the lower epidermis, lateral lobes, and corpus callosum were isolated from the lip of the orchid as templates. The expression level of the PeARF3 gene was detected using primers PeARF3-F (SEQ ID NO.4): 5'-CAGGCCATGGATGCACTAGA-3' and PeARF3-R (SEQ ID NO.5): 5'-AGTTGGTGAGAACGTAACCTCA-3'. The following procedure was used: pre-denaturation at 98℃ for 30 s, followed by 40 cycles (98℃ for 10 s, 58℃ for 30 s), and extension at 72℃ for 10 min. The procedure was performed according to the instructions of the HiscriptIIQRT SuperMix for qPCR (+gDNAwiper) (Vazyme Biotech Co., Ltd.) kit.

[0034] The expression of the PeARF3 gene was quantified by taking lateral lobes, calluses, and lower epidermis from the lip of the Phalaenopsis 'Cherry Tomato' flower. Figure 3 The results showed that the expression of the PeARF3 gene in the corpus callosum was significantly higher than that in the lower epidermis and lateral lobes, indicating that the PeARF3 gene may play a role in the formation of the corpus callosum, and also suggesting that it does not induce the formation of spur-like organs in the lower epidermis when it is not silenced.

[0035] Example 4: Silencing the PeARF3 gene induced by pCymMv virus

[0036] (1) Using the PeARF3 gene as a template, VIGS primers (5'→3'F (SEQ ID NO.6): CTTCCAAGGAAGGGGAGCTT; 3'→5'R (SEQ ID NO.7): CATATGCGGAAC TGGGGATTGG) were designed, and this part of the sequence was ligated to the pCymMv viral plasmid to form a viral plasmid.

[0037] (2) The viral plasmid was transferred into Agrobacterium tumefaciens EHA105 and cultured to obtain bacterial solution. The bacterial solution was injected into the leaves of cherry tomato and Phalaenopsis orchid by leaf injection. The PeARF3 gene was silenced by virus-induced gene silence (VIGS). At the same time, a control group pCymMv empty vector bacterial solution was injected, that is, the viral pCymMv vector without the PeARF3 gene was transformed into Agrobacterium tumefaciens EHA105.

[0038] (3) After leaf infection, the Phalaenopsis orchid was shaded for 12 hours and then restored to normal light and cultured at 23℃.

[0039] (4) Observe the growth of the organs on the dorsal side of the labia. Observe once every seven days. The observation results are as follows: Figure 4 As shown, the experimental group pCymMv-PeARF3 plants showed a significant difference in flower spacing growth compared to the control group (CK). Finally, analysis of the percentage of flower giant mutations, including the total number of petals and the number of flower giants produced, revealed that the experimental group pCymMv-PeARF3 showed a significantly higher mutation rate than the control group, averaging 30%. Figure 5 Example 5: Analysis of the expression of PeARF3 and CP protein-coding genes in the pCymMv-PeARF3-silenced Phalaenopsis orchid line.

[0040] Example 5: Analysis of the expression of PeARF3 and CP protein encoding genes in pCymMv-PeARF3-silenced Phalaenopsis orchid lines

[0041] 1. Preparation of cDNA from the material

[0042] The pCymMv-PeARF3 silent strain of Phalaenopsis orchid 'Cherry Tomato' and the wild-type control strain were used as controls. 200 mg each of different parts of the upper lip of the flower—the lower epidermis, callus, and lateral lobes—were extracted for RNA using the RNAprepPure Plant Plus Kit (Polysaccharides & Polyphenolics-rich) instructions. The obtained RNA was then used to prepare cDNA using HiScript II Enzyme Mix.

[0043] 2. Gene expression verification

[0044] To characterize the expression of PeARF3 in various organs of the lip in the silenced strain and the accumulation of viral CP protein, the pCymMv-PeARF3 silenced strain and control strain of Phalaenopsis orchid 'Cherry Tomato' were used as templates. Primers PeARF3-F: 5'-CAGGCCATGGATGCACTAGA-3' and PeARF3-R: 5'-AGTTGGTGAGAACGTAACCTCA-3' were employed, along with CP-RT-F (SEQ ID NO. 8).

[0045] 5'-GCCTGCTGAATGGCAGCG-3' and CP-RT-R (SEQ ID NO.9): 5'-TCGGCAATGTTGGTGATGAGG-3' were used to detect the expression levels of PeARF3 and CP genes in two lines. The following procedure was used: 98℃ pre-denaturation for 30 s, followed by 40 cycles (98℃ for 10 s, 58℃ for 30 s), and extension at 72℃ for 10 min. The procedure was performed according to the instructions of the HiscriptIIQRT SuperMix for qPCR (+gDNA wiper) (Vazyme Biotech Co., Ltd). The results showed that the expression level of CP was significantly increased in all parts of the lip in the silenced line, including the lateral cleft, corpus callosum, and lower epidermis, compared with the control line. Figure 6 This indicates that CymMV virus accumulates significantly in the silenced strain, and the virus functions normally. However, the expression levels of PeARF3 in the lower epidermis, lateral cleft, and corpus callosum were significantly lower than in the control strain, indicating that PeARF3 expression was silenced. Figure 6 This suggests that the PeARF3 gene may be involved in controlling the development of the lip and may also play an important role in the formation of the spur.

[0046] Example 6: Analysis of polar network-related gene expression in the corpus callosum of the pCymMv-PeARF3 silencing line

[0047] Polar network genes in plants play a crucial role in the morphogenesis of plant organs and exhibit regulatory relationships among themselves. The expression levels of PeARF3, PeARF4, PeKAN2, PeHOX32, PeYABBY2, and PeYABBY5 in the polar network of the Phalaenopsis orchid 'Cherry Tomato' were quantified using calluses from the lip of the flower. The results showed that the expression levels of the adaxial genes PeARF3, PeARF4, PeHOX32, PeYABBY2, and PeYABBY5 were all downregulated. Figure 7 This suggests that the formation of flower-like organs may be due to the suppression of the expression of genes related to the polar network on the lip.

[0048] In summary, the PeARF3 gene, when silenced, induces an organ resembling a spur on the back of the lip in Phalaenopsis orchids, providing a theoretical basis and new ideas for the targeted improvement of Phalaenopsis orchid varieties in the future.

[0049] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Downregulate genes PeARF3 Application of the gene in inducing spur growth in Phalaenopsis orchids PeARF3 The nucleotide sequence is shown in SEQ ID NO. 1, and the Phalaenopsis orchid is the 'Cherry Tomato' Phalaenopsis orchid.

2. A method for promoting the growth of Phalaenopsis orchid spurs, characterized in that, By downregulating the genes in the lip of the Phalaenopsis orchid PeARF3 The expression of the gene PeARF3 The nucleotide sequence is shown in SEQ ID NO. 1, and the Phalaenopsis orchid is the 'Cherry Tomato' Phalaenopsis orchid.

3. The method according to claim 2, characterized in that, Down-regulation of genes in the leaves of the Phalaenopsis orchid PeARF3 The expressions specifically include: Genes PeARF3 Link the pCymMv viral plasmid to construct the viral plasmid; The viral plasmid was transformed into Agrobacterium rhizogenes to obtain recombinant transformants; The recombinant transformant was used to infect Phalaenopsis orchid leaves, and the gene was cultured. PeARF3 Phalaenopsis orchids that express a downward tone.

4. The method according to claim 3, characterized in that, The cultivation includes: After shading the Phalaenopsis orchids for 12 hours, they were restored to light and cultured at 23℃ to observe the growth of the flower spurs.