Formic acid dehydrogenase for realizing direct electron transfer and mutant and application thereof

Abstract

This invention provides a formate dehydrogenase that enables direct electron transfer, its mutants, and their applications. The mutant uses the amino acid sequence shown in SEQ ID NO.1 or an amino acid sequence having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with SEQ ID NO.1 as a parent, containing at least one of the following sites or their equivalent positions: E263, L273, H264, R363, E228, H224C, E243, or H224. This mutant is an amino acid sequence that has undergone amino acid mutation and possesses formate dehydrogenase activity. The mutant of this invention can achieve direct electron transfer, exhibiting a higher CO2 reduction current in the DET system, higher catalytic ability or efficiency in the CO2 reduction reaction, and improved CO2 turnover or conversion rate.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a formate dehydrogenase that enables direct electron transfer, its mutants, and their applications. Background Technology

[0002] Formate dehydrogenase (FDH) is an oxidoreductase that specifically catalyzes the reversible reduction of CO2 to formate. There are two types of FDH: one is NADH-dependent FDH, which is oxygen-tolerant, easily expressed, and has a high yield, but has low CO2-reducing enzyme activity (FEBS Lett. 1972, 27(1), 111-115); the other is metal-dependent FDH (Science 1997, 275(5304), 1305-1308; Science 2002, 295(5561), 1863-1868.), which exhibits high enzyme activity and high turnover rate for CO2 reduction, but suffers from problems such as oxygen intolerance, difficulty in expression, and low yield. In CO2EER systems, when FDH catalyzes CO2 reduction, its electrons can be transferred to the electrode via electron mediators or coenzymes to achieve efficient CO2 reduction. However, processes mediated by electron mediators consume energy. Therefore, much research now focuses on direct electron transfer systems (DET) that do not rely on coenzymes or electron mediators, i.e., the direct transfer of electrons between the electron exchange sites at the enzyme interface and the electrode interface. DET not only simplifies CO2EER systems but also avoids the decrease in redox potential caused by coenzymes and electron mediators. More importantly, research has found that if formate dehydrogenase is directionally immobilized in DET systems, it is expected to achieve CO2 turnover rates (e.g., ClFDH: 1210s). -1 The value is higher than that of enzyme systems that use electron mediators as electron acceptors (ClFDH: 0.73s). -1 (CarbonEnergy 2023, 1-13.) Therefore, it is speculated that the electron transfer rate from the interfacial electron exchange site of formate dehydrogenase to the electron donor plays a crucial role in CO2 conversion. Research on DET systems with directed immobilization of formate dehydrogenase is expected to improve CO2 conversion.

[0003] Previous studies have shown that SfFDH (PNAS2008,105(31),10654-10658.) and EcFDH (JACS2014,136(44),4592; JACS2017,139(29),9927-9936) can achieve DET; however, strict anaerobic conditions limit the application of these two enzymes. Among oxygen-tolerant FDHs, DvFDH (PNAS 2008, 105(31), 10654-10658; ACS Catal. 2017, 7(11), 7558-7566; Angew. Chem. Int. Ed. 2019, 58(23), 7682-7686) and ClFDH (Adv. Energy Mater. 2019, 9(25); ACS Sustain. Chem. Eng 2022, 10(45), 14888–14896) also achieved reversible electrocatalysis of CO2 to formic acid. However, DvFDH expression and purification are complex (ACS Catal. 2020, 10(6), 3844-3856), and ClFDH has low CO2 reductase activity (9.4 mU / mg) (J CO2. Util The limitations of the two enzymes (2022, 57, 101876) restrict their engineering applications. In CO2EER systems constructed using NADH-dependent FDH, NADH is generally used as an electron mediator to conduct electron transfer to the electrode interface, resulting in energy loss and difficulties in NADH regeneration. However, NADH-dependent FDH generally has advantages such as oxygen tolerance, ease of expression, and high yield. If an efficient and rapid electron transfer pathway from the interfacial electron exchange site to the amino acid residues on the enzyme surface can be discovered in NADH-dependent FDH, and precisely and directionally immobilized to achieve in-situ regeneration of NADH, it would provide a possibility for constructing an engineered DET CO2EER system. TsFDH has the highest enzyme activity among NADH-dependent FDHs, its crystal structure and NADH binding site have been resolved, and its expression and purification methods are mature. In summary, TsFDH has the potential for efficient and rapid DET research and is expected to improve CO2 conversion rate through CO2EER formic acid production reaction systems. Therefore, exploring and establishing an efficient and rapid DET electron transfer pathway for TsFDH is of significant scientific importance and is currently a major challenge in the field of TsFDH research. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a formate dehydrogenase capable of direct electron transfer, its mutants, and their applications. Using an amino acid sequence such as SEQ ID NO.1 as the parent sequence and its structure (PDB:3WR5) as the design template, a rational design process is performed. Predicted sites are mutated, enzyme kinetics are tested, and electrochemical verification is conducted to obtain a formate dehydrogenase mutant capable of direct electron transfer.

[0005] In one aspect, the present invention provides a formate dehydrogenase mutant having an amino acid sequence of 1) or 2):

[0006] 1) Using the amino acid sequence shown in SEQ ID NO.1 or an amino acid sequence having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity with SEQ ID NO.1 as a parent, an amino acid sequence containing at least one of the following sites or equivalent positions: E263, L273, H264, R363, E228, E243, or H224, which has undergone amino acid mutation and has formate dehydrogenase activity;

[0007] 2) The amino acid sequence shown in 1) is modified by substitution and / or deletion and / or addition of one or more conserved amino acid residues to form an amino acid sequence with the same function.

[0008] In one embodiment of the present invention, the nucleotide sequence of the parent is as shown in SEQ ID No. 9, or SEQ ID No. 9 has a nucleotide sequence with at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity.

[0009] In one embodiment of the present invention, the amino acid sequence of the formate dehydrogenase mutant includes an amino acid substitution at at least one site selected from the group consisting of: E263C, L273C, H264C, R363C, E228C, E243C, and H224C. In one embodiment of the present invention, the amino acid substitution is selected from E263C. In one embodiment of the present invention, the amino acid substitution is selected from L273C. In one embodiment of the present invention, the amino acid substitution is selected from H264C. In one embodiment of the present invention, the amino acid substitution is selected from R363C. In one embodiment of the present invention, the amino acid substitution is selected from E228C. In one embodiment of the present invention, the amino acid substitution is selected from E243C. In one embodiment of the present invention, the amino acid substitution is selected from H224C.

[0010] In one embodiment of the present invention, the formate dehydrogenase mutant comprises an amino acid substitution selected from any of the following sites: E263C, L273C, H264C, R363C. Preferably, the formate dehydrogenase mutant comprises an amino acid substitution selected from the E263C site or the L273C site.

[0011] In one embodiment of the present invention, the amino acid sequence of the formate dehydrogenase mutant is as shown in any of SEQ ID NO:2-8 or has at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity with the sequence shown in any of SEQ ID NO:2-8.

[0012] In one embodiment of the present invention, compared with wild-type formate dehydrogenase, the formate dehydrogenase mutant exhibits a higher CO2 reduction current in the DET system and has higher catalytic ability or efficiency in the CO2 reduction reaction.

[0013] In a second aspect, the present invention provides a polynucleotide encoding the formate dehydrogenase mutant described above.

[0014] In one embodiment of the present invention, the polynucleotide comprises single-stranded or double-stranded DNA, cDNA, RNA, or other artificial nucleic acids.

[0015] In one embodiment of the present invention, the polynucleotide includes nucleotide sequences of open reading frames (ORF) and untranslated regions (UTR).

[0016] In a third aspect, the present invention provides a carrier containing the above-mentioned polynucleotides.

[0017] In one embodiment of the present invention, the vector can be any vector such as plasmid, bacteriophage, virus, YAC vector, shuttle vector, etc.

[0018] In one embodiment of the present invention, the plasmid includes, but is not limited to, the pET series, pACYC series, or pGEX series. In one embodiment, the plasmid is pET-20b(+) as the vector.

[0019] In one embodiment of the present invention, the vector is an expression vector, which may contain a transcription promoter, a terminator, a ribosome binding site, an enhancer, an A signal, a ribosome binding sequence (SD sequence), and selectable marker genes such as antibiotic (e.g., ampicillin, neomycin, kanamycin, tetracycline, chloramphenicol, etc.) resistance genes.

[0020] In a fourth aspect, the present invention provides a host cell containing the polynucleotide or the vector.

[0021] In one embodiment of the present invention, the host cell is obtained by introducing a polynucleotide encoding the mutant protease or a vector containing the polynucleotide (preferably a recombinant expression vector).

[0022] In one embodiment of the present invention, the host cell includes bacteria such as Escherichia coli and Bacillus subtilis, fungi such as yeast, animal cells, and plant cells. In one embodiment of the present invention, the host cell is Escherichia coli.

[0023] In one embodiment of the present invention, the method of introduction may include transformation methods such as calcium phosphate method, electroporation method, lipid transfection method, gene gun method, and PEG method.

[0024] In a fifth aspect, the present invention provides a method for preparing the above-mentioned formate dehydrogenase mutant, comprising culturing the above-mentioned host cells in a culture medium to obtain the mutant.

[0025] In one embodiment of the present invention, the culture medium includes any culture medium suitable for culturing the aforementioned host cells. For example, a culture medium suitable for host cells such as *E. coli* and yeast cells is acceptable, as long as the host cells can be cultured using available carbon sources, nitrogen sources, and inorganic salts. Examples include LB medium and 2×YT medium. An inducer can be added to the culture medium when culturing the host cells. For example, IPTG.

[0026] In one embodiment of the present invention, rational design is used to predict surface sites that can achieve direct electron transfer of TsFDH based on the TsFDH structure; and the target mutant is obtained by plasmid amplification using site-directed mutagenesis primers.

[0027] In one embodiment of the present invention, the following steps are specifically included:

[0028] (1) Predict the surface sites that can realize direct electron transfer of TsFDH based on the TsFDH structure, mutate the predicted sites to cysteine, and inoculate the host cell monoclonal containing the recombinant plasmid into 5 mL of liquid LB medium and culture at 37°C overnight to obtain seed liquid.

[0029] (2) Inoculate the seed culture into LB medium at a rate of 1%, and culture at 37°C until the biomass OD600 reaches 0.6-0.8. Then add an inducer and continue to culture at 16°C for 12-16 hours. Centrifuge to collect the cells.

[0030] (3) The cells collected by centrifugation were homogenized under high pressure, and the lysate was centrifuged at 4℃ and 8000rpm for 25min to obtain crude enzyme solution.

[0031] (4) The crude enzyme solution was subjected to nickel column affinity chromatography to obtain the pure enzyme of TsFDH mutant.

[0032] In a sixth aspect, the present invention provides an enzyme electrode for enzyme electrocatalytic reduction, comprising a metal electrode and a formate dehydrogenase mutant covering the surface of the metal electrode.

[0033] In one embodiment of the present invention, the metal electrode is selected from ITO electrode, FTO electrode, glassy carbon electrode, gold electrode, carbon electrode or carbon cloth electrode.

[0034] In one embodiment of the present invention, the loading amount of the formate dehydrogenase mutant on the metal electrode is 0.1-0.4 mg / cm³. 2 .

[0035] In one embodiment of the present invention, the formate dehydrogenase mutant is coated onto the surface of a metal electrode and incubated to allow the mutant to bind to the electrode surface; subsequently, the surface active sites on the metal electrode that are not bound to the formate dehydrogenase mutant are blocked, thereby obtaining the enzyme electrode.

[0036] In a seventh aspect, the present invention also provides an enzyme electroreactor, comprising the enzyme electrode described above, wherein the enzyme electrode is a working electrode.

[0037] In an eighth aspect, the present invention provides a method for performing a catalytic reduction reaction using the above-described enzyme electrode or enzyme electroreactor, comprising contacting the enzyme electrode or enzyme electroreactor with a reaction solution to generate an electric current for the reaction, wherein the reaction solution comprises an electrolyte and a substrate. The substrate is a formate dehydrogenase substrate. The electrolyte comprises at least one of phosphate buffer, carbonate buffer, Tris-HCl buffer, PBS buffer, etc.

[0038] In a ninth aspect, the present invention provides the application of the above-mentioned formate dehydrogenase mutant, polynucleotide, carrier, host cell, enzyme electrode, and enzyme electroreactor in the preparation of fuel cells, hydrogen storage materials, fine chemicals (including methanol, ethanol, or other organic acids / alcohols), and biofuels.

[0039] Compared with the prior art, the present invention has the following beneficial effects:

[0040] The mutant of this invention can achieve direct electron transfer, exhibits a higher CO2 reduction current in the DET system, has higher catalytic ability or efficiency in the CO2 reduction reaction, and improves the turnover or conversion rate of CO2. Attached Figure Description

[0041] Figure 1 Design concept diagram for TsFDH direct electron transport;

[0042] Figure 2 The graph shows the results of the enzymatic performance test of the TsFDH mutant.

[0043] Figure 3 Tests on the direct electron transport properties of TsFDH mutants. Detailed Implementation

[0044] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention, and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.

[0045] Unless otherwise stated, the raw materials and reagents used in the following examples are commercially available products or can be prepared by known methods.

[0046] "Parent" refers to a polypeptide whose amino acid residues have been mutated to form a mutant. In other words, "parent" is the polypeptide before the mutation.

[0047] "Amino acid mutation" refers to replacing an amino acid residue at a given position with another amino acid residue (e.g., a naturally occurring amino acid residue present in wild-type TsFDH (e.g., SEQ ID NO:1)). For example, the naturally occurring amino acid residue at position 263 of the wild-type TsFDH sequence (SEQ ID NO:1) is glutamic acid (E) (E263); therefore, an amino acid substitution at E263 means replacing the naturally occurring glutamic acid with any amino acid residue other than asparagine.

[0048] "The equivalent position" refers to the amino acid in the target polypeptide that aligns with the specified sequence when the polypeptide and the sequence are optimally aligned. This can be determined by aligning the target sequence and the reference sequence (e.g., the amino acid sequence of SEQ ID NO:1) in a manner that gives the greatest similarity. The alignment of amino acid sequences can be performed using well-known algorithms, the methods of which are well known to those skilled in the art. For example, alignment can be performed using the Clustal W multiple sequence alignment program (Thompson, JDe et al., 1994, Nucleic Acids Res. 22: 4673-4680) with default settings. Alternatively, Clustal W2 or Clustal omega, as revisions of Clustal W, can be used. For example, Clustal W, Clustal W2, and Clustal omega can be used on the website of the European Bioinformatics Institute (EBI [www.ebi.ac.uk]). In the above alignment, the position of the target sequence that matches any position in the reference sequence is considered the "equivalent position". For example, the amino acid corresponding to the position of SEQ ID NO:1 can be determined using an alignment algorithm such as BLAST. In some embodiments, the corresponding amino acid position is determined by aligning SEQ ID NO:1 with another TsFDH sequence.

[0049] "Polynucleotides" are single- or double-stranded polymers of deoxyribonucleotide or ribonucleotide bases, typically read from the 5' to 3' end. Polynucleotides include RNA and DNA, and can be isolated from natural sources, synthesized in vitro, or prepared from a combination of natural and synthetic molecules.

[0050] The identity of nucleotide and amino acid sequences can be calculated using the Lipman-Pearson method (Science, 1985, 227: 1435-1441). Specifically, it can be calculated using the homology analysis program in the Genetyx-Win genetic information processing software, with the Unit size to compare (ktup) set to 2.

[0051] "Operable linking" refers to linking a gene and a regulatory region in a manner that enables the gene to be expressed under the control of the regulatory region. Methods of "operable linking" are well known to those skilled in the art.

[0052] The term "host cell" refers to any cell capable of replicating and / or transcribing and / or translating heterologous polynucleotides. Therefore, "host cell" refers to any prokaryotic cell (including but not limited to *E. coli*) or eukaryotic cell (including but not limited to yeast cells, mammalian cells, avian cells, amphibian cells, plant cells, fish cells, and insect cells), whether located in vitro or in vivo. For example, host cells can be located in transgenic animals or transgenic plants. Host cells can be transformed, for example, with heterologous polynucleotides.

[0053] A "vector" is a nucleic acid containing a coding sequence and the sequences necessary for expressing that coding sequence. Vectors can be viral or non-viral. A "plasmid" is a non-viral vector, such as a nucleic acid molecule encoding a gene and / or a regulatory element required for gene expression. A "viral vector" is a virally derived nucleic acid capable of transporting another nucleic acid into a cell. When present in a suitable environment, a viral vector can guide the expression of one or more proteins encoded by one or more genes carried by the vector. Examples of viral vectors include, but are not limited to, retroviruses, adenoviruses, lentiviruses, and adeno-associated virus vectors.

[0054] "Direct electron transfer" refers to the process by which a formate dehydrogenase mutant, when catalyzing a substrate (CO2), directly transfers electrons through the enzyme's active site to an electron acceptor (such as a metal electrode) without relying on traditional cofactors, thus achieving direct electron transfer.

[0055] Example 1: Surface site design of TsFDH enzyme

[0056] The Find Surface Residuce plugin for Pymol was used to identify amino acid residues on the protein surface, among which those with a high electronic coupling matrix (T) were selected. DA The CB atoms of the residues are selected and mutated to cysteine ​​by screening as shown below.

[0057] 1. The residue is not in the surface depressions.

[0058] 2. CB atoms are points outside proteins.

[0059] 3. When the residue is mutated to cysteine, the structural stability is basically unaffected.

[0060] 4. Electron transport pathways do not cross protein-protein interaction interfaces.

[0061] Then, for each mutant system, molecular dynamics (MD) simulations were performed using Amber for 100 ns. Fourthly, T was calculated on the MD trajectory using Pathways (a VMD plugin developed by Balabin and Beratan). DA And based on the calculated T DA Select potential direct electronic pathways for mutant proteins.

[0062] Calculate the electron transport rate k according to the Fermi-Golden rule. ET .

[0063] Among them, electron transport rate (k ET The electron coupling matrix (T) is determined by four variables. DA ), driving force (ΔG), recombination energy (λ), and temperature T, in calculating k ET At this point, we assume that the driving force (ΔG) and recombination energy (λ) of different protein crystal conformations remain constant, and the electron transfer rate is mainly determined by T. DA Decision. Choose k. ET The higher electron pathways were identified to determine the amino acid residues they passed through, so as to facilitate subsequent experimental verification and analysis.

[0064] Example 2: Construction of plasmids for predicting mutants

[0065] Based on the predictions in Example 1, site-directed mutations were performed at TsFDH surface sites 263, 273, 264, 363, 228, 243, and 224 to cysteine.

[0066] The required cells and reagents are as follows: wild-type expression plasmid pET-20b(+) was obtained from our laboratory; E. coli Top10 and BL21(DE3) were prepared in-house, but can also be purchased; nickel affinity chromatography packing material was purchased from Sigma-Aldrich; the packing is done as needed during protein purification; β-nicotinamide adenine dinucleotide (NAD) + ) and β-nicotinamide adenine dinucleotide coenzyme reduction (NADH) were purchased from Aladdin Company, and all other reagents were domestically produced or imported analytical grade.

[0067] The target mutant was obtained by PCR amplification using site-directed mutagenesis primers with the mutant plasmid pET-20b(+)-TsFDH containing information from previous laboratory work as a template. The PCR amplification program was as follows: pre-denaturation at 98℃ for 2 min; denaturation at 98℃ for 10 s, annealing at 56℃ for 30 s, extension at 72℃ for 90 s, 25 cycles; extension at 72℃ for 5 min. The above products were digested with DpnI at 37℃ for 1 h, purified using a DNA purification kit, and then transformed into E. coli competent cells Top 10 to obtain positive clones. Single clones were selected and sequenced to obtain different mutants. Recombinant plasmids from 6 mutants were extracted for later use. The specific primer sequences are shown in Table 1.

[0068] Table 1 Primers used for site-directed mutagenesis

[0069] Primer Name Primer Sequence H264C-r(SEQ ID NO:10) CTGCATCCGGAAACCGAATGCATGATCAATGATGAA H264C-f(SEQ ID NO:11) TTCATCATTGATCATGCATTCGGTTTCCGGATGCAG E263C-r(SEQ ID NO:12) CTGCATCCGGAAACCTGCCACATGATCAATGATGAA E263C-f(SEQ ID NO:13) TTCATCATTGATCATGTGGCAGGTTTCCGGATGCAG L273C-r(SEQ ID NO:14) ACGCTGAAACTGTGCAAGCGTGGCGCTTAT L273C-f(SEQ ID NO:15) ATAAGCGCCACGCTTGCACAGTTTCAGCGT R363C-r(SEQ ID NO:16) GGTCGTCCGATTCGCTGCGAATATCTGATCGTG R363C-f(SEQ ID NO:17) CACGATCAGATATTCGCAGCGAATCGGACGACC E243C-r(SEQ ID NO:18) CACATCGCAGTGCGGTGTCATGTCTTCGCGGGT E243C-f(SEQ ID NO:19) ACCCGCGAAGACATGACACCGCACTGCGATGTG E228C-r(SEQ ID NO:20) CGTCACCGTCTGCCGtgcGCAGTGGAAAAAGAA E228C-f(SEQ ID NO:21) TTCTTTTTCCACTGCgcaCGGCAGACGGTGACG H224C-r(SEQ ID NO:22) ACCCGCGAAGACATGACACCGCACTGCGATGTG H224C-f(SEQ ID NO:23) CACATCGCAGTGCGGTGTCATGTCTTCGCGGGT

[0070] Example 3: Expression and purification of TsFDH mutant

[0071] The TsFDH mutant plasmid obtained in Example 2 was transformed into E. coli BL21(DE3) for TsFDH mutant expression. The specific steps are as follows:

[0072] (1) Preparation of Escherichia coli strains expressing TsFDH mutant. The screened positive strains were streaked on LB solid medium (100 μg / mL ampicillin) until single colonies grew. Single colonies were picked and inoculated into liquid LB medium and cultured in a shaker at 37°C and 200 rpm for 12-16 h to obtain seed culture.

[0073] (2) Mutant enzyme induction and screening. The induction conditions for the six mutant enzymes were the same as those for wild-type TsFDH. The seed culture, which had been cultured overnight, was inoculated into LB medium at a 1% inoculum and cultured at 37°C until the biomass OD600 reached 0.6-0.8. Then, isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.1 mM and the cells were induced at 16°C for 12-16 h. The cells were collected by centrifugation at 4°C. The collected cells were homogenized by high pressure (1000 bar) for 1 min in lysis buffer (50 mM PBS, pH 7.0) for 25 min, and the supernatant was collected by centrifugation at 8000 rpm at 4°C. The supernatant was directly fed into a nickel affinity chromatography column. Impurities were eluted with equilibration buffer (50 mM PBS, pH 7.0, containing 20 mM imidazole), followed by elution with elution buffer (50 mM PBS, pH 7.0, containing 200 mM imidazole). The target protein was concentrated by centrifugation and diluted with imidazole to below 0.1 mM.

[0074] Example 4: Enzymatic Performance Test of TsFDH Mutant

[0075] The principle of TsFDH mutant activity assay is as follows: Under the catalysis of TsFDH, the absorbance of the cofactor NADH at 340 nm decreases when the substrate NaHCO3(CO2) is reacted. The concentration change of NADH is calculated based on the molar extinction coefficient, thereby determining the TsFDH enzyme activity. Under these detection conditions, the extinction coefficient of NADH is 6.22 mM. -1 cm -1 Enzyme activity is defined as the amount of enzyme required to catalyze the consumption of 1 μmol of NADH by 1 mg of TsFDH at 37 °C, which is 1 U.

[0076] The specific steps are as follows:

[0077] (1) Final concentration of reaction solution: 50mM NaHCO3, 0.1, 0.2, 0.4, 0.8, 1.2, 1.6, 2.0, 2.5, 3.0, 4.0mM NADH solution, 100mg / L TsFDH mutant.

[0078] (2) Add the above reaction solution to a 96-well plate, 250 μL per well, and react at 25°C for 40 min.

[0079] (3) The kinetic parameters of the enzyme were calculated using nonlinear regression with GraphPad Prism software. Figure 2 ).

[0080] The results showed that, compared with wild-type formate dehydrogenase, all TsFDH mutants exhibited little change in Km and Vmax, indicating that these sites have little impact on enzymatic performance.

[0081] Example 5: Testing of direct electron transfer in TsFDH mutants

[0082] A gold electrode was selected as the base electrode. The gold electrode was polished with Al₂O₃ and electrochemically activated in 0.5 M H₂SO₄. The scan range was -0.3 V to 1.5 V, the scan rate was 50 mV / s, and the number of scan cycles was 20. Afterwards, it was ultrasonically cleaned with ultrapure water and ethanol for 5 min each, and then dried under nitrogen. 10 μl of the above-mentioned 2 g / L active mutant was drop-coated onto the Au electrode surface and incubated overnight at 37 °C. This was labeled FDH / Au. The next day, the unbound mutant was washed with ultrapure water and dried under N₂. FDH / Au was then immersed in 1 mM 6-mercapto-1-hexanol (MCH) solution for 1 h to allow MCH to block the unbound active sites on the gold electrode surface. This was then labeled FDH / M / Au and prepared for later use. First, time-current tests were performed on all mutant electrodes. The voltage was set to -1.0V, the electrolyte was 0.1M PBS (pH 6), 50mM sodium bicarbonate was added, and CO2 was continuously passed through for two hours. The current response was recorded.

[0083] By comparing the reduction currents of different mutant enzyme electrodes for CO2, mutant electrodes capable of direct electron transfer were selected based on the magnitude of the reduction current. Figure 3 ).

[0084] The results show that, compared with wild-type formate dehydrogenase, mutants E263C, L273C, H264C, and R363C exhibited higher CO2 reduction currents, which increased by 16, 14, 8, and 1 times, respectively, indicating that these mutant enzymes have higher catalytic ability or efficiency in CO2 reduction reactions.

[0085] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

[0086] SEQ ID NO:1

[0087]

[0088] SEQ ID NO:2

[0089]

[0090] SEQ ID NO:3

[0091]

[0092] SEQ ID NO:4

[0093]

[0094]

[0095] SEQ ID NO:5

[0096]

[0097] SEQ ID NO:6

[0098]

[0099] SEQ ID NO:7

[0100]

[0101] SEQ ID NO:8

[0102]

[0103] SEQ ID NO.9 Sequence:

[0104]

[0105]

Claims

1. A mutant formate dehydrogenase enzyme, characterized in that: Using the amino acid sequence shown in SEQ ID NO.1 as the parent, the amino acid sequence of the formate dehydrogenase mutant is an amino acid substitution at any one of the following sites: E263C, L273C, H264C, R363C, and its amino acid sequence is selected from any one of the sequences shown in SEQ ID NO:4 to 7.

2. A polynucleotide encoding the formate dehydrogenase mutant of claim 1.

3. A vector containing the polynucleotide of claim 2.

4. A host cell containing the polynucleotide of claim 2 or the vector of claim 3.

5. The host cell of claim 4, wherein: The host cell is obtained by introducing a polynucleotide encoding the formate dehydrogenase mutant or a vector containing the polynucleotide.

6. The host cell of claim 4, wherein: The host cells include bacteria, fungi, animal cells, and plant cells.

7. The host cell of claim 6, wherein: The bacteria are Escherichia coli or Bacillus subtilis; the fungus is yeast.

8. The host cell of claim 7, wherein: The host cell is Escherichia coli.

9. A method of preparing the formate dehydrogenase mutant of claim 1, comprising: a) expressing a polynucleotide encoding the formate dehydrogenase mutant in a host cell; and b) isolating the formate dehydrogenase mutant from the host cell. The mutant is obtained by culturing the host cells of any one of claims 4-8 in a culture medium.

10. An enzyme electrode for electrocatalytic reduction of an enzyme, characterized by: The formate dehydrogenase mutant of claim 1 includes a metal electrode and a coating on the surface of the metal electrode.

11. An enzyme electroreactor, characterized in that it includes the enzyme electrode of claim 10, wherein the enzyme electrode is a working electrode.

12. A method for carrying out a catalytic reduction reaction using the enzyme electrode of claim 10 or the enzyme electroreactor of claim 11, characterized in that: The method involves contacting an enzyme electrode or enzyme electroreactor with a reaction solution and generating an electric current to carry out the reaction; the reaction solution includes an electrolyte and a substrate; the substrate is a formate dehydrogenase substrate; the electrolyte includes at least one of phosphate buffer, carbonate buffer, Tris-HCl buffer, and PBS buffer.

13. The application of the formate dehydrogenase mutant of claim 1, the polynucleotide of claim 2, the vector of claim 3, the host cell of any one of claims 4-8, the enzyme electrode of claim 10, and the enzyme electroreactor of claim 11 in the preparation of fuel cells, hydrogen storage materials, fine chemicals, and biofuels.

14. The application as described in claim 13, characterized in that: The fine chemicals are selected from methanol, ethanol, or other organic acids / alcohols.

Images