BdNIS1, an effector protein of apple ring rot fungus, its encoding gene, and its applications

Abstract

This invention provides an effector protein BdNIS1 from *Rhizoctonia solani*, its encoding gene, and its applications. The amino acid sequence of the effector protein BdNIS1 is shown in SEQ ID NO.1, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.2. Studies have found that knocking out... BdNIS1 After gene modification, it does not affect the apple ring rot pathogen ( B.dothidea The growth of the fruit does not affect its resistance to adverse conditions or cell wall integrity, but its pathogenicity to apple fruits and branches is significantly reduced, indicating that... BdNIS1 This is a key pathogenic gene in the infection process of *B. benthamiana*, the causal agent of apple ring rot. Transient expression of BdNIS1 in *N. benthamiana* inhibits the Bax-induced PCD response in leaf cells, promoting pathogen infection of the plant. This invention is of great significance for elucidating the relevant molecular mechanisms of *B. benthamiana* and establishing integrated control strategies for apple ring rot.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a fungus that causes apple ring rot (…). Botryosphaeria dothidea The effector protein BdNIS1, its encoding gene, and its applications. Background Technology

[0002] Apples and related industries occupy an important position in my country's agricultural economy. Currently, apples from Luochuan in Shaanxi, Wafang in Liaoning, Lingbao in Henan, Yantai in Shandong, and Aksu in Xinjiang are exported both domestically and internationally. Apple ring rot is one of the main factors affecting the apple industry. This disease is caused by various pathogens of the genus *Botrytis*, among which *Botrytis cinerea* (*Botrytis cinerea*) is a major contributor. Botryosphaeria dothidea ) is its main pathogenic bacterium. B. dothidea This disease not only infects branches and trunks, causing rough bark or ulcers and severely weakening the tree, leading to a decrease in both the quality and quantity of fruit, but it also damages fruit during storage, causing rot and spoilage, resulting in significant economic losses. Currently, chemical control is the primary method for managing this disease. However, the extensive use of chemical agents not only pollutes the environment but also enhances the pathogen's resistance, and pesticide residues on the fruit threaten consumer health. Therefore, to fundamentally control this disease, it is essential to thoroughly investigate the pathogen causing ring rot (…). B. dothidea The process and mechanism of infection of the host, based on the enhanced understanding of this type of pathogen, continuously inspires new ideas for the comprehensive prevention and control of this type of disease.

[0003] Effectors, also known as effector molecules, effector factors, or effectors, play a crucial role in the interaction between pathogens and host plants. When the host plant contains a resistance protein (R) corresponding to the pathogen's effector protein, the effector protein triggers an effector-triggered immunity (ETI) response in the plant; in this case, the effector protein is also called an avirulence protein (AVR). Conversely, when the host plant lacks the corresponding resistance protein, the effector protein exhibits toxicity, suppressing the plant's immune response and thus promoting pathogen infection, leading to disease in the host plant. Therefore, effectors are both a key weapon for plant pathogens to successfully infect their host plants and an important target for the plant's immune system to recognize pathogen invasion. Research on the functions of plant pathogen effector genes and effector proteins will significantly advance our understanding of pathogenic mechanisms and the molecular mechanisms of host plant resistance.

[0004] In recent years, numerous studies have found that necrosis-inducing secreted protein 1 (NIS1) plays an important role in the pathogenicity of plant pathogenic fungi. Yoshino et al. (Cell Death of Nicotiana benthamiana Is Induced by Secreted Protein NIS1 of Colletotrichum orbiculare and Is Suppressed by a Homologue of CgDN3. Molecular plant-microbe interactions: MPMI, 2012, 25(5):625. DOI:10.1094 / MPMI-12-11-0316.) found that in… Colletotrichum orbicu-lare and C. higginsianum NIS1 type genes are present. CoNIS1 and ChNIS1 The proteins they encode can trigger the production of Benn's tobacco (Nymphaea rubrum). Nicotiana benthamiana The cells undergo programmed cell death in tobacco leaves, and they also inhibit inducible cell death triggered by INF1 and various immune responses induced by PAMPs (pathogen-associated molecular patterns), thereby promoting pathogen infection of the host. Rice blast fungus (… M. oryzae While the MoNIS1 protein of *Anthracnose* does not induce cell death, it does inhibit the innate immune response in plants. *Anthracnose* endophytic fungi (root anthracnose) C. tofieldiae CtNIS1 in soybeans can inhibit the PTI (pattern-triggered immunity) response in Arabidopsis thaliana, which may be one of the main reasons for the reciprocal relationship between them. The pathogen of soybean sudden death disease is Fusarium oxysporum. Fusarium virguliforme The FvNIS1 protein of *Valsa mali* can cause cell death in soybean leaves and is considered an effector protein with phytotoxic properties. Nie et al. (Two NIS1-like proteins from apple canker pathogen (Valsa mali) play distinct roles in plant recognition and pathogen virulence. *Stress Biology*, 2022, 2:1-15. DOI:10.1007 / s44154-021-00031-0.) found that *Valsa mali*, the pathogen causing apple canker, plays distinct roles in plant recognition and pathogen virulence. Valsa maliTwo NIS1-like proteins, VmNIS1 and VmNIS2, were discovered in the study. VmNIS1 can induce strong cell death in *N. benthamiana*, while VmNIS2 can inhibit cell death triggered by inducin (INF1). Whether NIS1-like effector proteins also exist in the secretory proteome of *N. benthamiana*, and what roles they play in the pathogenicity of the fungus, remains poorly understood. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to address the shortcomings of the prior art by providing a fungus for apple ring rot (…). B. dothidea The study of the effector protein BdNIS1, its encoding gene, and its applications is of great significance for researching the pathogenic mechanism of apple ring rot fungus and the comprehensive prevention and control of apple ring rot.

[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is: an effector protein BdNIS1 of apple ring rot fungus, the amino acid sequence of which is shown in SEQ ID NO.1, and its encoding gene. BdNIS1 The nucleotide sequence is shown in SEQ ID NO.2.

[0007] The present invention also provides a method comprising the above. BdNIS1 Gene expression cassettes, recombinant vectors, or recombinant bacteria.

[0008] The present invention also provides the effector protein BdNIS1 of the apple ring rot pathogen or the... BdNIS1 Genes, or those containing BdNIS1 Application of gene expression cassettes, recombinant vectors, or recombinant bacteria in the prevention and control of apple ring rot.

[0009] This invention has significant technical advantages compared to existing technologies: 1. This invention provides a novel fungus for apple ring rot ( B. dothidea The study of the effector protein BdNIS1, its encoding gene, and its applications is of great significance for elucidating the relevant molecular mechanisms of apple ring rot fungus and establishing a comprehensive prevention and control strategy for apple ring rot.

[0010] 2. This invention utilizes the principle of homologous recombination to knock out apple ring rot pathogen ( B. dothidea )of BdNIS1 Genes were acquired BdNIS1 Gene deletion mutant Δ BdNIS1 Through transformant growth assays, it was found that BdNIS1 Gene deletion hinders nutrient growth; further stress testing revealed... BdNIS1 The deletion of the gene did not affect the resistance and cell wall integrity of *Rhizoctonia solani*. However, pathogenicity testing of transformants revealed that Δ BdNIS1The pathogenicity to apple fruit and branches has decreased significantly, indicating that... BdNIS1 It is a key pathogenic gene in the infection process of apple ring rot fungus, participates in the expansion of lesions after infection, and plays a crucial role in the infection process of apple ring rot fungus.

[0011] 3. Transient expression of BdNIS1 in Nicotiana benthamiana inhibited the Bax-induced PCD response in Nicotiana benthamiana leaf cells. Further inoculation with Phytophthora indicum and tissue staining revealed that BdNIS1 could inhibit intracellular O2. - The release of H2O2 promotes the infection of plants by pathogens.

[0012] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. Attached Figure Description

[0013] Figure 1 This is Embodiment 2 of the present invention. BdNIS1 Schematic diagram of gene targeted knockout; Figure 2 This is in Embodiment 2 of the present invention BdNIS1 The construction of the gene knockout box and the results of mutant detection, including (a) electrophoresis of PCR amplification of the fusion fragment in one round, (b) electrophoresis of PCR amplification of the transformation fragment in three rounds, and (c) electrophoresis of the knockout mutant detection. Figure 3 This is in Embodiment 2 of the present invention BdNIS1 Results of gene complementation transformant detection, including (a) electrophoresis image of complementation transformant detection, (b) fluorescence observation of hyphae of complementation strain, and (c) RT-PCR detection of target gene in complementation transformant; Figure 4 This is the wild-type (WT) apple ring rot fungus in Example 2 of the present invention. BdNIS1 Gene knockout (Δ) BdNIS1 ), complement mutant ( BdNIS1- C) Analysis of pathogenicity of apple branches and fruits, including (a) pathogenicity detection of branches (10 dpi), and bar charts showing the statistical analysis of lesion area (**, P<0.01); (b) pathogenicity detection of fruits (3 dpi), and bar charts showing the statistical analysis of lesion area (**, P<0.01). Figure 5 This is the wild-type (WT) apple ring rot fungus in Example 2 of the present invention. BdNIS1 Gene knockout (Δ) BdNIS1 ), complement mutant ( BdNIS1- C) Analysis of growth in four culture media: PDA, CM, MM, and OM. (a) Growth status, (b) Colony diameter statistics (P<0.05). Figure 6This is the wild-type (WT) apple ring rot fungus in Example 2 of the present invention. BdNIS1 Gene knockout (Δ) BdNIS1 ), complement mutant ( BdNIS1- C) Analysis of abiotic stress, including (a) growth after culture under five stresses; (b) inhibition rate of colony diameter after culture under five stresses (P<0.05). Figure 7 This is the transient expression analysis of the effector protein BdNIS1 in Nicotiana benthamiana in Example 3 of the present invention. (a) Agrobacterium infiltration strategy and infiltration phenotype. PVX-GFP and Buffer are negative controls, and PVX-GFP+Bax and Buffer+Bax are positive controls. In the figure, the denominator represents the number of repetitions, and the numerator represents the number of times the corresponding phenotype appears. (b) Western blot test results of total protein in leaves from different regions. Figure 8 This is a functional analysis of the effector protein BdNIS1 in the infection of Nicotiana benthamiana by Phytophthora in Example 3 of the present invention. (a) Transient expression of GFP (left) and BdNIS1 (right) on the underside (left) and upper surface (right) of leaves. The denominator of the numerical part represents the number of repetitions, and the numerator represents the number of times the corresponding phenotype appears; (b) Lesion length (**, P<0.01) (left) and relative biomass of Phytophthora in the diseased area (**, P<0.01) (right); (c) Western blot detection of protein expression in the diseased area; Figure 9 This is an analysis of the effect of the effector protein BdNIS1 on the bursting ability of O2- and H2O2 in tobacco cells in Example 3 of the present invention. (a) H2O2 stained with DAB, the statistical graph is the quantitative conversion result of the stained area by ImageJ (**, P<0.01); (b) O2- stained with NBT, the statistical graph is the quantitative conversion result of the stained area by ImageJ (**, P<0.01); Figure 10 This is an analysis of the relative expression level of BdNIS1 in apple fruits infected with B. dothidea, the apple ring rot pathogen, within 72 h in Example 3 of the present invention. Detailed Implementation Example 1

[0014] This embodiment describes the acquisition of the gene encoding the effector protein BdNIS1 from B. dothidea, the causal agent of apple ring rot.

[0015] The target strain was Bd180088 of *Bacillus dothidea*, a fungus that causes apple ring rot and is preserved in the Fungal Diseases Research Laboratory of the College of Plant Protection, Henan Agricultural University. The gene encoding the effector protein BdNIS1 of *Bacillus dothidea* was obtained from strain Bd180088, and the method of acquisition is as follows: (1) Take a piece of mycelium from the *Staphylococcus aureus* strain (Bd180088) preserved in a 20% glycerol cryopreservation tube and inoculate it onto a fresh PDA plate. Incubate in the dark at 25°C for 36-48 hours. Then, use a 5 mm punch to take a piece of mycelium from the edge of the colony and inoculate it onto another fresh PDA plate with the mycelial side down. Continue to incubate in the dark at 25°C for 60-72 hours. Once the strain has been rejuvenated, it is ready for use.

[0016] (2) The 5mm mycelial cake obtained from the edge of the fully rejuvenated Bd180088 strain was inoculated onto a PDA plate lined with sterile cellophane and cultured under suitable conditions for 60-72 hours. Then the mycelium was collected for total nucleic acid extraction.

[0017] (3) Total RNA was extracted from the pathogen using the Kangwei Century Ultrapure RNA Extraction Kit (CW0581S), strictly following the instructions. After extraction, the total RNA was stored at -80℃ or used directly for reverse transcription to synthesize cDNA.

[0018] (4) Using cDNA as a template, the following primers were used to amplify and obtain the BdNIS1 gene fragment: BdNIS1-F: ATGTTCCCCAAGATCGCC, BdNIS1-R:TTAAAAGCCCTTGAACCC; The reaction system for PCR amplification is as follows: Table 1 PCR reaction system (25 μL)

[0019] The reaction procedure for PCR amplification is as follows: Table 2 PCR reaction procedure

[0020] After the amplification was completed, the product was detected by 1.2% agarose gel electrophoresis and then sent to the company for sequencing (Shanghai Sangon Biotech). The amino acid sequence of the effector protein BdNIS1 of B. dothidea is shown in SEQ ID NO.1, the nucleotide sequence of its encoding gene is shown in SEQ ID NO.2 (excluding introns), and the full-length sequence of the BdNIS1 gene is shown in SEQ ID NO.3 (including introns).

[0021] Example 2 This example illustrates the effect of knocking out the BdNIS1 gene on the growth of *B. dothidea*, the causal agent of apple ring rot, and its pathogenicity infecting plants.

[0022] I. Obtaining BdNIS1 gene knockout mutants First, a BdNIS1 gene knockout cassette was constructed using the principle of homologous recombination. Then, BdNIS1 was knocked out using a PEG-mediated protoplast transformation method. Finally, the mutant obtained was identified using four pairs of primers.

[0023] 1. BdNIS1 Construction of gene knockout boxes (1) In apple ring rot fungus ( B. dothidea The sequences of the target gene, 2000 base pairs (bp) upstream and downstream of it, were located in the genome of the strain, and two primer pairs, F1 / R1 and F2 / R2, were designed accordingly. Primer R1 contains... HYG The resistance gene contains the 5' end 25 bp sequence, and primer F2 contains... HYG The 3' 25 bp sequence of the resistance gene. These PCR fragments were amplified and recovered from genomic DNA using a PCR reaction system, as follows: Table 3 PCR reaction system (25 μL)

[0024] Note: Primers are F1 / R1 and F2 / R2; The reaction procedure is as follows: Table 4 Reaction Procedure

[0025] At the end of the reaction, the amplified upstream and downstream PCR fragments were recovered by gel extraction using a universal DNA purification and recovery kit (Shanghai Huiling) and used for the next round of fusion.

[0026] (2) A second round of fusion was performed using a PCR reaction system, and the system was prepared as follows: Table 5 PCR reaction system (20 μL)

[0027] The reaction procedure is as follows: Table 6 Reaction Procedure

[0028] The product obtained from the reaction will be used as primers for three rounds of PCR reactions.

[0029] (3) The three-round PCR amplification and transformation fragment system is as follows: Table 7 PCR reaction system (50 μL)

[0030] Note: Primers are F1 / HY-R and YG-F / R2; The reaction procedure is as follows: Table 8 Reaction Procedure

[0031] After the reaction, the amplified fusion fragments were recovered by gel extraction using a universal DNA purification and recovery kit (Shanghai Huiling) (upstream: corresponding primer F1 / HY-R, downstream: corresponding primer YG-F / R2), and used for subsequent protoplast transformation.

[0032] 2. Preparation of Staphylococcus aureus protoplasts and PEG-mediated protoplast transformation a. Preparation of Staphylococcus aureus protoplasts (1) The Staphylococcus aureus strain Bd180088 was activated and rejuvenated on a PDA plate and cultured at 25°C for 2-3 days; (2) In a clean bench, use a scalpel to cut the edge hyphae block of 1 cm2 as small as possible, transfer it to 100 mL YEPD liquid medium (containing 100 μg / mL AMP+), and incubate at 25°C and 150 rpm for 48 h; (3) After the cultured mycelial clumps were broken up three times by a homogenizer at 6000 rpm for 10 s, they were poured back into the original bottle, and fresh YEPD liquid culture medium was added to 100 mL. The mixture was then shaken at 25°C and 150 rpm for 10 h. (4) Filter the cultured larvae through two layers of sterile filter cloth, rinse with 0.7M NaCl until the hyphae turn white, and transfer an appropriate amount into a 50 mL centrifuge tube. (5) Weigh 0.2 g of Driselase, 0.1 g of Lysing enzyme, and 0.1 g of snail enzyme into a 50 mL centrifuge tube, add 10 mL of 0.7 M NaCl to dissolve, shake at 30 °C and 100 rpm for 25 min, centrifuge at 3500 rpm for 8 min, filter the supernatant through a 0.22 μm filter to remove bacteria, and add it to the centrifuge tube in (4) and shake to disperse the bacteria; (6) Protect the centrifuge tubes from light and incubate at 30°C with shaking at 90 rpm for 2-2.5 h (observe the degree of lysis during this period); (7) Place three layers of lens paper and two layers of non-woven filter cloth in the funnel to filter the enzymatic hydrolysis mixture, and rinse 2-3 times with 0.7 M NaCl; (8) Centrifuge the filtrate at 4°C and 3500 rpm for 10 min, and discard the supernatant; (9) Add 20 mL of 1×STC Buffer and gently pipette to suspend. Centrifuge at 3500 rpm for 6 min at 4℃ and discard the supernatant. (10) Add 1.5 mL of 1×STC Buffer to resuspend, transfer to a 2 mL sterile centrifuge tube, centrifuge at 6000 rpm for 5 min at room temperature, and discard the supernatant; (11) Repeat step (10) to obtain the protoplast of Staphylococcus aureus strain Bd180088 for later use.

[0033] b. PEG-mediated protoplast transformation (1) Take 200 μL of the prepared Staphylococcus aureus strain Bd180088 protoplasts, add 10 μL each of the DNA fusion fragment (upstream and downstream) obtained in step 1, gently pipette and stir to mix, and incubate on ice for 30 min. (2) Cut off the sharp part of the 1 mL pipette tip, slowly rotate and drip in 1 mL of 40% PEG, slowly turn it over to mix it evenly, and let it stand at room temperature for 20 min; (3) Transfer to a 50 mL sterile centrifuge tube, bring the volume up to 10 mL with TB3 liquid medium (containing 100 μg / mL Amp), let stand at room temperature for more than 2 h, and incubate at 25℃ and 90 rpm for 18-20 h; (4) After incubation, bring the volume to 45 mL with warm PDA medium (containing 30 μg / mL HYG), mix slowly by rotating, pour into plates (15 mL / plate), and incubate at 25℃ for 24-48 h for initial screening; (5) If mycelium grows, then use warm PDA medium (containing 50 μg / mL HYG) to cover the plate (10 mL / plate) for secondary screening.

[0034] 3. Detection of knockout mutants (1) Under a stereomicroscope, use a sterile picking needle to pick up a small amount of edge hyphae growing on the double screening plate and inoculate them onto a fresh PDA plate (containing 50 μg / mL HYG) and incubate at 25℃ for 2-3 days; (2) Pick mycelia from the edge of the colony and inoculate them onto fresh antibiotic-free PDA plates, and incubate at 25°C for 2-3 days; (3) Collect hyphal blocks from the edge of the colony and extract total DNA from the hyphae using the CTAB method; (4) Use four pairs of primers (Target-F / Target-R, HYG-F / HYG-R, PF / HY-R, YG-F / PR) to detect the Target gene, HYG resistance gene, and upstream and downstream binding sites of the transformants, respectively; The knockout mutants detected by four pairs of primers were inoculated onto fresh PDA plates (containing 50 μg / mL HYG), cultured at 25°C for 2-3 days, and mycelial blocks were cut and placed in 20% glycerol and stored at -80°C.

[0035] Figure 1 This is a schematic diagram of the BdNIS1 gene targeted knockout.

[0036] Figure 2This is the construction of the BdNIS1 gene knockout cassette and the results of mutant detection. (a) is an electrophoresis image of PCR amplification of the fusion fragment after one round; (b) is an electrophoresis image of PCR amplification of the transformed fragment after three rounds; and (c) is an electrophoresis image of the gene knockout mutant. The experimental results show that the upstream and downstream fragments of BdNIS1 were successfully amplified by PCR. Figure 2 a); subsequently, by fusing it with the hygromycin gene, the upstream and downstream fusion fragments were obtained by PCR amplification ( Figure 2 b); Six knockout transformants were obtained via PEG-mediated transformation. PCR amplification using four primer pairs identified three transformants (BdNIS1-1, BdNIS1-2, and BdNIS1-3) as capable of amplifying hygromycin bands and upstream / downstream fusion fragments, but none amplified the target band of BdNIS1. Figure 2 c) This proves that these three transformants are positive mutants with the deletion of the BdNIS1 gene, and they are named ΔBdNIS1-1, ΔBdNIS1-2 and ΔBdNIS1-3, respectively.

[0037] II. Obtaining BdNIS1 complement transformants BdNIS1 was inserted into the Hind III restriction site of the pKNTG vector. BdNIS1 was then randomly inserted into the genome of the knockout mutant ΔBdNIS1 using PEG-mediated protoplast transformation. G418 antibiotic selection and RT-PCR were used to determine whether the complemented transformants were positive mutants. The steps are as follows: (1) The pKNTG vector was digested with Hind III and the pKNTG-BdNIS1 recombinant plasmid was obtained by seamless cloning using the Gib-Seamless Cloning (Multi-Fragment) (Kermey) kit. (2) Protoplasts of strain ΔBdNIS1 were prepared by referring to the preparation method of protoplasts of Staphylococcus aureus strain Bd180088, and pKNTG-BdNIS1 recombinant plasmid was transformed by PEG-mediated transformation. (3) Initial screening (50 μg / mL) and secondary screening (80 μg / mL) were performed using G418 resistance. (4) The detection method for the replacement transformant is the same as that for the knockout mutant. The resistance is replaced with G418 and the detection primers are: BdNIS1-Target-F / BdNIS1-Target-R and JC-NEO-F / JC-NEO-R. (5) The complement transformants detected by primers were inoculated onto fresh PDA plates (containing 80 μg / mL G418), cultured at 25℃ for 2-3 days, and mycelial blocks were cut and placed in 30% glycerol and frozen at -80℃.

[0038] Figure 3These are the results of BdNIS1 gene complementation transformant detection and RT-PCR detection. (a) is the electrophoresis image of the complementation transformant; (b) is the fluorescence observation of the hyphae of the complementation strain; and (c) is the RT-PCR detection of the target gene in the complementation transformant. Figure 3 As shown in Figure a, compared with the wild-type and knockout mutants, the BdNIS1 complement transformant showed both the target gene band and the G418 resistance gene band, indicating that the effect gene BdNIS1 of apple ring rot fungus had been successfully transformed into the BdNIS1-deficient mutant. Fluorescence microscopy observation of the mutant hyphae revealed abundant fluorescence in the BdNIS1-C hyphae of the complement transformant, further demonstrating that the effect gene BdNIS1 had been successfully transferred into the BdNIS1-deficient mutant. Figure 3 b). RT-PCR analysis of BdNIS1 knockout (ΔBdNIS1), complement mutant (BdNIS1-C), and wild-type strain (WT) revealed that the band brightness of WT and BdNIS1-C was similar, indicating that the BdNIS1 expression level in the complement mutant had been restored to the wild-type state. Figure 3 c).

[0039] Table 9 Primers

[0040] III. The pathogenicity of *Bostomia dothidea* was significantly reduced after BdNIS1 was knocked out. Empty PDA medium was used as a blank control (CK), and wild-type *Botrytis cinerea* strain (Bd180088, WT) was used as a positive control. Wild-type strain (WT), knockout mutant (ΔBdNIS1), and complement mutant (BdNIS1-C) were inoculated onto detached branches and fruits of current-year 'Fuji' apple trees to detect the biological role of BdNIS1 in *B. dothidea* infection. The steps are as follows: 1. Determination of pathogenicity of branches: (1) Activating and rejuvenating Staphylococcus aureus inoculation strains; (2) Cut the current year's apple branches that are of uniform thickness and grow in the field into short branches of about 15 cm; (3) Rinse the branches 2-3 times with tap water to remove dust from the surface; (4) Spray the entire branch with 75% alcohol evenly to disinfect the surface, and then place it in a cool and ventilated place for 10 minutes to allow the residual ethanol on the surface to fully evaporate. (5) Line both ends of the inoculation tray with absorbent cotton, and then evenly place the treated branches in the inoculation tray; (6) Use a 5 mm punch to make a small hole in the center of the short branch, and at the same time punch out the mycelium at the edge of the colony; (7) Inoculate the edge mycelial block with the mycelial side down into the well, and cover the inoculation point with 1 mm thick moist defatted cotton to keep it moist. Seal the inoculation tray with plastic wrap. (8) After culturing at 25℃ in the dark for 24 h, light was introduced. No additional water was added after 3 days. After 7-10 days, the disease incidence was observed in the inoculation wells, and the length and width of the lesions were measured. The significance was analyzed by t-test using Prism software.

[0041] 2. Fruit pathogenicity test: (1) Select ripe Fuji apples, wash the surface of the fruit with running water, then spray the entire fruit evenly with 75% ethanol for disinfection, and finally place the fruit in a cool and ventilated place to dry the residual ethanol on the surface. (2) Using the fruit stalk as the central axis, make two small holes with a depth of 2-3 mm symmetrically at the center of the side of the fruit with a 5 mm punch. Take 5 mm of mycelial cake from the edge of the colony of the fully rejuvenated wild-type grape cotyledon strain, the BdNIS1 gene knockout strain (ΔBdNIS1), and the BdNIS1 gene replenishment strain (BdNIS1-C). Inoculate the mycelial cake (mycelial side down) into the hole and then carry out moist culture at 25℃. (3) Observe the disease situation at the inoculation well three days after the onset of the disease, and measure the length and width of the lesions. Use Prism software to perform t test for significance analysis.

[0042] Figure 4 This study analyzed the pathogenicity of wild-type, BdNIS1 gene knockout, and complement mutants of *Pseudomonas aeruginosa* on apple branches and fruits. (a) Pathogenicity test of knockout and complement mutants on current-year apple branches (10 dpi), bar chart shows lesion area statistics (**, P<0.01); (b) Pathogenicity test of knockout and complement mutant fruits (3 dpi), bar chart shows lesion area statistics (**, P<0.01). Figure 4 As shown, no lesions were developed on branches and fruits in the control group (CK), while ulcerative lesions of varying sizes were developed at the inoculation sites of the wild-type strain, the knockout mutant, and the replacement mutant. The ulcer area caused by the knockout mutant was significantly smaller than that of the wild type, while the ulcer area formed by the replacement mutant was not significantly different from that of the wild type. These results indicate that knocking out the effector gene BdNIS1 significantly reduces the pathogenicity of *B. dothidea* on current-year apple branches and fruits, suggesting that the effector gene BdNIS1 is one of the key pathogenic genes of *B. dothidea*.

[0043] IV. Knockout BdNIS1 It does not affect apple ring rot fungus ( B. dothidea Growth, stress resistance and cell wall integrity 1. Mutant growth assay: To verify the knockout BdNIS1 The effects on the growth of Bd180088 were investigated using different culture media (PDA, CM, MM, OM) to culture wild-type (Bd180088) and knockout mutant (Δ) of apple ring rot fungus. BdNIS1 ), complement mutant ( BdNIS1- C), The culture medium formulation is as follows: PDA medium: 200 g peeled potato, 20 g glucose, 15 g agar powder, deionized water to a final volume of 1000 mL, sterilize at 121℃ for 20 min.

[0044] OM medium (oat medium): Boil 50 g of oat flakes, filter with gauze, suspend 15 g of agar powder in deionized water and add to the filtrate, bring the volume to 1000 mL, and sterilize at 121℃ for 20 min.

[0045] CM medium (complete medium): 2 g peptone, 1 g yeast extract, 1 g acid-hydrolyzed casein, 10 g glucose, 6 g sodium nitrate, 0.5 g potassium chloride, 1 g magnesium sulfate heptahydrate, 1.5 g potassium dihydrogen phosphate, 15 g agar powder, add to 800 mL deionized water to dissolve, adjust the pH to 6.5, and then make up to 1000 mL with deionized water.

[0046] MM medium (minimum medium): 5 g glucose, 1 g ammonium nitrate, 0.5 g potassium dihydrogen phosphate, 1.5 g disodium hydrogen phosphate, 1 g sodium chloride, 0.2 g magnesium sulfate heptahydrate, 15 g agar powder, add to 800 mL deionized water to dissolve, adjust pH to 7.2, and then make up to 1000 mL with deionized water.

[0047] The culture conditions were: 25℃, dark culture, and colony diameter was measured after 3 days using the cross-sectional method.

[0048] Figure 5 It is the wild type of apple ring rot fungus. BdNIS1 The vegetative growth of gene knockout and complement mutants was analyzed. (a) Growth in four culture media: PDA, CM, MM, and OM; (b) Colony diameter after 3 days of culture in the four media (P<0.05). The results showed no significant difference in growth rate between wild-type, knockout mutants, and complement mutants on the same culture media, indicating that knockout mutants... BdNIS1 No impact B. dothideaThe vegetative growth of the pathogens was observed. However, their growth rates and colony morphologies varied significantly across the four different culture media. On PDA medium, the three different types of pathogens grew most vigorously, producing a large number of aerial hyphae. On CM medium, hyphal growth was somewhat inhibited, but aerial hyphae could still be produced. On OM and MM mediums, different types of strains produced fewer aerial hyphae, and colonies were also somewhat inhibited. Among these, the inhibition of hyphae was most pronounced on MM medium.

[0049] 2. Mutant stress test: To clarify BdNIS1 The effect on cell wall integrity of Bd180088 was investigated by culturing wild-type (Bd180088) and knockout mutant (Δ) of *Bacteroides rubrum* under different stress media (0.3 g / LCR, 0.5 M NaCl, 0.04% SDS, 0.5 M Sorbitol, 0.8 mM H2O2). BdNIS1 ), complement mutant ( BdNIS1- C), the above-mentioned culture medium is the PDA medium containing the corresponding amount of stress substances. Among them, CR: Congo red stress medium, used to test cell wall integrity; NaCl: sodium chloride stress medium, used to test salt stress; SDS: sodium dodecyl sulfate stress medium, used to test cell wall integrity and stress resistance; Sorbitol: sorbitol stress medium, used to test hyperosmotic stress; H2O2: hydrogen peroxide stress medium, used to test oxidative stress; blank PDA medium is used as a control.

[0050] The culture conditions were: 25℃, dark culture, and colony diameter was measured after 3 days using the cross-sectional method.

[0051] Figure 6 It is the wild type of apple ring rot fungus. BdNIS1 The stress assays of gene knockout and complement mutants were analyzed, including (a) growth after culture under five different stresses; and (b) the inhibition rate of colony diameter after culture under five different stresses (P<0.05). The results showed that the colony diameters of wild-type, knockout mutant, and complement mutant of *Acer rotundum* on the same culture medium were not significantly different, indicating that the same culture medium had little effect on the knockout and complement mutants, suggesting that the knockout mutant... BdNIS1 No impact B. dothidea The resistance to stress and cell wall integrity were assessed; however, different culture media had a significant impact on the knockout mutant and the complement mutant. Both the deletion mutant and the complement mutant grew best on 0.5 M Sorbitol and 0.8 mM H2O2 media, while they grew worst on 0.04% SDS media.

[0052] Example 3 This example describes apple ring rot fungus (… B. dothidea The effector protein BdNIS1 was transiently expressed in Nicotiana benthamiana.

[0053] I. BdNIS1 can inhibit the Bax-induced PCD reaction. Bax The gene, primarily derived from mammals, can be expressed in plant systems as a PAMP, recognized by plants and triggering an immune response, thereby effectively inducing apoptosis. This embodiment will... BdNIS1 The complete cDNA coding sequence was constructed into the PVX transient expression vector, and PVX- was expressed using liquid nitrogen cold shock. BdNIS1 Transient expression vectors are transformed into Agrobacterium, and then Agrobacterium is infiltrated into tobacco leaves to achieve [the desired result]. BdNIS1 Heterologous expression in tobacco cells. PVX-GFP and Buffer (MMA) were used as negative controls, and PVX-GFP+Bax and Buffer+Bax were used as positive controls. Bax was injected at the same site after 24 h.

[0054] 1. Construction of the expression carrier a) Vector enzyme digestion The PVX transient expression vector was digested with SmaⅠ using a single enzyme, and the following digestion reaction system was prepared on ice: Table 10 Enzyme digestion reaction system (50 μL)

[0055] The enzyme digestion reaction procedure is as follows: Table 11 Enzyme digestion reaction procedure

[0056] After enzyme digestion, the linearized vector was recovered by gel electrophoresis on a 1.2% agarose gel (120V, 30min) using a universal DNA purification and recovery kit (Shanghai Huiling).

[0057] b. Constructing expression carriers (1) Using the cDNA of strain Bd180088 as a template, the complete coding sequence (CDS region) of BdNIS1 from the start codon to the stop codon was amplified by PCR and recovered; (2) The target gene fragment was directionally cloned into the PVX vector using the Gib-Seamless Cloning (Multi-Fragment) (Kermey) kit; (3) The fusion plasmid was transformed into Escherichia coli DH5α by heat shock transformation and the recombinant expression vector was obtained.

[0058] 2. Preparation of Agrobacterium GV3101 competent cells and liquid nitrogen cold shock conversion method a. Preparation of Agrobacterium GV3101 competent cells (1) Streak the preserved Agrobacterium GV3101 glycerol bacteria onto antibiotic-free LB plates and incubate upside down at 28°C for 48 h; (2) Pick a single colony and inoculate it into 3 mL of LB liquid medium. Incubate at 28℃ and 200 rpm for 6-8 h until OD600 = 0.4-0.6. (3) Take 1 mL of the cultured bacterial solution into 100 mL of LB liquid medium and incubate at 28℃ and 200 rpm for 12 h until OD600 = 0.4-0.6; (4) After dividing the cultured bacterial solution into two 50 mL centrifuge tubes, incubate on ice for 30 min; (5) Centrifuge at 3500 rpm for 10 min at 4℃, discard the supernatant, and invert the tube to allow the remaining culture medium to drain completely; (6) Wash the cells three times with 20 mL, 6 mL and 3 mL of pre-cooled 10% glycerol for every 50 mL of culture, centrifuge at 3500 rpm for 10 min at 4℃, and discard the supernatant; (7) Each 50 mL culture was suspended in 2.5 mL of pre-cooled 10% glycerol, dispensed into 1.5 mL sterile centrifuge tubes in units of 100 μL, quick-frozen in liquid nitrogen, and stored in a low temperature freezer at -80℃.

[0059] b. Agrobacterium liquid nitrogen cold shock conversion method (1) Take out the prepared Agrobacterium GV3101 competent cells from the -80℃ freezer and thaw them in an ice bath for 10 min; (2) Add 2 μg of recombinant plasmid and gently stir and mix. Seal the tube opening with sealing film and incubate on ice for 30 min. (3) Freeze with liquid nitrogen for 4 min; (4) Quickly transfer to a 37°C water bath for heat shock for 5 min, and then cool in an ice bath for 10 min; (5) Add 800 μL of antibiotic-free LB liquid medium, mix gently, and incubate at 28℃ and 200 rpm for 3-4 h, then centrifuge at 4000 rpm for 2 min. (6) Discard 600 μL of supernatant and resuspend the bacterial cells in the remaining culture medium; (7) Take 150 μL of bacterial culture and spread it on LB agar containing 50 μg / mL Kana (the vector resistance corresponding to Agrobacterium) and 25 μg / mL rifampin. Incubate at 28°C upside down for 48-72 h. (8) Select a single colony and use PCR to identify positive clones.

[0060] 3. Inoculation of tobacco leaves using Agrobacterium tumefaciens permeation method (1) Streak the Agrobacterium tumefaciens identified as positive clones onto LB plates containing 50 μg / mL Kana and 25 μg / mL rifampin, and incubate upside down at 28°C for 48 h; (2) Pick a single colony and inoculate it into 800 μL of LB liquid medium containing 50 μg / mL Kana and 25 μg / mL rifampicin (corresponding resistance), and incubate at 28℃ and 200 rpm for 24 h; (3) Take 50 μL of the cultured bacterial solution into 5 mL of LB liquid medium containing 50 μg / mL Kana and 25 μg / mL rifampicin (corresponding resistance) (add 100 μL of 0.5 M MES and 2 μL of 100 mM AS to the medium in advance), incubate at 28℃ and 200 rpm for 12-18 h until OD600 = 1.0, centrifuge at 3500 rpm for 10 min and discard the supernatant; (4) Wash twice with 2 mL of 10 mM MgCl2; (5) Resuspend the bacterial cells in MMA solution to OD600 = 1.0 and let stand at room temperature in the dark for 3 h; (6) Remove the needle from a 1 mL syringe and inject the prepared Agrobacterium tumefaciens solution into healthy, uniform-sized tobacco leaves that have been growing for 4-6 weeks. Circle the injection area with a marker to facilitate recording the results or to perform a second injection. After injecting Agrobacterium tumefaciens, keep the tobacco in a constant temperature environment at 25°C for 12 hours in the dark before exposing it to light.

[0061] 4. Western blot verification a) Extraction of total protein from Ben's tobacco (1) Leaf samples were collected 48 h after the leaves of *Tobacco Benedict* were treated with *Agrobacterium* injection. (2) The sample was rapidly frozen in liquid nitrogen and then ground thoroughly in a liquid nitrogen grinder at 60 Hz for 180 s. (3) Add 10 μL of 100 mM benzyl sulfonyl fluoride (PMSF) protease inhibitor and 1 mL of Tris buffer solution (TBS) to the ground sample. (4) Centrifuge the mixture at 10,000 × g for 10 min at 4℃; (5) After centrifugation, carefully aspirate 100 μL of supernatant, add 25 μL of 5× protein loading buffer, and mix thoroughly; (6) The mixture was heated in a boiling water bath for 5 min to denature it, and then immediately placed on ice to cool for 5 min. The treated sample was stored at -20℃ for later use.

[0062] b. Western blot verification (1) Prepare a PAGE gel and perform SDS-PAGE gel electrophoresis. Then, use wet transfer technology to transfer the separated proteins from the gel to a PVDF membrane (BIO-RAD, catalog number 162-0177). Before transfer, the PVDF membrane needs to be soaked in methanol for 15-20 s to activate the membrane surface; (2) Based on the molecular weight of the target protein and the voltage set in the transfer apparatus, the transfer time is precisely controlled to ensure effective transfer; (3) After the transfer is completed, the PVDF membrane is immersed in TBST buffer containing 5% (mass / volume) skim milk powder and gently shaken at room temperature for 1 h to block non-specific binding sites. (4) Incubate the membrane with mouse anti-monoclonal antibody diluted in TBST and shake horizontally overnight at 4°C to ensure that the antibody binds fully to the target protein; (5) The next day, the membrane was thoroughly washed four times with TBST buffer containing 0.05% (volume / volume) Tween 20 for 5 minutes each time to remove unbound antibodies; (6) Immerse the membrane in a 3% skim milk powder TBST solution containing goat anti-mouse IgG-HRP complex (CWBIO, catalog number CW0102) and incubate at room temperature for 30 min to form an antibody-enzyme complex. (7) Wash the membrane with TBST 4 times, 5 min each time, to remove unbound secondary antibodies; (8) Finally, the membrane was reacted with the Western ECL substrate (BIO-RAD, catalog number 170-5060) in the dark for 1 min to generate a chemiluminescent signal; (9) The luminescence signal was captured and analyzed using a Bio-Rad fluorescent gel imaging system (Gel Doc XR+, model 1708195) to detect and quantify the expression level of the target protein.

[0063] Figure 7 This study analyzed the transient expression of the effector protein BdNIS1 in Nicotiana benthamiana. (a) Agrobacterium infiltration strategy and infiltration phenotypes; PVX-GFP and Buffer were negative controls, and PVX-GFP+Bax and Buffer+Bax were positive controls. In the figure, the denominator represents the number of repetitions, and the numerator represents the number of occurrences of the corresponding phenotype; (b) Total protein was extracted from leaves in five regions (excluding the Buffer injection site) for Western blot analysis. Figure 7As shown in Figure a, neither the PVX-GFP nor the Buffer treatment groups produced necrotic plaques, but both produced allergic necrotic plaques after Bax injection. The PVX-BdNIS1 treatment group, however, did not produce necrotic plaques before or after Bax injection. Total protein was extracted from tobacco leaf tissue near the injection site, and the expression of the target protein could be detected by Western blot, such as... Figure 7 As shown in b, BdNIS1 itself does not induce a strong allergic necrosis response in tobacco cells, but it can inhibit the allergic necrosis response induced by Bax. Therefore, it can be concluded that the BdNIS1 protein of *Bacillus maculatus* is one of the key pathogenic effectors of the pathogen.

[0064] II. BdNIS1 can promote the infection of *Phytophthora indica* by *N. benthamiana*. Transient expression technology was used to express control GFP and effector protein BdNIS1 at both ends of *Phytophthora nicotianae* leaves, and the protein expression regions were then inoculated with *Phytophthora nicotianae* for testing. The steps are as follows: (1) Inject Agrobacterium with the target gene plasmid into tobacco leaves and soak for 36 h; (2) Take a clean petri dish, line it with two layers of filter paper and moisten it with an appropriate amount of sterile water, and set it aside for use; (3) Cut the tobacco leaves from the base of the petiole and wrap the cut surface with moist cotton to keep it moist; (4) Place the leaf with the back of the leaf facing up in the petri dish, and make a small hole symmetrically on both sides of the center of the leaf. (5) Use a 5 mm punch to punch out the edge hyphae of Phytophthora tobaccoensis cultured for 5-7 days, inoculate the wound with the hyphae facing down, and cover the fungal cake with a thin layer of moist defatted cotton. (6) After sealing the petri dish, place it in a constant temperature environment of 25℃ and incubate in the dark for 60 h. Then observe and record the experimental results under a handheld ultraviolet lamp. (7) Tissue samples of tobacco leaves, approximately 1.5 cm × 1.5 cm in size, were taken from the periphery of the inoculation site. Total DNA was extracted from the diseased tobacco tissue using the CTAB method. Actin was used as an internal reference gene, and the expression level of the stably expressed EF1 gene in Phytophthora tobaccois was detected by RT-qPCR to assess the relative biomass of Phytophthora tobaccois in the diseased tissue. In addition, total protein was extracted from the diseased tissue using the same method as that for extracting total protein from Nicotiana benthamiana, and the expression of the target protein was examined by Western blot.

[0065] Figure 8This study analyzed the function of the effector protein BdNIS1 in *Phytophthora indicum* infection of *Nicotiana benthamiana*. (a) Transient expression of GFP (left) and BdNIS1 (right) was performed on the underside (left) and upper surface (right) of leaves. *Phytophthora indicum* was inoculated 36 h later, followed by infection for 60 h. The denominator of the numerical values ​​represents the number of replicates, and the numerator represents the number of occurrences of the corresponding phenotype. (b) Lesion length (**, P<0.01) (left) and relative biomass of *Phytophthora indicum* in the affected area (**, P<0.01) (right) were measured 60 h after inoculation. (c) Western blot analysis of protein expression in the affected area was performed. The results showed that the lesion area in the BdNIS1 treatment group was significantly larger than that in the GFP control group (P<0.01). To further analyze the disease incidence, total DNA was extracted from the affected areas, and the expression level of the stably expressed EF1 gene in *Phytophthora indicum* was detected by RT-PCR to reflect the relative biomass of *Phytophthora indicum*. The results showed that the EF1 gene expression level in the BdNIS1 treatment group was significantly higher than that in the GFP control group (P<0.01). Furthermore, Western blot analysis of total protein levels at the lesion sites showed that the target protein was stably expressed in both groups. These results indicate that the effector protein BdNIS1 of *Phytophthora indicum* significantly enhances the infection of *Nicotiana benthamiana* by *Phytophthora indicum*.

[0066] Third, BdNIS1 can inhibit the release of reactive oxygen species in plants, thereby weakening the immune response to Nicotiana benthamiana. Under adverse conditions, plant tissues produce various reactive oxygen species (ROS), among which hydrogen peroxide (H2O2) and superoxide anion (O2-) are two main types. Previous studies have found that BdNIS1 can inhibit Bax-induced PCD response and enhance the pathogenicity of P. nicotianae to Nicotiana benthamiana. To clarify this pathogenesis mechanism, the accumulation of O2- and H2O2 in leaves of Nicotiana benthamiana inoculated with P. nicotianae and transiently expressing BdNIS1 was studied and analyzed using tissue staining (DAB 1 mg / mL pH=3.8, NBT 0.5 mg / mL pH=7.8). Simultaneously, ImageJ software was used to quantify the staining depth.

[0067] The principle of H2O2 and O2- content detection is as follows: 3,3'-diaminobenzidine (DAB) reacts with hydrogen peroxide (H2O2) under the action of peroxidase to form a brown precipitate that is insoluble in water and ethanol, and nitroblue tetrazolium (NBT) reacts with superoxide anion (O2-) to form a blue precipitate that is insoluble in water and ethanol.

[0068] The test method is as follows: (1) After soaking tobacco leaves with BdNIS1 for 36 h, they were inoculated with Phytophthora nicotianae and cultured in a moist environment for 60 h. (2) Completely immerse tobacco leaves infected with Phytophthora in DAB (Sigma) dye solution (1 mg / mL pH=3.8) or NBT (Sigma) dye solution (0.5 mg / mL pH=7.8) and incubate overnight at room temperature; (3) After rinsing the surface with sterile water 3-5 times to remove the residual dye, place it in 95% ethanol in a 40℃-60℃ water bath for 6-16 h until the green background of the leaves is completely removed (fresh ethanol can be replaced repeatedly during this period). (4) Remove the leaf, rinse the leaf surface with sterile water 3-5 times to remove the residual ethanol, place it in 10% glycerol to observe and record the overall staining results, and observe and record the local tissue staining results under a stereomicroscope. ImageJ image analysis software was used to perform quantitative analysis of the staining results using grayscale values ​​(operation steps: ImageJ>Type>8-bit>Adjust>Threshold>Analyze>Measure), converting the staining depth into quantifiable numerical data. Subsequently, Prism statistical software was used to perform t-test analysis on the experimental data to determine the statistical significance of the differences in H2O2 and O2- content among different treatment groups.

[0069] Figure 9 This study analyzed the effect of the effector protein BdNIS1 on the O2- and H2O2 emission capacity of tobacco cells. (a) DAB staining of H2O2, the statistical graph shows the quantitative conversion results of the stained areas using ImageJ (**, P<0.01); (b) NBT staining of O2-, the statistical graph shows the quantitative conversion results of the stained areas using ImageJ (**, P<0.01). The results showed that after overnight incubation with DAB and NBT staining solutions on the corresponding tobacco leaves, the color reaction in the BdNIS1 treatment group was significantly weaker than that in the GFP control group. Observation of the color-changing tissue under a light microscope also revealed that the BdNIS1 treatment group had less color accumulation in the cells compared to the GFP control group. Quantitative conversion of the stained areas using ImageJ software showed that the conversion amount in the BdNIS1 treatment group was lower than that in the GFP control group. These results indicate that the accumulation of O2- and H2O2 in the BdNIS1 treatment group was significantly lower than that in the GFP control group, suggesting that BdNIS1 can effectively inhibit the ROS response in plants, weaken its immune response, and promote pathogen infection.

[0070] IV. The effector gene BdNIS1 was significantly upregulated in the early stages of B. dothidea infection of the host. To clarify the expression pattern of the effector gene BdNIS1 in apples infected by the apple causal agent *B. dothidea*, we inoculated apple fruits with *B. dothidea* and observed the disease development 6-72 hpi after inoculation. Total RNA was extracted from the diseased / healthy fruit pulp at different time points, and the expression level of BdNIS1 was determined using RT-qPCR. The steps are as follows: (1) Select ripe Fuji apples, wash the surface of the fruit with running water, then spray the entire fruit evenly with 75% ethanol for disinfection, and finally place the fruit in a cool and ventilated place to dry the residual ethanol on the surface. (2) Using the fruit stalk as the central axis, make two small holes with a depth of 2-3 mm symmetrically at the center of the side of the fruit with a 5 mm punch. Take a 5 mm mycelium cake from the edge of the fully rejuvenated Bd180088 colony and inoculate the mycelium cake (mycelium side down) into the hole. Then carry out moist culture at 25℃. (3) According to the experimental needs, collect the pulp tissue at the junction of diseased and healthy fruit at the corresponding time points (6 h, 12 h, 24 h, 36 h, 60 h, 72 h), cut it as finely as possible with a scalpel, and then put it in a liquid nitrogen grinder to grind it thoroughly. (4) Real-time quantitative PCR (RT-qPCR) was used to detect the expression level of the BdNIS1 gene. The method was as follows: RNA extraction: The rapid universal plant RNA extraction kit (Huayueyang) was used, and the operation was carried out strictly in accordance with the instructions. The extracted RNA was used directly for reverse transcription or stored at -80℃. cDNA reverse transcription: cDNA was obtained by reverse transcription using the All-in-One Script Rtpremix (with dsDNase) kit (Kermey).

[0071] RT-qPCR detection: Using cDNA as a template and Bd-Actin as an internal reference gene, the expression level of BdNIS1 was determined using a real-time quantitative PCR system (ThermoFisher Scientific QuantStudio 3). The primers are as follows: qPCR-BdNIS1-F:ATTGTTCCCCAAGATCGCC, qPCR-BdNIS1-R:GGATGTTCTCGATCTGCT; The primers for the internal reference gene are: Bd-Actin-F: CCGCTCCGTTTCTATGCTCT, Bd-Actin-R:ACCTCACCGACATACCAGT; Following the instructions for the Kermey 2×SYBR Green qPCR Premix (Universal) kit, the following system was prepared: Table 12 PCR reaction system (20 μL)

[0072] Table 13 PCR reaction procedure

[0073] Export the chart after the program finishes, using 2 -ΔΔCt calculate BdNIS1 Gene expression levels.

[0074] Figure 10 yes B. dothidea Infecting apple fruit within 72 hours BdNIS1 Relative expression level analysis revealed that, BdNIS1 exist B. dothidea Expression of the gene was significantly upregulated 6-24 h after infection of apple fruit, with the highest upregulation at 6 hpi, followed by a gradual decrease in expression levels. These results indicate that the effector gene... BdNIS1 BdNIS1 plays an important role in the early stage of pathogen infection (within 6 hours) and also plays an important role in pathogen colonization and disease development. It is one of the key pathogenic genes of apple ring rot fungus.

[0075] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any way. Any simple modifications, alterations, and equivalent changes made to the above embodiments based on the inventive essence shall still fall within the protection scope of the present invention.

Claims

1. The apple ring rot pathogen effector protein BdNIS1 or the gene encoding said apple ring rot pathogen effector protein BdNIS1. BdNIS1 or containing the gene BdNIS1 The application of expression cassettes, recombinant vectors, or recombinant bacteria in the prevention and control of apple ring rot, characterized in that... The amino acid sequence of the apple ring rot pathogen effector protein BdNIS1 is shown in SEQ ID NO.

1. BdNIS1 The nucleotide sequence is shown in SEQ ID NO.2; the application is: knocking out apple ring rot pathogen. B. dothidea of BdNIS1 After gene generation, apple ring rot fungus B. dothidea Its pathogenicity to apple fruit and branches is significantly reduced.

Images