Use of enrofloxacin for the preparation of a medicament for the prevention and / or treatment of bovine nodular dermatitis

Abstract

The application belongs to the technical field of veterinary drugs, and particularly relates to application of enrofloxacin in preparation of a medicine for preventing and / or treating bovine dermatophilosis, and the application finds that enrofloxacin can inhibit bovine dermatophilosis virus proliferation and can be used for treating diseases caused by bovine dermatophilosis virus infection. In a safe concentration range, enrofloxacin can dose-dependently inhibit bovine dermatophilosis virus replication and has significant antiviral activity. Therefore, enrofloxacin has a good prospect in preparation of an anti-bovine dermatophilosis virus medicine.

Description

Technical Field

[0001] This invention belongs to the field of veterinary drug technology, specifically, it relates to a new use of a class of monomeric compounds, particularly the use of enrofloxacin in the preparation of drugs for the prevention and / or treatment of bovine nodular skin disease. Background Technology

[0002] Bovine lumpy skin disease (LSD) is a subacute to acute infectious disease caused by bovine lumpyskin disease virus (LSDV), characterized by nodular lesions on the skin of cattle. LSDV belongs to the Poxviridae family (…). Poxviridae ), Goatpoxvirus genus ( Capripoxvirus The mortality rate of cattle infected with LSDV is approximately 10%, and the morbidity rate is approximately 90%. Affected cattle exhibit symptoms such as fever, emaciation, decreased milk production, and nodules all over the body, severely limiting the economic benefits of cattle farming. Current technologies mainly employ a strategy and measures combining emergency immunization with attenuated live vaccines and isolation and culling for LSD control. Although vaccination currently has good protective effects, clinical results show that attenuated live vaccines have certain side effects, and increasing research demonstrates the risk of strain recombination when using live attenuated vaccines. Currently, there are no effective drugs for the treatment of LSDV. Given the limitations of vaccine immunization, there is an urgent need to develop effective drugs for the prevention or treatment of LSD as a technological reserve. Summary of the Invention

[0003] In view of the shortcomings of the prior art, the present invention provides the application of enrofloxacin in the preparation of drugs for the prevention and / or treatment of bovine nodular dermatitis, which is expected to bring a new antiviral drug for the prevention and treatment of LSD.

[0004] The technical solution provided by this invention is as follows:

[0005] This invention provides the use of enrofloxacin in the preparation of medicaments for the prevention and / or treatment of bovine nodular dermatitis, a disease caused by the bovine nodular dermatitis virus.

[0006] Furthermore, the drug is a drug that inhibits the replication phase of bovine nodular dermatitis virus.

[0007] Furthermore, the enrofloxacin is the sole or one of the active ingredients in a drug for the prevention and / or treatment of bovine nodular dermatitis.

[0008] Furthermore, the concentration of enrofloxacin used in the drug is 100 μM.

[0009] This invention also provides the use of enrofloxacin in the preparation of a medicament against bovine nodular dermatosis virus.

[0010] This invention also provides the use of enrofloxacin in the preparation of drugs that inhibit the replication phase of bovine nodular dermatosis virus.

[0011] The present invention also provides a medicament for treating bovine nodular dermatitis, wherein the medicament has an effective amount of the above-described enrofloxacin as its active ingredient.

[0012] Furthermore, the drug also includes one or more pharmaceutically acceptable carriers.

[0013] Furthermore, the pharmaceutically acceptable carrier includes: excipients, fillers, binders, wetting agents, disintegrants, diluents, and / or surfactants.

[0014] Furthermore, the dosage form of the drug is any one or more of tablets, capsules, oral liquids, granules, pills, or injections.

[0015] Beneficial effects

[0016] This invention is the first to discover that enrofloxacin can inhibit the proliferation of bovine nodular dermatitis virus (LSDV) and can be used to treat diseases caused by LSDV infection. In the MDBK and Vero cell lines, the selectivity index (SI) of enrofloxacin as an LSDV drug was greater than 23.09 and greater than 12.64, respectively, indicating that enrofloxacin has a wide safety margin in inhibiting LSDV proliferation. Furthermore, within the safe concentration range, enrofloxacin can dose-dependently inhibit LSDV replication, thus demonstrating its promising potential in the development of anti-Bovine nodular dermatitis virus drugs. Attached Figure Description

[0017] Figure 1 This is a schematic diagram of the chemical structure of enrofloxacin;

[0018] Figure 2 These are the activity curves and cytotoxicity curves of enrofloxacin inhibiting LSDV proliferation;

[0019] Figure 3 The fluorescence images show the inhibition of rLSDV proliferation by different concentrations of enrofloxacin in MDBK.

[0020] Figure 4 The fluorescence images show the inhibition of rLSDV proliferation by different concentrations of enrofloxacin in Vero.

[0021] Figure 5 Through TCID 50 The inhibitory effect of enrofloxacin on LSDV was tested (Note: the concentration of enrofloxacin used was 100 μM).

[0022] Figure 6 The inhibitory effect of enrofloxacin on LSDV was detected by qPCR (Note: the concentration of enrofloxacin used was 100 μM).

[0023] Figure 7 The inhibitory effect of enrofloxacin on LSDV at different MOIs was detected by Western blot (Note: the concentration of enrofloxacin used was 100 μM).

[0024] Figure 8 This is a diagram of the Time of Addition experimental design.

[0025] Figure 9 The effect of enrofloxacin on the inhibition of rLSDV at different stages was reflected by mCherry (Note: the concentration of enrofloxacin used was 100 μM).

[0026] Figure 10 The inhibitory effect of enrofloxacin on rLSDV at different stages was analyzed using Luciferase (Note: the concentration of enrofloxacin used was 100 μM). Detailed Implementation

[0027] This invention provides the use of enrofloxacin in the preparation of a medicament for the prevention and / or treatment of bovine nodular dermatitis. It should be noted that enrofloxacin is a monomeric compound. CAS No.: 93106-60-6; ​​Chemical Formula: C 19 H 22 FN3O3; its chemical structural formula is as follows: Figure 1 As shown.

[0028] Example 1

[0029] 1. Experimental Materials and Methods

[0030] 1.1 Experimental Materials

[0031] Enrofloxacin was purchased from MCE. RIPA protein lysis buffer was purchased from Yuanye Company. DNA extraction kit, CCK-8 kit, reverse transcription reagent, and SYBR Green Master Mix were purchased from YEASEN. β-Tublin mouse monoclonal antibody, HRP-labeled goat anti-rabbit secondary antibody, and HRP-labeled goat anti-mouse secondary antibody were purchased from Yaxin Company. Trypsin was purchased from Solarbio. MDBK, Vero cell line, fetal bovine serum, and DMEM were purchased from Nanjing Senbeijia Company. LSDV rabbit polyclonal antibody was prepared and preserved in our laboratory. The preparation method is as follows:

[0032] LSDV virus was mixed with Freund's complete adjuvant at a 1:1 ratio, emulsified, and used as an immunogen. The concentration was 0.5 × 10⁻⁶.6.2 TCID 50 New Zealand white rabbits were immunized by subcutaneous injection at multiple sites with the prescribed dose; subsequently, booster immunizations were administered every 14 days with the same dose of Freund's incomplete adjuvant, for a total of 3 immunizations; serum was collected 14 days after the 3rd immunization and stored at -20 ℃.

[0033] The LSDV XJ201901 strain was isolated, identified, and deposited by the China Animal Health and Epidemiology Center, with NCBI GeneBank accession number OM984485. The specific preparation method for the recombinant rLSDV strain carrying the mCherry and Luciferase expression cassette is as follows:

[0034] LSDV's ORF50 and ORF51 are two adjacent proteins. According to literature reports, inserting a foreign gene between the genes encoding these two proteins does not affect viral replication. Therefore, we used this region as the insertion site for the mCherry and firefly luciferase reporter genes (Luciferase). First, donor plasmids carrying mCherry and Luciferase were constructed. During recombinant virus construction, the MDBK cell line was infected with the LSDV XJ201901 strain. Six hours later, the donor plasmid was transfected into the MDBK cell line. At this time, the viral DNA was recombined by intracellular homologous recombination enzymes according to the homologous sequence of the donor plasmid, thus recombining the DNA fragment corresponding to the donor plasmid into the viral genome's ORF50 and ORF51 gene positions. Then, the recombinant strain emitting red fluorescence was purified through three consecutive rounds of plaque assays, finally obtaining the rLSDV strain simultaneously expressing mCherry and Luciferase for subsequent experiments. The donor plasmid sequence is as follows:

[0035]

[0036] 1.2 Drug CC 50 Detection

[0037] Inoculate 2×10⁶ cells into 96-well plates 4 MDBK or Vero cell suspension (100 μL / well). Pre-culture the plates in an incubator for 24 h (37 ℃, 5% CO2). Perform 3-fold serial dilutions of the drug with cell maintenance medium, creating 8 dilutions (maximum drug concentration 100 μM). Treat cells with each diluted drug solution for 72 h, with an equal volume of DMSO as a control for each concentration. Add 10 μL of CCK-8 solution to each well, avoiding bubble formation. Incubate the plates in an incubator for 2 h. Measure the absorbance at 450 nm using a microplate reader. Calculate cell viability using the following formula: Cell viability = [OD (drug-treated group) - OD (blank group)] / [OD (control group) - OD (blank group)] × 100%. Experimental group: OD values ​​of wells containing cells, CCK-8 solution, and drug solution. Blank group: OD values ​​of wells containing maintenance medium and CCK-8 solution but without cells. Control group: OD values ​​of wells containing cells, CCK-8 solution, and DMSO solution. Finally, GraphPad was used to plot the CCK values ​​of the drug. 50 curve.

[0038] 1.3 Drug IC 50 Detection

[0039] Inoculate 2×10⁶ cells into 96-well plates 4 MDBK or Vero cell suspension (100 μL / well). Incubate the culture plates in an incubator for 20 h. Perform 3-fold serial dilutions of the drug with cell maintenance medium to obtain drug dilutions, for a total of 8 dilutions (maximum drug concentration 100 μM). Take 30 μL of drug dilution and add 0.01 Multiplicity of Infection (MOI) (200 TCID50). 50 MOI = TCID at the time of infection 50 The rLSDV virus solution (volume / cell count) was diluted to obtain a drug-virus mixture. The drug-virus mixture was incubated at 37 °C for 30 min. The cell culture medium was then discarded, and 30 μL of the incubated drug-virus mixture was added, incubating at 37 °C for 2 h. The drug-virus mixture was then discarded, and the cells were carefully washed once with PBS. 200 μL of drug dilution was added to the wells, and the cells were cultured for another 72 h. An equal volume DMSO control group and an untreated blank group were also established. Cell luminescence was recorded under a fluorescence microscope.

[0040] Then, aspirate the cell culture medium, add 100 μL of cell lysis buffer to each well, and incubate on ice for 5 min to fully lyse the cells. Take 20 μL of lysis buffer and add it to a black ELISA plate. Dilute the firefly luciferase substrate (50×) and kidney luciferase substrate (50×) to 1× working solution with their respective buffers. Incubate at room temperature. Add 100 μL of firefly luciferase reaction solution to each well, shake to mix, and immediately detect the activity of firefly luciferase (within 30 min). Calculate the data using the following formula: Inhibition rate (%) = 1 - (Experimental group value / Control group value) × 100. Wherein, blank group: untreated cells from the same batch as the experimental group. Experimental group: cells treated with a mixture of drug and virus. Control group: cells treated with a mixture of DMSO and virus. Experimental group value = Experimental group reading - Blank group reading. Control group value = Control group reading - Blank group reading. Finally, GraphPad was used to plot the drug's IC. 50 curve.

[0041] 1.4 Western blot experiment

[0042] Inoculate 1×10⁶ cells into 24-well plates 5 MDBK or Vero cell suspension (500 μL / well). Incubate the culture plates in an incubator for 20 h. Then discard the cell culture medium and add 200 μL of 0.01 MOI (1000 TCID50) to each well. 50 ) and 0.1 MOI (10000 TCID) 50LSDV and the drug maintenance medium were incubated at 37 °C for 2 h. The liquid was then discarded, and the cells were carefully washed once with PBS. 1000 μL of the drug-containing maintenance medium was added to the wells, and the cells were cultured for another 72 h. The cell culture medium in the culture dish was discarded, and the cells were washed twice with pre-chilled 1×PBS. RIPA lysis buffer was added, and the cells were lysed on ice for 10 min. The lysed mixture was transferred to a 1.5 mL EP tube and centrifuged at 12000 g for 10 min at 4 °C. 80 μL of the supernatant was collected, and 20 μL of 5× Loading Buffer was added. After mixing, the mixture was heated at 95 °C for 5 min, followed by brief centrifugation before sample loading and analysis. An equal volume of the sample was added to a PAGE gel for SDS-PAGE electrophoresis at a constant voltage of 80 V. When the bromophenol blue migrated to the bottom of the gel, a semi-dry transfer apparatus was used for transfer, and the transfer filter paper was soaked in pre-chilled transfer buffer. Place the following layers in the order from bottom to top: filter paper, NC membrane, gel, and filter paper, taking care to remove air bubbles. The program is: constant current 0.3 A, voltage limit 25 V, time 33 min. After completion, block with TBST containing 5% skim milk at room temperature for 2 h. After blocking, wash three times with TBST at room temperature for 5 min each time, add rabbit anti-LSDV polyclonal antibody and mouse anti-β-Tubulin monoclonal antibody, and incubate at 4 ℃ for 12 h. Wash three times with TBST for 5 min each time, add the corresponding HRP-labeled goat anti-rabbit and goat anti-mouse secondary antibodies, and incubate at room temperature for 1 h. Wash three times with TBST for 5 min each time, and finally treat with ECL chemiluminescence solution before exposure in an exposure apparatus.

[0043] 1.5 qPCR experiment

[0044] Sample preparation: Inoculate 1×10⁶ samples into a 24-well plate. 5 MDBK cell suspension (500 μL / well). Culture plates were incubated for 20 h. Then, the cell culture medium was discarded, and 200 μL of MDBK cell suspension containing 0.01 MOI (1000 TCID50) was added to each well. 50 LSDV and the drug maintenance medium were incubated at 37 °C for 2 h. The liquid was then discarded, and the cells were carefully washed once with PBS. 1000 μL of the drug-containing maintenance medium was added to the wells, and the cells were cultured for another 72 h.

[0045] DNA Extraction: Add 10 µL of Proteinase K to 400 µL of lysis buffer LB, mix well, and obtain DNA lysis buffer. Discard the cell culture supernatant and wash twice with PBS. Discard the PBS and add 410 µL of DNA lysis buffer. Let stand for 30 s, then pipette repeatedly 20 times to transfer the cell lysis buffer to a 1.5 EP tube. Incubate at 55 ℃ for 10 min, vortex to mix, and let stand at room temperature for 5 min. Remove the EP tube and allow it to cool to room temperature, then gently vortex to mix. Add 300 µL of protein removal buffer PL and 300 µL of binding buffer BD sequentially, and shake vigorously to mix. Centrifuge at 12000 rpm for 5 min. The solution will separate into two layers: the upper layer is a blue extraction layer, and the lower layer is a clear aqueous phase. There may be a partial precipitate layer between the two layers; the DNA is in the lower aqueous phase. Carefully aspirate the lower layer solution for column purification. Insert the DNA adsorption column T1 into a 2 mL collection tube for later use. Add 200 μL of buffer AC to DNA adsorption column T1, centrifuge at 12000 rpm for 1 min, and discard the waste liquid. Add the lower layer solution of the above sample pretreatment to DNA adsorption column T1, centrifuge at 12000 rpm for 1 min, and discard the waste liquid. Place DNA adsorption column T1 back into the collection tube, add 500 µL of wash buffer W (add anhydrous ethanol as per the instructions before use), centrifuge at 12000 rpm for 30 sec, and discard the waste liquid. Repeat the washing with wash buffer W once. Place DNA adsorption column T1 back into the collection tube, centrifuge the empty column at 12000 rpm at room temperature for 2 min to remove residual wash buffer W. Place DNA adsorption column T1 into a new 1.5 mL centrifuge tube, add 25 µL of elution buffer preheated to 65 ℃ to the center of the adsorption column, and incubate at room temperature for 2 min. Then centrifuge at 12000 rpm for 1 min. Collect the filtrate. Add 25 µL of fresh, preheated elution buffer (65 °C) and repeat the elution once more to obtain approximately 50 µL of DNA solution. Determine the DNA concentration using a nanodropper and store at -20 °C for later use. Design primer sequences F: AGGGTGATGGGAAGGGTGTT, R: ACTTGCCCGTATCCATCCAC for LSDV ORF72. Prepare the qPCR reaction system according to the amounts shown in Table 1, and detect gene abundance in the samples according to the reaction procedure shown in Table 2.

[0046] Table 1: qPCR system

[0047]

[0048] Table 2: qPCR Procedure

[0049]

[0050] 1.6 TCID 50 experiment

[0051] Sample preparation is the same as for qPCR. TCID 50 Assay: Using growth medium, 2 × 10⁶ cells were inoculated into 96-well plates. 4 MDBK cell suspension (100 μL / well). Culture plates were incubated for 24 h (37 ℃, 5% CO2). Virus solution was serially diluted 10-fold with maintenance medium (DMEM containing 2% FBS), with 8 replicates per well. 100 μL of the diluted virus solution was added to each well to maintain cell culture for 5 days. Finally, the number of diseased wells was observed and counted under a microscope, and the TCID of the virus solution was calculated using the Reed-Muench method. 50 .

[0052] 1.7 Time of addition experiment ( Figure 8 )

[0053] The process of viral infection of host cells can be divided into four stages in chronological order: the stage before viral contact with the cell; the stage where the virus binds to host receptors and attaches to the surface of the host cell; the stage where the virus enters the cell through endocytosis; and the replication stage after the virus enters the cell. To determine at which stage of LSDV infection of MDBK cells the drug exerts its antiviral effect, this embodiment treated cells or the virus with the drug during rLSDV infection of MDBK cells, and evaluated the viral replication level using the mCherry and Luciferase proteins expressed by the virus. Figure 8 The experimental design pattern diagram for Time of addition provided in the embodiments of the present invention is as follows:

[0054] Inoculate 2×10⁶ cells into 96-well plates 4 MDBK cell suspension (100 μL / well). Culture plates were incubated in an incubator for 24 h. Four experimental groups were established based on different drug treatment durations.

[0055] Group 1 (Neutralization Phase): To determine whether the drug has a neutralizing effect on the virus before contact with cells, the drug was diluted to a 2× drug concentration working solution using maintenance solution. 50 μL of the 2× drug concentration working solution was then mixed with an equal volume of 200 TCID50. 50 rLSDV hybrid obtains 200 TCID 50 The rLSDV working solution at 1× drug concentration was prepared and neutralized at 37 °C for 1 h. The incubated solution was then seeded into cells and incubated with MDBK cells for 2 h. The solution was discarded, and the cells were washed twice with 1×PBS. After discarding all the solution, 200 μL of maintenance solution was added, and the cells were cultured for another 72 h.

[0056] Group 2 (Blocking Phase): To determine whether the drug competitively binds to host cell receptors during viral adsorption into cells, the drug was diluted to a 1× working solution using maintenance buffer. 100 μL of the 1× working solution was added to the cells and incubated at 37 °C for 1 h. The solution was discarded, and the cells were washed twice with 1×PBS. After discarding all remaining solution, cells containing 200 TCID50 were added. 50 100 μL of rLSDV was incubated with MDBK cells for 2 h. The liquid was discarded, and the cells were washed twice with 1×PBS. After discarding the liquid, 200 μL of maintenance medium was added, and the cells were cultured for another 72 h.

[0057] Group 3 (Cell Entry Phase): To determine whether the drug could prevent viral entry into cells, the drug was diluted to a 2× drug concentration working solution using maintenance solution. 50 μL of the 2× drug concentration working solution was then mixed with an equal volume of 200 TCID50 solution. 50 rLSDV hybrid obtains 200 TCID 50 100 μL of the 1× working solution of rLSDV was seeded into MDBK cells and incubated for 2 h. The solution was then discarded, and the cells were washed twice with 1×PBS. After discarding all the solution, 200 μL of maintenance solution was added, and the cells were cultured for another 72 h.

[0058] Group 4 (Replication Phase): To determine whether the drug inhibits viral replication after the virus enters the host cell, the drug was diluted to a 1× drug concentration working solution using maintenance solution. After discarding the liquid, a solution containing 200 TCID32 was added. 50 100 μL of rLSDV was incubated with MDBK cells for 2 h, the liquid was discarded, and the cells were washed twice with 1×PBS. After discarding the liquid, 200 μL of the 1× drug concentration working solution was added, and the cells were incubated at 37 ℃ for another 72 h.

[0059] DMSO was used as a control group in all four groups. Samples were collected at 72 hpi to detect the activity of Luciferase produced by the virus. Figure 9 and Figure 10 As shown, both the Luciferase activity assay and the mCherry fluorescence spectrum indicate that enrofloxacin mainly exerts an inhibitory effect during the LSDV replication phase.

[0060] 2. Experimental Results

[0061] 2.1 Drug CC 50 Measurement

[0062] To evaluate the in vitro cytotoxicity of the drug, we treated MDBK and Vero cells with different concentrations of the drug, measured cell viability using CCK-8 assays, and plotted cytotoxicity curves. Figure 2 As shown, enrofloxacin C-cell activity in MDBK and Vero cell lines... 50 All are greater than 100 μM.

[0063] 2.2 Drug IC 50 Measurement

[0064] To evaluate the antiviral activity of the drug in vitro, we treated MDBK and Vero cells with different concentrations of the drug during rLSDV infection and used the mCherry protein expressed by the virus to label the distribution of the virus within the cells. We then plotted the inhibitory effects of the drug on LSDV replication in both cell types by detecting the activity of Luciferase expressed by the virus. Figure 2 As shown, the IC50 of enrofloxacin in the MDBK cell line 50 The IC50 of enrofloxacin on the Vero cell line was 4.33 μM. 50 It is 7.91 μM.

[0065] The Selectivity Index (SI) is an important indicator for evaluating the efficacy and safety of drugs. SI is defined as the compound selectivity (CC) of a drug. 50 With IC 50 The ratio, i.e., SI=CC 50 / IC 50 Selection index (SI) helps us understand at what concentration a drug can effectively inhibit pathogens while minimizing toxicity to host cells. Generally, a selection index greater than 1.00 is considered effective, and a higher selection index indicates a wider safety margin for the drug. 50 With IC 50 The ratio calculation results showed that the selection index of enrofloxacin in the MDBK cell line was greater than 23.09, and the selection index of enrofloxacin in the Vero cell line was greater than 12.64; this indicates that enrofloxacin has a large safety margin in inhibiting LSDV proliferation.

[0066] like Figure 3 , Figure 4 As shown, the higher the concentration of enrofloxacin used in MDBK and Vero, the lower the protein expression level of mCherry of rLSDV. This indicates that the effect of enrofloxacin in inhibiting the proliferation of rLSDV in MDBK and Vero is dose-dependent.

[0067] 2.3 TCID 50 Verify drug efficacy

[0068] To evaluate the antiviral activity of the drug in vitro, we treated MDBK cells with 100 μM enrofloxacin during LSDV XJ wild-type virus infection. The TCID of LSDV in the cell samples was then measured. 50 The values ​​were used to evaluate the inhibitory effect of the drug on LSDV. For example... Figure 5 As shown, after treating two cell lines with enrofloxacin, the viral TCID in the cells... 50 The content decreased significantly (analyzed by independent samples t-test). P <0.01).

[0069] 2.4 qPCR validation of drug efficacy

[0070] To evaluate the antiviral activity of the drug in vitro, we treated MDBK and Vero cells with 100 μM of the drug after infecting them with wild-type LSDVXJ virus. The inhibitory effect of the drug on LSDV was assessed by detecting the relative abundance of the LSDV gene in the cell samples. Figure 6 As shown, enrofloxacin treatment of both cell lines significantly reduced the relative expression level of the viral ORF72 gene (analyzed by independent samples t-test). P <0.01).

[0071] 2.5 Western Blot Analysis of Drug Efficacy

[0072] To evaluate the antiviral activity of the drug in vitro, we infected MDBK and Vero cells with LSDV at 0.01 MOI and 0.1 MOI, and treated the cells with 100 μM enrofloxacin. Whole cell lysates were collected at 72 hpi for Western blotting. The results are as follows: Figure 7 As shown, enrofloxacin has a good inhibitory effect on LSDV infection of MDBK and Vero cell lines with different MOIs.

[0073] 2.6 Time of addition experiment

[0074] To determine at which stage of LSDV infection of MDBK cells the drug exerts its antiviral effect, we treated MDBK cells with 100 μM of the drug during rLSDV infection and evaluated viral replication levels using the expression of mCherry and Luciferase proteins. Figure 9 and Figure 10 As shown, enrofloxacin significantly inhibits LSDV replication primarily during the replication phase (analysis using independent samples t-tests). P <0.01).

Claims

1. The use of enrofloxacin in the preparation of drugs for the prevention and / or treatment of bovine nodular dermatitis, characterized in that, The bovine nodular dermatitis is a disease caused by the bovine nodular dermatitis virus; the drug is a drug that inhibits the replication stage of the bovine nodular dermatitis virus; the enrofloxacin is the only effective ingredient in the drug for the prevention and / or treatment of bovine nodular dermatitis; the concentration of enrofloxacin used in the drug is 100 μM.

2. The application of enrofloxacin in the preparation of drugs that inhibit the gene replication stage of bovine nodular dermatosis virus, characterized in that, The enrofloxacin is the only active ingredient in the drug that inhibits the replication phase of bovine nodular dermatitis virus; the concentration of enrofloxacin used is 100 μM.

3. The application of enrofloxacin in the preparation of drugs against bovine nodular dermatosis virus, characterized in that, The drug is an inhibitor of the replication phase of bovine nodular dermatitis virus; the enrofloxacin is the only active ingredient in the drug against bovine nodular dermatitis virus; the concentration of enrofloxacin used in the drug is 100 μM.

Images