Panax notoginseng bHLH transcription factor gene PnbHLH2 and application thereof

By overexpressing the Panax notoginseng bHLH transcription factor gene PnbHLH2 in tobacco, the problems of long breeding cycles and environmental pollution in traditional breeding have been solved, achieving highly efficient antifungal genetic engineering breeding and providing new disease-resistant materials.

CN120366334BActive Publication Date: 2026-05-29KUNMING UNIV OF SCI & TECH

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
KUNMING UNIV OF SCI & TECH
Filing Date
2025-05-21
Publication Date
2026-05-29

Smart Images

  • Figure CN120366334B_ABST
    Figure CN120366334B_ABST
Patent Text Reader

Abstract

The application discloses a Panax notoginseng bHLH transcription factor gene PnbHLH2 , and the nucleotide sequence is as shown in SEQ ID NO:1, and the bHLH transcription factor is encoded. PnbHLH2 The application proves that the gene has the ability to improve the resistance of plants to fungal infection by molecular biology and functional genomics related technologies. PnbHLH2 The gene is constructed into a plant expression vector and is introduced into tobacco to be overexpressed, and experimental results show that the overexpression PnbHLH2 Transgenic tobacco has obviously enhanced resistance to Fusarium lateritium (Fusarium lateritium) Fusarium lateritium ), Fusarium roseum (Fusarium roseum) Fusarium incarnatum ), Humicola grisea (Humicola grisea) Humicola fuscoatra ) and Cylindrocarpon destructans (Cylindrocarpon destructans) Cylindrocarpon destructans ).
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and genetic engineering, and specifically relates to a Panax notoginseng bHLH transcription factor gene with antifungal infection capabilities. PnbHLH2 And its applications. Background Technology

[0002] Pathogen infection has a serious impact on plant growth and development (Wilkinson SW, Mageroy MH, López Sánchez A, et al. Surviving in a hostile world: plant strategies toresist pests and diseases. Annual Review of Phytopathology, 2019, 57: 505-529). Plant diseases can occur throughout the entire plant production chain and are one of the greatest threats to sustainable development, causing annual yield losses of 13%-22% in major crops such as rice, wheat, corn, and potatoes (Savary S, Willocquet L, Pethybridge SJ, et al. The global burden of pathogens and pests on major foodcrops. Nature Ecology and Evolution, 2019, 3 (3): 430-439). Among these, fungal diseases are the most numerous type of plant disease, accounting for approximately 80%-90% of all disease types. Traditional methods for controlling plant diseases mainly involve using chemical agents, improving cultivation management practices, and breeding resistant new varieties. While these methods have achieved some success, traditional breeding cycles are long, cultivation measures are less effective, and chemical agents can easily lead to environmental pollution and food safety issues, thus failing to completely solve the disease problem. With the rapid development of biotechnology, using genetic engineering to breed disease-resistant new varieties can not only overcome many of the drawbacks of the above-mentioned control methods but also minimize damage to beneficial microorganisms in the soil, achieving sustainable agricultural development.

[0003] In the process of natural selection and biological evolution, plants have developed unique molecular mechanisms for regulating gene expression. These mechanisms are divided into three levels: transcriptional regulation, post-transcriptional regulation, and translational regulation. Transcription factors (TFs) are a class of proteins that can bind to specific sequences upstream of genes and thus regulate gene transcription. Plants have various families of transcription factor proteins, such as bHLH, bZIP, Zinc-finger, and MYB, among which bHLH transcription factor has attracted much attention. Typical plant transcription factors generally consist of four functional domains: a DNA-binding domain, a transcription regulation domain, a nulcear localization signal domain, and an oligomerization site (Chen Xia, Luo Shiqiao, Duan Cuifang, et al. Research progress on transcription factors in higher plants. Anhui Agricultural Science Bulletin, 2008, 14 (9): 48-52, 65). Overexpression of a disease-resistant transcription factor gene in plants through genetic engineering is equivalent to introducing multiple disease-resistant genes, thereby improving overall disease resistance. Therefore, transcription factors have become a research hotspot in plant disease resistance genetic engineering in recent years. There are approximately 58 transcription factor families in plants, among which six transcription factor families—AP2 / ERF (APETALA2 / ethyleneresponsive factor), bHLH (basic helix-loop-helix), MYB, NAC [NAM (no apicalmeristem), ATAF1 / 2 (Arabidopsis transcription activation factor), CUC2 (cup-shaped cotyledon)], WRKY, and bZIP (basic leucine zipper)—are involved in biotic and abiotic stress responses (Ng DW, Abeysinghe JK, Kamali M. Regulating the regulators: the control of transcription factors in plant defense signaling. International journal of molecular sciences, 2018, 19 (12): 3737).

[0004] bHLH is one of the largest transcription factor families in plants (Zhang Z, Chen J, Liang C, et al. Genome-wide identification and characterization of the bHLH transcription factor family in pepper). Capsicum annuum L.). Frontiers in Genetics, 2020, 11: 570156), named for the basic helical-loop-helical (bHLH) conserved domain in its protein structure (Wang L, Xiang L, Hong J, et al. Genome-wide analysis of bHLH transcription factorfamily reveals their involvement in biotic and abiotic stress responses in wheat ( Triticum aestivumL.). 3 Biotech, 2019, 9 (6): 236). A typical bHLH contains a highly conserved bHLH domain of about 60 amino acids, which has two functionally distinct regions: a basic region on the N-terminus and an HLH region on the C-terminus (Carretero-Paulet L, Galstyan A, Roig-Villanova I, et al. Genome-wide classification and evolutionary analysis of the bHLH family of transcription factors in Arabidopsis, poplar, rice, moss, and algae. PlantPhysiology, 2010, 153 (3): 1398-1412). The basic region, consisting of 13-17 amino acids, is involved in DNA binding (Blanc-Mathieu R, Dumas R, Turchi L, et al. Plant-TFClass: a structural classification for plant transcription factors. Trends in Plant Science, 2024, 29 (1): 40-51). bHLH regions are typically composed of two amphiphilic α-helices separated by variable loops, and the formation of homologous and / or heterodimers between bHLH proteins is mediated by hydrophobic contacts between the helices (Pires N, Dolan L. Origin and diversification of basic-helix-loop-helix proteins in plants. Molecular Biology Evolution, 2010, 27 (4): 862-874).

[0005] The bHLH family has been shown to be important regulators of plant defense responses. bHLH transcription factors regulate plant defense responses by modulating the biosynthesis of secondary metabolites, such as flavonoids, anthocyanins, glucosinolates, diterpenoid phytoalexins, and saponins (Meraj TA, Fu J, Raza MA, et al. Transcriptional factors regulate plant stress responses through mediating secondary metabolism. Genes(Basel), 2020, 11(4): 346). Chrysanthemum CmbHLH18 Heterologous overexpression of [the gene] enhances Arabidopsis resistance to necrotrophic fungi by increasing callose deposition, preventing spore entry into leaves, reducing ROS accumulation, increasing the activity of antioxidant and defense enzymes, and promoting the expression of resistance-related genes (Ding Y, Wang X, Wang D, et al. Identification of CmbHLH transcription factor family and excavation of [the gene]). CmbHLHs resistant tonecrotrophic fungus Alternaria in Chrysanthemum Genes (Basel), 2023, 14 (2):275). Transcription factors GhPAS1 Silencing of GhPAS1 increases susceptibility to Verticillium wilt in cotton, while overexpression of GhPAS1 increases resistance to Verticillium dahliae (Zhang J, Gu M, Wu H, et al. GhPAS1, a bHLH transcription factor in upland cotton). Gossypium hirsutum ), positively regulates Verticillium dahlia resistance. Industrial Crops and Products, 2023, 192:116077).

[0006] Sanqi [ Panax notoginseng (Burk.) FH Chen] is a member of the Araliaceae family ( Araliaceae) Ginseng ( Panax This perennial herb is a traditional and precious medicinal material in my country, with effects such as promoting blood circulation, removing blood stasis, reducing inflammation, and relieving pain (Xie W, Meng X, Zhai Y, et al.). Panax Notoginsengsaponins: A review of its mechanisms of antidepressant or anxiolytic effects and network analysis on phytochemistry and pharmacology. Molecules, 2018, 23 (4): 940). However, Panax notoginseng has a long growth cycle and is susceptible to various diseases during cultivation, especially by Fusarium solani (…). Fusarium solani Root rot caused by fungi such as _____, severely reduces the yield and quality of Panax notoginseng (Fan ZY, Miao CP, Qiao XG, et al. Diversity, distribution, and antagonistic activities of rhizobacteria of _____). Panax notoginseng Journal of Ginseng Research, 2016, 40 (2): 97-104. Currently, there is a lack of highly resistant and stable Panax notoginseng varieties in production. Transcription factors of the bHLH family play an important role in plant defense responses, therefore, the discovery and functional analysis of bHLH genes in Panax notoginseng have important research and application value. Summary of the Invention

[0007] This invention provides a Panax notoginseng bHLH transcription factor gene. PnbHLH2 Its application in improving tobacco resistance to Fusarium oxysporum, Fusarium oxysporum, Pythium spp. and Cyclospora spp.

[0008] This invention clones transcription factor genes from Panax notoginseng. PnbHLH2 , PnbHLH2 The nucleotide sequence is shown in SEQ ID NO:1. The open reading frame of this gene is 408 bp, encoding a protein with the amino acid sequence shown in SEQ ID NO:2.

[0009] This invention isolates and clones transcription factor genes from Panax notoginseng. PnbHLH2 The complete cDNA fragment was obtained using Agrobacterium tumefaciens (Gastrointestinal rust) Agrobacterium tumefaciens The inventors mediated the transfer of the target gene into recipient plants and overexpressed it. Further experiments were conducted to verify whether this gene could enhance the plant's antifungal activity, laying the foundation for future applications in improving the resistance of tobacco and other plants to fungal diseases. The gene was named... PnbHLH2 .

[0010] The above PnbHLH2The gene was applied to improve tobacco's resistance to Fusarium oxysporum, Fusarium oxysporum, Pythium spp., and Cyclospora destructosa. The specific operation is as follows:

[0011] (1) Amplification PnbHLH2 Using specific primers, total RNA was extracted from Panax notoginseng roots and amplified by reverse transcription-polymerase chain reaction (RT-PCR). PnbHLH2 The coding region was then ligated into the pGEM-T vector, and clones containing the target gene were obtained by sequencing.

[0012] (2) Using restriction endonucleases Eco RI and Bam HI enzyme digestion of pGEM-T- PnbHLH2 The target gene fragment was obtained by gel extraction from the vector. The plant expression vector pCAMBIA2300S was digested with the same restriction enzyme, and the desired large vector fragment was obtained by gel extraction. The obtained fragment was then... PnbHLH2 The gene fragment was linked with the pCAMBIA2300S fragment to construct a plant overexpression vector, and then the constructed recombinant vector was transformed into tobacco for expression via Agrobacterium tumefaciens.

[0013] (3) Transformants were screened using the resistance markers on the recombinant vector T-DNA, and real transgenic plants were obtained by PCR detection. The ability of transgenic plants to resist fungal infection was analyzed, and finally transgenic plants with significantly enhanced resistance to Fusarium oxysporum, Fusarium oxysporum, Pythium spp. and Pythium spp. were screened.

[0014] This invention provides a novel method for improving plant resistance to fungal diseases. By using genetic engineering to cultivate disease-resistant plants, it overcomes the shortcomings of traditional breeding methods, shortening the breeding cycle, simplifying the process, and making it easier to obtain highly resistant materials. This invention originates from Panax notoginseng. PnbHLH2 The gene can enhance plant resistance to Fusarium oxysporum, Fusarium oxysporum, Pythium spp., and Strombocytosporum toxinii. Introducing this gene into tobacco can produce new varieties and materials with fungal resistance. The use of genetic engineering technology to cultivate resistant plant varieties and materials has significant advantages and irreplaceable importance; it not only facilitates large-scale production of crops, medicinal herbs, and horticultural plants, greatly reducing the use of chemical pesticides, but also saves costs in agricultural production and reduces environmental pollution. Therefore, this invention has broad market application prospects. Attached Figure Description

[0015] Figure 1 This is the present invention. PnbHLH2The image shows the PCR detection results of genomic DNA from transgenic tobacco. The marker in the image is the DL2000 DNA Marker (Takara Bio Engineering (Dalian) Co., Ltd., China), which consists of five DNA fragments: 2,000 bp, 1,000 bp, 750 bp, 500 bp, and 250 bp. The positive control is plasmid pGEM-T- PnbHLH2 The negative control is the PCR product with sterile water as the template; the WT is the PCR product with total DNA from non-transgenic tobacco (wild type) as the template.

[0016] Figure 2 This is a partial positive in the present invention. PnbHLH2 In genetically modified tobacco PnbHLH2 The graph shows the expression analysis results at the transcriptional level, where WT represents non-transgenic tobacco (wild type), and 2-1, 2-4, 2-7, 2-9, 2-10, 2-12, 2-14, 2-17, 2-18, 2-19, 2-20, and 2-21 represent... PnbHLH2 Genetically modified tobacco;

[0017] Figure 3 This is the present invention. PnbHLH2 Figures showing the results of disease resistance identification in transgenic tobacco: Figure a shows tobacco leaves inoculated with *Fusarium oxysporum*; Figure b shows tobacco leaves inoculated with *Fusarium oxysporum*; Figure c shows tobacco leaves inoculated with *Pseudomonas aeruginosa*; Figure d shows tobacco leaves inoculated with *Corylus demiseus*; WT represents wild-type tobacco; 2-4, 2-9, and 2-17 are respectively... PnbHLH2 Transgenic tobacco strains. Detailed Implementation

[0018] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. However, the scope of protection of the present invention is not limited to the contents described. Unless otherwise specified, the methods in the embodiments are conventional methods, and the reagents used are conventional commercial reagents or reagents prepared according to conventional methods unless otherwise specified.

[0019] Example 1: PnbHLH2 Gene cloning and sequence analysis

[0020] The roots of Panax notoginseng, inoculated with Fusarium oxysporum for 12 hours, were ground into powder using liquid nitrogen and then transferred to centrifuge tubes. Total RNA was extracted using the guanidine isothiocyanate method and analyzed using GoScript. TMThe Reverse Transcriptase System synthesizes the first strand of cDNA using total RNA as a template. The reaction system and procedure are as follows: Take 5 μg of total RNA, add 1 μL of Oligo dT15 primer and 1 μL of Random primer, and bring the reaction volume to 10 μL with Nuclease-Free Water; mix well, heat at 70℃ for denaturation for 5 min, and then rapidly cool on ice for 5 min. Then add 4 μL of 5×Reaction Buffer, 4 μL of MgCl2 (25 mM), 1 μL of PCR Nucleotide Mix, and 0.4 μL of Recombinant RNasin. ® Ribonuclease inhibitor, 0.4 μL reverse transcriptase, and 1.2 μL nuclease-free water were mixed, briefly centrifuged, incubated at 25°C for 5 min, and then incubated at 42°C for 1.5 h. The reaction was terminated by heating at 70°C for 10 min after removal. The synthesized first strand of cDNA was stored at -20°C for later use.

[0021] Using the synthesized first-strand cDNA as a template, the target gene is amplified. PnbHLH2 The upstream and downstream primer sequences used were 5'ATGATGGAACATAAAAGAAGCCCC3' and 5'GTATTTGGGGGAAGTAGTCTTGATAG3', respectively. The target gene was amplified using TAKARA ExTaq®. The PCR reaction conditions were 94℃ for 5 min, 94℃ for 30 s, 57℃ for 30 s, and 72℃ for 30 s (32 cycles), followed by 72℃ for 5 min. The reaction volume (50 μL) consisted of 2 μL cDNA and 5 μL 10×Ex Taq Buffer (containing Mg). 2+ The PCR mixture consisted of 20 mM dNTPs, 4 μL of dNTP Mix (2.5 mM each), 1 μL of upstream primer (5 μM), 1 μL of downstream primer (5 μM), 0.25 μL of TaKaRa Ex Taq (5 U / μL), and 36.75 μL of ddH2O. After PCR, 8 μL of the mixture was subjected to 1.2% agarose gel electrophoresis to detect the specificity and size of the amplified products.

[0022] The obtained PCR product contained only one DNA band. The PCR amplification product was recovered by gel extraction using the SanPrep column-based PCR product purification kit (Shanghai Sangon Biotech). TA cloning was then performed using pGEM-T Vector System I (TaKaRa). The reaction system and procedure were as follows: 4 μL of PCR product was added sequentially to 0.7 μL of pGEM-T vector, 0.9 μL of T4 DNA Ligase, and 5 μL of 2×Rapid Ligation Buffer. After mixing, the mixture was incubated overnight at 16°C. The ligation product was then transformed into *E. coli* DH5α using the heat shock transformation method. Positive clones were screened using LB solid medium containing ampicillin (Amp). Several single colonies were selected, shaken, and then amplified. PnbHLH2 Specific primers were used to identify the inserted... PnbHLH2 The identified clones were sequenced, and the final results were obtained. PnbHLH2 The full-length cDNA is 408 bp (see SEQ ID NO:1), encoding a protein containing 135 amino acids with a molecular weight of approximately 14.88 kDa and an isoelectric point of approximately 9.67. Analysis was performed using the bioinformatics software SignalP 4.1. PnbHLH2 The encoded protein sequence was analyzed to determine if it contained a signal peptide; the results showed that the gene... PnbHLH2 There is no signal peptide, and subcellular localization predicts that it is located in the cell nucleus.

[0023] Example 2: Construction of plant overexpression vectors

[0024] pGEM-T- was extracted using the SanPrep column-based plasmid DNA mini-extraction kit (Sangon Biotech (Shanghai) Co., Ltd., China). PnbHLH2 The plant expression vector pCAMBIA2300S plasmid was also used; 1 μL was used for agarose gel electrophoresis to detect the integrity and concentration of the extracted plasmid. Restriction endonucleases were then used... Eco RI (TaKaRa, Japan) and Bam HI (TaKaRa, Japan) separately tested plasmid pGEM-T- PnbHLH2 Double digestion with pCAMBIA2300S (50 μL system) was performed. The reaction system and operation procedure were as follows: Take 20 μL of pGEM-T- PnbHLH2 Alternatively, add pCAMBIA2300S plasmid, followed by 7.5 μL of 10×K buffer and 2.5 μL of... Eco RI, 2.5 μL BamAdd HI and 17.5 μL ddH2O, mix well, centrifuge briefly, and incubate at 37℃ for 3 h for enzyme digestion. Spot all digestion products onto an agarose gel for electrophoresis, then... PnbHLH2 The fragments and the large fragment of the pCAMBIA2300S vector were separately recovered by gel electrophoresis using the SanPrep DNA Gel Extraction Kit (Sangon Biotech (Shanghai) Co., Ltd., China). 1 μL of the recovered product was analyzed by agarose gel electrophoresis to determine the size and concentration of the recovered fragments, and then stored at -20℃ for later use.

[0025] Using T4 DNA Ligase (TaKaRa, Japan), the recovered DNA was... PnbHLH2 The DNA fragment and the pCAMBIA2300S vector fragment were ligated. The reaction system (20 μL) and the operation procedure were as follows: Take 10 μL... PnbHLH2 The DNA fragment was added sequentially with 2 μL pCAMBIA2300S vector DNA, 2 μL 10×T4 DNA Ligase Buffer, 1 μL T4 DNA Ligase, and 5 μL ddH2O. After mixing, the mixture was briefly centrifuged and then incubated overnight at 16°C. The ligation product was then transformed into *E. coli* DH5α using a heat shock transformation method. Positive clones were screened using solid medium containing 50 mg / L kanamycin (Km). Single colonies were selected and cultured, and the bacterial culture was used as a template for amplification. PnbHLH2 PCR was performed using specific primers to select... PnbHLH2 Clones that have been successfully ligated to pCAMBIA2300S, if the tested strain is positive, add glycerol and store at -80℃ for later use.

[0026] Extract and purify pCAMBIA2300S- from the above-mentioned Escherichia coli. PnbHLH2 Plasmid. The constructed plant expression vector pCAMBIA2300S- was then frozen and thawed in liquid nitrogen. PnbHLH2 Transfected into Agrobacterium tumefaciens LBA4404 competent cells. The procedure was as follows: Take 2 μg of pCAMBIA2300S- PnbHLH2 The plasmid was added to a centrifuge tube containing 100 μL of competent cells, gently mixed, and incubated on ice for 5 min. Then, it was transferred to liquid nitrogen and frozen for 5 min, followed by an immediate 37°C water bath for 5 min, and then immediately incubated on ice for 5 min. 800 μL of LB broth was added, and the cells were incubated at 28°C with shaking for 2-3 h. The activated Agrobacterium was plated on LB solid medium containing 50 mg / L Km and incubated statically at 28°C. Single colonies were selected and shaken for further amplification. PnbHLH2 PCR was performed using specific primers to detect pCAMBIA2300S- PnbHLH2To determine whether to transfer the clone into Agrobacterium, for positive clones, add glycerol and store at -80°C for later use.

[0027] Example 3: Agrobacterium-mediated plant genetic transformation and screening of transgenic plants

[0028] The transgenic recipient in this experiment was tobacco. Tobacco seeds were soaked in 75% alcohol for 30 seconds, washed with sterile water, soaked in 0.1% HgCl2 for 8 minutes, washed several times with sterile water, sown on 1 / 2 MS medium, and cultured in the dark at 28℃ for 6 days. After germination, they were transferred to a light incubator (25℃, 16 h / d light). Subcultured monthly on 1 / 2 MS medium thereafter.

[0029] Removed from a -80℃ freezer containing pCAMBIA2300S- PnbHLH2 Agrobacterium LBA4404, containing plasmids, was inoculated into 5 mL of LB liquid medium containing 50 mg / L Km and 20 mg / L rifampin, and cultured at 28°C until the medium became turbid. 1 mL of the turbid bacterial culture was transferred to LB solid medium containing 50 mg / L Km and cultured at 28°C for 48 h. Subsequently, an appropriate amount of Agrobacterium was scraped from the LB solid medium and inoculated into MGL liquid medium supplemented with 20 mg / L acetylsyleugenol, and cultured at 28°C with shaking for 2–3 h to activate the Agrobacterium.

[0030] Take leaves from sterile tobacco seedlings and cut them into 1 cm pieces. 2 The leaf discs on both sides were completely immersed in the MGL liquid medium containing activated Agrobacterium for 15 min. The bacterial solution on the leaf surface was then blotted dry with sterile filter paper. The leaf discs were then placed on a co-culture medium for room temperature incubation. The co-culture medium for tobacco transformation was MS + 0.02 mg / L 6-BA + 2.1 mg / L NAA + 30 g / L sucrose + 6 g / L agar. The mixture was incubated in the dark at 22°C for 2 days.

[0031] After co-culture, the leaf discs were transferred to MS selection medium supplemented with antibiotics for differentiation into seedlings, and transgenic plants were screened simultaneously. The tobacco selection medium consisted of MS medium supplemented with 0.5 mg / L 6-BA, 0.1 mg / L NAA, 30 g / L sucrose, 6 g / L agar, 50 mg / L Km, and 200 mg / L cefotaxime sodium salt (Cef). During selection culture, the culture flasks were transferred to a light incubator (25℃, 16 h / d light, 8 h / d dark). After the tobacco plants sprouted, they were subcultured on MS medium containing 50 mg / L Km and 200 mg / L Cef. The regenerated tobacco seedlings were then transferred to MS medium containing 50 mg / L Km to allow rooting. Finally, the best-rooted regenerated seedlings were selected for PCR detection.

[0032] Genomic DNA was extracted from the leaves of transgenic tobacco plants using the CTAB method. 1 μL of the extracted genomic DNA was analyzed for integrity and concentration by agarose gel electrophoresis. The genomic DNA from the transgenic plants was then used as a template for amplification. PnbHLH2 PCR was performed using specific primers. After PCR, 8 μL of the product was used for agarose gel electrophoresis to detect positive transgenic plants. The amplification results of some tobacco transgenic plants are shown below. Figure 1 As shown, a total of 19 positive transgenic plants were screened.

[0033] Example 4: In genetically modified tobacco PnbHLH2 Expression analysis

[0034] Total RNA was extracted from young leaves of positive transgenic plants and non-transgenic tobacco (wild type), respectively. The RNA was reverse transcribed to generate the first strand of cDNA, which was then used as a template for amplification. PnbHLH2 Real-time quantitative PCR (qPCR) was performed using specific primers, and the results of qPCR were analyzed in each transgenic plant. PnbHLH2 The expression levels at the transcriptional level were as follows; the methods for total RNA extraction and reverse transcription were the same as in Example 1; the qPCR system consisted of 1.0 μL cDNA, 10 μL 2×Go Taq® qPCR Master Mix, 0.2 μL CXRReference Dye, 7.6 μL RNase-Free ddH2O, 0.6 µL Primer QF (10 mM), and 0.6 µL Primer QR (10 mM). The qPCR reaction was performed using the following parameters: 95℃ for 2 min; 95℃ for 5 s; 60℃ for 30 s (40 cycles). Each sample's qPCR reaction was repeated three times. PnbHLH2 The expression level is 2 -ΔΔCt The calculation method yielded the following results for some individual plants:Figure 2 As shown.

[0035] Example 5: PnbHLH2 Functional analysis of transgenic tobacco against fungal infection

[0036] Laboratory-preserved *Fusarium oxysporum*, *Fusarium oxysporum*, *Pythium spp.*, and *Cyclophorus demiseus* were inoculated onto PDA solid medium (200 g / L potato / carrot, 15 g / L agar, 20 g / L glucose) and incubated in the dark at 28°C for 7 days. Well-grown, uniformly sized, and fully extended WT tobacco plants from a greenhouse were also inoculated. PnbHLH2 Transgenic tobacco leaves were cut from the petiole using surgical scissors. Using a sterile plastic pipette tip, uniformly sized wounds were made at approximately the same location on the leaf. Equal-sized mycelial blocks of *Fusarium oxysporum*, *Fusarium oxysporum*, *Pythium spp.*, and *Corylus demiseus* were inoculated. The inoculated leaves were placed on filter paper moistened with sterile water and incubated in a 28°C light incubator, with sterile water added daily to maintain humidity. After 7 days of incubation, the leaves were collected, and the disease incidence of each strain was observed. Results are as follows: Figure 3 As shown, after inoculation with *Fusarium oxysporum*, *Fusarium oxysporum*, *Pseudomonas aeruginosa*, and *Corylus demiseus*, respectively, wild-type tobacco leaves developed large lesions, while transgenic tobacco leaves showed very mild symptoms, and the lesion area was much smaller than that of wild-type tobacco. Clearly, PnbHLH2 Genetically modified tobacco exhibits significant resistance to Fusarium oxysporum, Fusarium oxysporum, Pythium spp., and Strombocytozoon.

Claims

1. A Panax notoginseng bHLH transcription factor gene PnbHLH2 To improve the resistance of tobacco to Fusarium oxysporum (Brick Red Fusarium) Fusarium brick Fusarium rosenbergii ( ), Fusarium incarnate ), brown-black humic mold ( Humicola fuscoatra ) and Destructive Columnar Spore ( Cylindrocarpon destructans Its application in resistance is characterized by: Panax notoginseng bHLH transcription factor gene PnbHLH2 The nucleotide sequence is shown in SEQ ID NO:1.