SNP molecular marker for identifying coilia ectenes and coilia brachycephala and application thereof

Abstract

The application discloses SNP molecular markers for identifying Coilia ectenes and Coilia nasus and application thereof, and belongs to the technical field of DNA molecular identification. The marker is selected from any one or more of SNP1-SNP5, the SNP1-SNP5 are located on an amplification product with a nucleotide sequence as shown in SEQ ID NO:1, and are located at the 185th, 231th, 259th, 322th and 412th positions respectively; the Coilia ectenes correspond to T, A, T, A and A at the SNP1-SNP5 sites respectively, and the Coilia nasus correspond to C, G, C, T and C at the SNP1-SNP5 sites respectively. The SNP molecular markers developed by high-coverage genome only need one pair of primers to realize efficient and accurate species identification, and provide strong technical support for subsequent Coilia ectenes population genetics research, germplasm resource assessment and key habitat protection and other related management measures.

Description

Technical Field

[0001] This invention belongs to the field of DNA molecular identification technology, specifically relating to an SNP molecular marker for identifying Coilia ectenes and Coilia shortjaws and its application. Background Technology

[0002] As a typical anadromous fish, the Chinese anchovy migrates from the sea to the Yangtze River in spring for spawning, producing offspring in the main stream of the middle and lower reaches of the Yangtze River and its connected lakes. Another freshwater resident fish with a similar morphology, the short-jawed anchovy, is also distributed in the main stream of the middle and lower reaches of the Yangtze River and its connected lakes. Typical adult individuals of the two species can be distinguished by the length of their maxillae: the short-jawed anchovy has a shorter maxilla, extending posteriorly beyond the posterior margin of the operculum (maxilla length / head length ratio significantly less than 1), while the Chinese anchovy's maxilla extends posteriorly to the base of the pectoral fin (maxilla length / head length ratio significantly greater than 1). However, in the early life stages of both the Chinese anchovy and the short-jawed anchovy (including eggs, larvae, and juveniles), their morphological characteristics are highly similar due to the incomplete differentiation of their jaws, leading to significant difficulties in species identification and severely hindering the accurate identification and effective protection of key habitats such as the Chinese anchovy's spawning and nursery grounds. In addition, some atypical adult anchovies or short-jawed anchovies have been found in waters such as Taihu Lake and Hongze Lake. Their maxilla development shows an incompletely differentiated intermediate form (the ratio of maxilla length to head length is close to 1). These atypical individuals also cannot be reliably identified by traditional morphological characteristics.

[0003] While traditional morphological methods offer advantages such as ease of operation and intuitiveness, their practical application is limited by the high similarity and overlapping traits between *Coilia ectenes* and *Coilia serratifolia*, leading to potential misidentification. Subsequently, some molecular biology studies have used molecular markers such as mitochondrial genes (Cytb, D-loop, COI) and nuclear genes (AFLP, SSR) to analyze the genetic relationship between the two species. However, these markers are limited to specific genes or regions, resulting in low analytical power and resolution, making it difficult to effectively distinguish between *Coilia ectenes* and *Coilia serratifolia*. Previous studies have developed SNP molecular markers for distinguishing the two species using cross-species target gene enrichment methods, but the low genome coverage has resulted in a lack of representativeness. Other studies have published SNP sites and primers for distinguishing the two species based on genomic differences between *Coilia ectenes* and *Coilia serratifolia*, but this method requires amplification of multiple primer pairs.

[0004] Therefore, in order to address the technical problems existing in the current technology, such as the susceptibility of misjudgment by traditional morphological methods, the low resolution of single molecular markers, and the lack of representativeness of SNP molecular markers, there is a need for a precise and efficient genetic molecular marker and method to distinguish between Coilia ectenes and Coilia septemlobus. Summary of the Invention

[0005] Technical problem solved: To address the above-mentioned technical problem, this invention provides SNP molecular markers for identifying Coilia ectenes and Coilia shortjaw, and their applications. It provides 5 SNP molecular markers and their primer pairs, providing effective genetic molecular markers for accurate and efficient identification of Coilia ectenes and Coilia shortjaw.

[0006] Technical solution: SNP molecular markers for identifying Coilia ectenes and Coilia septemlobus are selected from any one or more of SNP1 to SNP5. SNP1 to SNP5 are located on the amplification product with the nucleotide sequence shown in SEQ ID NO:1, and are located at positions 185, 231, 259, 322, and 412, respectively. For Coilia ectenes, SNP1 to SNP5 correspond to T, A, T, A, A, respectively, while for Coilia septemlobus, SNP1 to SNP5 correspond to C, G, C, T, C, respectively.

[0007] Preferably, the nucleotide sequences of the primer pairs used for amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0008] The application of the above SNP molecular markers in the identification of Coilia ectenes and Coilia septemlobus.

[0009] A method for distinguishing between Coilia ectenes and Coilia septemlobus, which distinguishes between Coilia ectenes and Coilia septemlobus by detecting the base types of any one or more of the above SNP1 to SNP5.

[0010] Preferably, the method includes the following steps:

[0011] Step 1: Extract sample DNA and amplify the sample DNA using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3;

[0012] Step 2: Based on the base types of any one or more SNPs 1-5 in the nucleotide sequence of the amplified product, determine whether the sample is Coilia ectenes or Coilia septemlobus.

[0013] Preferably, the nucleotide sequences of the primer pairs used for amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0014] Preferably, the sample is an adult or juvenile anchovy or short-jawed anchovy.

[0015] Preferably, the criteria for judgment are as follows: for *Anchovy davidii*, the SNP1 to SNP5 sites correspond to T, A, T, A, A respectively, and for *Anchovy brevis*, the SNP1 to SNP5 sites correspond to C, G, C, T, C respectively.

[0016] A kit for identifying Coilia ectenes and Coilia septemlobus, the kit comprising primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3.

[0017] The application of the above kit in the identification of Coilia ectenes and Coilia septemlobus.

[0018] Beneficial Effects: Based on the high-quality chromosome-level genomes of *Coilia ectenes* and *Coilia serratifolia* assembled by our research group, and combined with resequencing data from 11 populations of these two species, this invention screened out 5 representative SNP molecular markers and their corresponding primer pairs. This invention utilizes SNP molecular markers developed with high-coverage genomes, requiring only one primer pair to achieve efficient and accurate species identification. This provides strong technical support for subsequent population genetics research on *Coilia ectenes*, germplasm resource assessment, and the formulation of related management measures for the protection of key habitats. Attached Figure Description

[0019] Figure 1 Sequence alignment and identification of specific SNP sites of Coilia ectenes and Coilia shortjaw.

[0020] Figure 2 Sequencing peak diagram of samples from *Anchovy davidii* and *Anchovy septemlobus*.

[0021] Figure 3 Agarose gel electrophoresis results of PCR products from 60 adult fish and 30 juvenile fish.

[0022] Figure 4 Sequence alignment and identification of specific SNP sites in juvenile anchovies. Detailed Implementation

[0023] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. Unless otherwise specified, the reagents and experimental materials described in the embodiments are commercially available.

[0024] This invention provides SNP molecular markers for identifying codfish and anchovy, selected from any one or more of SNP1 to SNP5. SNP1 to SNP5 are located on the amplification product with the nucleotide sequence shown in SEQ ID NO:1, specifically at positions 185, 231, 259, 322, and 412, respectively. For codfish, SNP1 to SNP5 correspond to T, A, T, A, and A, respectively; for anchovy, SNP1 to SNP5 correspond to C, G, C, T, and C, respectively.

[0025] SNP1 to SNP5 and their corresponding sequences are as follows:

[0026] AGATAGCTGTTTAAGGTGATGATAGATAAGGAGGCTTAAGAATAGTAGGTGCATTATGGACTTGTATGTTTGAATGCTCCGGTAGGCACTCTGGCTCAACACTGAAATGCTCCACTGGGAAGTTCTCACTTCTTGTACGTCACACACCA AGTTTCCATGAGGGCTTTTCCCTTCTTCTCCTTT[T / C]CCCCCCAGACTGGACTGAGGTAAAACCTAAATTCATTTGGAGGGA[A / G]GCTGAAGTGGCCGCTAGCCCAGTGCTC[T / C]AGAGGGTTTGCTGAATCACAGGGTTCTG ACTACAAAGTGAACTCTGCATCAAGGAATGAGTT[A / T]CCACAGAGGCAGAAGGAAAA GACTGCAACTATAAAGGTGTTCTATGGAACTGATGACAGAAACAGTTGATGACAGTGCC CACAATAGAT[A / C]ACTTTTTAGTAAAAGAAAGGTTTTCTGCTTTAAAACATACTTTCAGT GTATGTTTGTTATAATCACTGCACCATTACATTTCCATGTAGACAAATGTATTTAAAGGAAGCAGGAGTTACCCTCAAAGACCCCATCAGGCAAACATACATGACCGCATATACGTTTATATGCCTGTTGGCATTATTAAATTCCATTTTATAATATCAATCAGCCTGAGTGGCTGTAATGATA ATGAGTGGAGACCCACCTCACAGTGCTCTGGAGCGACATATTTGGAGTAATGCAATACTGAGTTTTCTGTGCACTATTCAGAGCCAATCAAAATTGCGTAGACTGGAACGGGGAACTGAGTGGTGGGGTCTGAGGGGGATATTATTTTGGTTTGTACACTATCTGTGGCATGAATCAT(SEQ ID NO:1)

[0027] The SNP1 site is labeled T / C and is located at positions 2,133,317 of chromosome 24 of the Coilia ectenes genome.

[0028] The SNP2 site is labeled A / G and is located at positions 2,133,363 of the genome sequence on chromosome 24 of the Chinese anchovy.

[0029] The SNP3 site is labeled T / C and is located at positions 2,133,391 of chromosome 24 of the Coilia ectenes genome sequence.

[0030] The SNP4 site is labeled A / T and is located at positions 2,133,454 of the genome sequence on chromosome 24 of the Chinese anchovy.

[0031] The SNP5 site is labeled A / C and is located at position 2,133,544 of chromosome 24 of the *Anchovy* genome.

[0032] Example 1

[0033] A method for developing SNP molecular markers to distinguish between Coilia ectenes and Coilia shortjaw, comprising the following steps:

[0034] 1. Obtaining molecular markers for diagnostic SNPs in species

[0035] This invention utilizes a high-quality chromosome-level genome analysis of the Chinese cod (Anchovy spp.) to perform whole-genome resequencing analysis on 128 samples from 11 geographical populations of both species. The average sequencing depth for each sample reached 26.18×. The clean reads obtained from the resequencing were compared with the genomic data, and SNP detection was performed on each sample using the HaplotypeCalle module in GATK v4.1 software. Subsequently, the generated gvcf files were merged using the CombineGVCFs tool, and joint genotyping was performed using the GenotypeGVCFs tool to finally generate vcf files. The acquired SNP dataset was screened based on the following strict filtering criteria: a) QD < 2: the ratio of variant confidence to depth < 2; b) FS > 60: Fisher's possible false positive test > 60; c) MappingQualityRankSum < -12.5: the alignment quality assessment of REF and ALT reads < -12.5; d) ReadPosRankSum < -8.0: the position assessment of the variant on the read < -8.0; e) StrandOddsRatio (SOR) < 3.0: the overall assessment of strand bias may have an SOR < 3.0. A total of 434,160 high-quality SNP loci were obtained through these screening criteria. Using Simon Martin software with a 20kb sliding window, the Fst value across the entire genome was calculated, and 41 highly differentiated windows with Fst > 0.98 were selected, including 16 windows with Fst = 1.

[0036] Based on the 41 highly differentiated windows identified above, specific SNP sites stably existing in *Anchovy scutellarioides* and *Anchovy brevis* were determined. These sites needed to meet the following criteria: a 100% SNP detection rate in both species; a 100% base mutation frequency; and highly conserved upstream and downstream sequences of the mutation site. Finally, five SNP molecular markers meeting the set criteria were selected and named SNP1–SNP5. The bases at these sites are T, A, T, A, A in *Anchovy scutellarioides*, and C, G, C, T, C in *Anchovy brevis* (Table 1).

[0037] Table 1 SNP site sequence information

[0038]

[0039] The two species, *Coilia ectenes* and *Coilia septemlobus*, can be identified by using any one or more of the five SNP molecular markers mentioned above.

[0040] 2. Primer design

[0041] The selected SNP sites were mapped to the genome of Coilia ectenes, and highly conserved sequences of approximately 800 bp upstream and downstream of the SNP sites were extracted. A pair of primers, named 1F / 1R, was then designed to distinguish Coilia ectenes from Coilia shortjaw. The primer pair sequences are shown in Table 2.

[0042] Table 2 Primer pairs for the sequences containing the 5 SNPs

[0043]

[0044]

[0045] The designed primer pairs consist of two primer sequences, upstream and downstream, and were sent to Sangon Biotech Co., Ltd. for synthesis. Each primer was packaged and stored independently and added to the PCR primer reaction system in the form of primer solution.

[0046] 3. Reliability verification of SNP molecular markers

[0047] (1) Collection of adult fish samples of Anchovy and Coilia ectenes

[0048] Thirty adult Coilia ectenes and 30 adult Coilia shortjaw were randomly selected from the 128 resequencing samples. Species identification was performed on all samples based on morphological characteristics and otolith microchemistry. All Coilia ectenes samples (maxillary bone / head length > 1) were migratory individuals (Sr / Ca×1000 > 3), and all Coilia shortjaw were freshwater resident individuals (maxillary bone / head length < 1) (Sr / Ca×1000 < 3) (Table 3).

[0049] Table 3. Collection information for 60 resequencing samples

[0050]

[0051] (2) Genomic DNA extraction

[0052] Genomic DNA was extracted from all samples using the Ezup column-based animal tissue DNA kit. DNA integrity was assessed by 1% agarose gel electrophoresis (120-180V, 1×TAE buffer). DNA concentration and purity were determined using a spectrophotometer. A DNA sample solution with an OD 260 / 280 ratio between 1.7 and 2.0 was considered to be of good quality and stored at -20℃.

[0053] (3) PCR amplification and sequencing

[0054] PCR amplification was performed using genomic DNA from *Anchovy scutellarioides* and *Anchovy brevis* as templates. Primer pair 1F / 1R was used to amplify the target sequences including SNP1–SNP5. The PCR amplification system consisted of 25 μL of primers: 1 μL R primer, 1 μL F primer, 1 μL DNA sample solution, and 1 μL PCR Mix solution. ddH2O was then added to bring the total volume to 25 μL. PCR amplification conditions were: 95℃ pre-denaturation for 5 min; 10 cycles (94℃ for 30 s, initial annealing at 63℃ for 30 s / cycle, decrease by 0.5℃, extension at 72℃ for 30 s); 30 cycles (95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s); 72℃ extension for 10 min; and storage at 4℃. After the reaction, 5 μL of PCR product from each sample was taken and spotted onto a 1% agarose gel. Electrophoresis was performed at 120V for 20 min. The results were observed and recorded in the gel imaging system. The amplified PCR products were then sent to Sangon Biotech Co., Ltd. for bidirectional sequencing using a 3730XL sequencer.

[0055] (4) Multiple sequence alignment

[0056] The sequences obtained from PCR product sequencing were assembled using CodonCode Aligner software, and the sequencing results were aligned using BioEdit software. Adult *Anchovy* and *Anchovy brevicaulis* were identified based on the base types of the five SNP sites in the PCR amplification product sequences.

[0057] As attached Figure 1 As shown, PCR amplification was performed on all samples using primer pair 1F / 1R. Sequencing of the amplified products revealed that the bases at SNP1–SNP5 sites were T, A, T, A, A for all *Anchovy* samples, and C, G, C, T, C for all *Anchovy* samples. The peak values ​​at SNP sites were analyzed using MEGA7 software to differentiate between *Anchovy* and *Anchovy*. (See attached image) Figure 2As shown, each SNP site validation is performed by randomly selecting one sample from two species out of 30 samples.

[0058] Example 2

[0059] The application of the above-mentioned SNP molecular markers and primer pairs in the identification of adult and juvenile anchovies and bream includes the following steps:

[0060] 1. Collection of adult and juvenile fish samples

[0061] Thirty adult *Coilia ectenes* (CN01-30) and 30 adult *Coilia scutellario* (CB01-30) samples were randomly collected from the spawning grounds of *Coilia ectenes* in Poyang Lake between June and July 2023. Species identification was performed based on morphological characteristics. All *Coilia ectenes* samples (maxillary bone / head length ratio significantly greater than 1) were typical long-jawed individuals, with body length and weight ranging from 25.6 to 33.9 cm and 47.8 to 155.1 g, respectively. All *Coilia scutellario* samples (maxillary bone / head length ratio significantly less than 1) were typical short-jawed individuals, with body length and weight ranging from 15.9 to 28.3 cm and 20.3 to 95.0 g, respectively. In addition, a survey of juvenile Anchovy was conducted at the mouth of Poyang Lake from September to November 2024. From 100 juvenile Anchovy specimens collected, 30 samples (numbered Y01-30) were randomly selected for species identification. The selected samples ranged in body length from 7.1 to 12.5 cm and in weight from 0.7 to 14.7 g. Based on morphological characteristics, they were visually identified as Anchovy (individuals with a body length <13 cm had not yet fully differentiated jawbones). Muscle tissue was collected from these individuals, immediately placed in liquid nitrogen, and preserved in a laboratory ultra-low temperature freezer at -80°C.

[0062] 2. Genomic DNA extraction, PCR amplification, and sequencing

[0063] The experimental procedures, such as genomic DNA extraction, PCR amplification, and sequencing, are consistent with those in Example 1.

[0064] 3. PCR amplification results

[0065] As attached Figure 3 As shown, by observing the gel imaging results, after amplification using primer pair 1F / 1R, a single band appeared at approximately 800 bp, consistent with the sequence length that should be amplified during primer design.

[0066] 4. Multiple sequence alignment and species identification

[0067] The sequences obtained from PCR product sequencing were assembled using CodonCode Aligner software, and the sequencing results were then aligned using BioEdit software. (See attached image) Figure 1As shown, PCR amplification was performed on all adult fish samples using primer pair 1F / 1R. Sequence alignment of the amplified products showed that the bases at SNP1 to SNP5 of all Anchovy samples were T, A, T, A, A, and the bases at SNP1 to SNP5 of all Short-jawed Anchovy samples were C, G, C, T, C, and the bases at SNP1 to SNP5 were C, G, C, T, C.

[0068] The sequences of 30 juvenile anchovy samples were analyzed using BioEdit software, and the results are attached. Figure 4 As shown, the bases at SNP1 to SNP5 sites in 13 samples were T, A, T, A, and A, respectively, which led to the identification of the species to be tested as Coilia ectenes; the bases at SNP1 to SNP5 sites in 17 samples were C, G, C, T, and C, respectively, which led to the identification of the species to be tested as Coilia esculenta.

[0069] The above results show that the five specific SNP molecular markers of the present invention can efficiently and accurately identify Coilia ectenes and Coilia septemlobus, with an identification accuracy of 100%.

Claims

1. An SNP molecular marker for identifying Coilia ectenes and Coilia shortjaw, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:

1. Positions 185, 231, 259, 322, and 412 of the nucleotide sequence are SNP1 to SNP5, respectively. For Coilia ectenes, SNP1 to SNP5 correspond to T, A, T, A, and A, respectively. For Coilia esculenta, SNP1 to SNP5 correspond to C, G, C, T, and C, respectively.

2. The application of the primer pair containing the SNP molecular marker described in claim 1 in the identification of Coilia ectenes and Coilia shortjaw, characterized in that, The SNP1 to SNP5 sites of *Anchovy davidii* correspond to T, A, T, A, A, respectively, while the SNP1 to SNP5 sites of *Anchovy brevicula* correspond to C, G, C, T, C, respectively.

3. The application according to claim 2, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO:2 and SEQ ID NO:

3.

4. A method for distinguishing between *Anchovy simia* and *Anchovy brevicula*, characterized in that, The distinction between *Anchovy davidii* and *Anchovy brevicula* is made by detecting the base types of SNP1 to SNP5 in the nucleotide sequence of the SNP molecular marker described in claim 1. The criteria for this distinction are as follows: *Anchovy davidii* corresponds to T, A, T, A, A at SNP1 to SNP5, respectively, while *Anchovy brevicula* corresponds to C, G, C, T, C at SNP1 to SNP5, respectively.

5. The method for distinguishing between *Anchovy simia* and *Anchovy brevicula* according to claim 4, characterized in that, The nucleotide sequences of the primer pairs used for detection are shown in SEQ ID NO:2 and SEQ ID NO:

3.

6. The method for distinguishing between *Anchovy simia* and *Anchovy brevicula* according to claim 4, characterized in that, The samples were adult or juvenile anchovies or short-jawed anchovies.

Images