A haplotype molecular marker chr19_156236840 related to peanut oil content and application thereof

Abstract

This invention discloses a haplotype molecular marker Chr19_156236840 related to peanut oil content and its application, belonging to the field of marker-assisted breeding. The nucleotide sequence of the haplotype molecular marker Chr19_156236840 is shown in SEQ ID NO.1. A G / T polymorphism exists at base 99, including two haplotypes: Chr19_156236840-G and Chr19_156236840-T. Homozygous lines containing the Chr19_156236840-G haplotype have significantly higher seed oil content than homozygous lines containing the Chr19_156236840-T haplotype. Using this haplotype molecular marker to detect peanut germplasm seedling materials allows for accurate and efficient prediction of seed oil content without waiting for peanut fruiting, greatly improving the selection efficiency of peanut breeding.

Description

Technical Field

[0001] This invention relates to the field of marker-assisted breeding, and in particular to a haplotype molecular marker Chr19_156236840 related to peanut oil content and its application. Background Technology

[0002] As an important oilseed crop, the oil content of peanuts (Arachis hypogaea L.) is a key target trait for genetic improvement.

[0003] Molecular marker-assisted selection technology provides a new approach for breeding high-oil-content peanuts. Early genotyping can be achieved through leaf DNA analysis at the seedling stage, but current technologies have not yet established haplotype combinations significantly associated with oil content. Currently available commercial gene chips lack specific marker sites for peanut oil content traits, making it difficult to meet the needs of precision breeding.

[0004] The current genetic improvement of peanut oil content faces the following technical bottlenecks: (1) lack of molecular markers closely linked to the high oil content trait; (2) no high-density haplotype map covering the entire genome has been constructed; and (3) existing detection methods cannot achieve rapid and accurate prediction of oil content at the seedling stage. These problems seriously restrict the breeding efficiency of high-oil peanut varieties.

[0005] Therefore, developing novel molecular marker systems and establishing efficient and accurate methods for early prediction of oil content are of great significance for accelerating the breeding process of high-oil-content flowers. Summary of the Invention

[0006] The purpose of this invention is to provide a haplotype molecular marker Chr19_156236840 related to peanut oil content and its application, in order to solve the problems existing in the prior art. By using the haplotype molecular marker provided by this invention to detect peanut germplasm seedling materials, the oil content of seeds can be accurately and efficiently predicted without planting and waiting for peanut fruit, greatly improving the selection efficiency of peanut seed production.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] This invention provides a haplotype molecular marker Chr19_156236840 related to peanut oil content. The nucleotide sequence of the haplotype molecular marker Chr19_156236840 is shown in SEQ ID NO.1. There is a G / T polymorphism at the 99th base of its sequence, including two haplotypes: Chr19_156236840-G and Chr19_156236840-T.

[0009] The present invention also provides the application of the reagent for detecting the haplotype molecular marker Chr19_156236840 in identifying the oil content of peanut seeds.

[0010] Optionally, if the peanut to be tested is detected to be a homozygous line containing the Chr19_156236840-G haplotype, then the peanut to be tested is a high-oil-content peanut.

[0011] If the peanut to be tested is detected to be a homozygous line containing the Chr19_156236840-T haplotype, then the peanut to be tested is a low-oil-content peanut.

[0012] The present invention also provides the application of reagents for measuring the haplotype molecular marker Chr19_156236840 in the early prediction of oil content in peanut seeds.

[0013] Optionally, the leaves of the early-stage peanut plants to be tested are examined. If the leaves are found to be homozygous lines containing the Chr19_156236840-G haplotype, then the peanut to be tested is predicted to be a high-oil-content peanut.

[0014] If the leaf is detected to be a homozygous line containing the Chr19_156236840-T haplotype, then the peanut to be tested is predicted to be a low-oil-content peanut.

[0015] The present invention also provides the application of the reagent for detecting the haplotype molecular marker Chr19_156236840 in the molecular marker-assisted breeding of high oil content peanuts.

[0016] Optionally, the leaves of the early-stage peanut plants to be tested are examined. If the leaves are found to be homozygous lines containing the Chr19_156236840-G haplotype, then the peanut to be tested is predicted to be a high-oil-content peanut.

[0017] If the leaf is detected to be a homozygous line containing the Chr19_156236840-T haplotype, then the peanut to be tested is predicted to be a low-oil-content peanut.

[0018] Homozygous lines containing the Chr19_156236840-G haplotype were selected for cultivation.

[0019] Optionally, the reagent includes primers for amplifying the haplotype molecular marker Chr19_156236840.

[0020] Optionally, the primers include KASP primers, which consist of upstream primer F1 as shown in SEQ ID NO.2, upstream primer F2 as shown in SEQ ID NO.3, and a universal downstream primer as shown in SEQ ID NO.4.

[0021] The present invention discloses the following technical effects:

[0022] This invention is the first to develop and obtain a haplotype molecular marker Chr19_156236840 related to peanut oil content. By using this haplotype molecular marker to detect peanut germplasm seedling materials, the oil content of the seeds can be accurately and efficiently predicted without planting and waiting for peanuts to bear fruit, which greatly improves the selection efficiency of peanut seedlings.

[0023] The SNP sites of this invention are clearly located, unaffected by the environment, more targeted, require less actual detection work, are more efficient, and have lower costs, which is of great significance for accelerating the breeding process of high-oil-yielding flowers. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 Phenotypes of 184 peanut germplasms;

[0026] Figure 2 The distribution of significant SNP sites identified by GWAS on 20 chromosomes;

[0027] Figure 3 This is a schematic diagram of the Venn diagram, where A represents the co-localization of significant sites of linoleic acid, oil content, oleic acid, and palmitic acid, and B represents the co-localization of significant sites of amino acids, leucine, methionine, threonine, and proteins.

[0028] Figure 4 GWAS localization (A) of peanut seed oil content and LD-block analysis diagram linked to screening sites;

[0029] Figure 5 Here is a diagram of the AhZT2LDC gene structure;

[0030] Figure 6 The differences in oil content (A), amino acid content (C), and protein content among different haplotypes of Chr19_156236840 are shown. "***" indicates a significant difference between the two haplotypes (P<0.001). Detailed Implementation

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0033] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0034] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0035] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0036] Example 1: Major-effect QTL localization and haplotype identification

[0037] 1. Biomaterials and phenotypic analysis

[0038] Of the 184 peanut germplasm accessions from both domestic and international sources, 119 represent varieties from 13 provinces and regions including Shandong, Henan, Guangdong, and Fujian; 47 were preserved by the Germplasm Resources Institute of Shandong Academy of Agricultural Sciences, and 18 were introduced varieties from countries such as the United States and India.

[0039] The 184 domestic and foreign peanut germplasm accessions collected were used as natural populations. Figure 1The genotype of this natural population in 2018 and 2022 was obtained using a near-infrared spectroscopy system, including information on 19 traits such as fatty acid content (including oil content, protein content, 6 fatty acids, and 11 amino acids). Thirteen traits showed a normal or near-normal distribution (arachidic acid, behenic acid, stearic acid, protein, amino acids, proline, histidine, valine, isoleucine, threonine, arginine, lysine, and phenylalanine); six traits showed a skewed distribution (oil content, oleic acid, linoleic acid, palmitic acid, histidine, and methionine) (Table 1). The genotype of this population was determined using the Affymetrix 'Axiom_Arachis2' 48K SNP array chip.

[0040] Table 1. Variation of fatty acids and amino acids in 1184 peanut varieties

[0041]

[0042] 2. SNP screening

[0043] Using genotype and phenotype information, 91 SNPs significantly associated with 19 phenotypes were identified by GWAS, of which 39 SNPs were associated with at least two traits. These significant SNPs were distributed across 20 chromosomes, as shown in Table 2.

[0044] Table 2 shows the SNPs that significantly associated with 19 traits, including fatty acids and amino acids, as determined by GWAS.

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052] Figure 2 The distribution of significant SNP sites identified by GWAS across the 20 chromosomes was further shown, by Figure 2 As shown in Table 2, chromosomes 13, 19, and 9 contain the most significant SNPs, with 41, 29, and 24 respectively. In contrast, chromosome 15 has only one significant SNP.

[0053] Seventeen SNPs co-localized with oleic acid, linoleic acid, and palmitic acid traits, with phenotypic variance explained (Marker R2) ranging from 6.1% to 14.2%, and -log(p) values ​​ranging from 3.02 to 5.30 (Table 2). Figure 3 (A). Eight SNPs co-localized with protein and amino acid traits, with effect sizes ranging from 6.2% to 14.3% and -log(p) values ​​between 3.00 and 5.28 (Table 2). Figure 3 (B). Thirteen SNPs were associated with both fatty acid and amino acid traits, with effect sizes ranging from 6.1% to 18.5% and -log(p) values ​​between 3.01 and 5.17. Furthermore, significant SNPs co-located with oil content and palmitic acid had effect sizes ranging from 8% to 9.4% and -log(p) values ​​between 3.10 and 3.51 (Table 2). Figure 3 ).

[0054] Figure 4 This shows a GWAS mapping of peanut seed oil content. Figure 5 The results showed that three SNPs on chromosomes chr01 and chr19 were associated with peanut seed oil content, but the markers AX-176816934 and AX-176793317 were located in the intergenic region, while the marker AX-177638375 was located 41 bp downstream of the AhZT2LDC gene. Figure 5 The AhZT2LDC gene encodes a SEC61 transporter protein, which is closely related to lipid metabolism. The AX-177638375 marker may control peanut seed oil content by regulating the expression of the AhZT2LDC gene. This SNP site contains a G / T mutation, with genotypes including CC, CT, and TT. The gene fragment sequence containing this SNP variant site is shown in SEQ ID NO.1 and is designated as the haplotype molecular marker Chr19_156236840.

[0055] SEQ ID NO.1:

[0056] CTTAGTTCTGCTATGTTTCGTCTATTTTGTTTTGTTTTTTTTTTTCCTTCAGTCATCTCTGGGAGCATTACAGTGAGATTTAGAATGTAAAATTTTTA K ACCTCGACACATTGCTTTGATTTAGGATTAAGGACGCAAAAAATTGAGGAATTGCAGTTTTGCTTTTAGACTTTGTTAACCTTGAATTTGGGGAAGGGGTCTG.

[0057] The 99th base of the sequence shown in SEQ ID NO.1 is an SNP site, which exhibits G / T polymorphism.

[0058] 3. Haplotype effect

[0059] To confirm the phenotypic effect of significant SNP sites, haplotype analysis was performed using a natural population consisting of 184 domestic and international peanut germplasms.

[0060] like Figure 6 As shown, this locus contains two haplotypes: Chr19_156236840-G and Chr19_156236840-T. The average oil content of seeds from homozygous lines containing the Chr19_156236840-G haplotype is 52.8%, while the average oil content of seeds from homozygous lines containing the Chr19_156236840-T haplotype is 50.5%. Furthermore, the average amino acid / protein content of seeds from homozygous lines containing the Chr19_156236840-G haplotype is 20.9% / 25.1%, while the average amino acid / protein content of seeds from homozygous lines containing the Chr19_156236840-T haplotype is 23.9% / 27.7%. The homozygous line containing the Chr19_156236840-G haplotype can increase the seed oil content by 2.3%, and the homozygous line containing the Chr19_156236840-T haplotype can increase the seed amino acid / protein content by 3% / 2.6%.

[0061] Example 2: Molecular marker-assisted breeding

[0062] 1. Primer design for amplifying molecular markers

[0063] Design KASP primers to amplify the sequence fragment shown in SEQ ID NO.1. Specific primer information is as follows:

[0064] Upstream primer F1: GAAGGTGACCAAGTTCATGCT GATTTAGAATGTAAAATTTTTAC,SEQ IDNO.2;

[0065] Upstream primer F2: GAAGGTCGGAGTCAACGGAT GATTTAGAATGTAAAATTTTTAT,SEQ IDNO.3;

[0066] Universal downstream primer R: CAGACCCCTTCCCCAAATTCA, SEQ ID NO.4.

[0067] 2. Application of molecular markers

[0068] To verify the practicality of this molecular marker, 166 peanut germplasms were reselected (52 from Shandong, 18 from Zhejiang, 18 from Hebei, 17 from Sichuan, 15 from Jilin, 39 other domestic varieties, and 7 foreign varieties). Genomic DNA was extracted from peanut leaves. The designed amplification primers were used to amplify the peanut germplasms and determine their genotypes. The amplification system was as follows: DNA 1 μL, 2×KASPMaser MIX 5 μL, upstream primer F1 0.1 μL, downstream primer F2 0.1 μL, downstream universal primer R 0.3 μL, ddH2O 3.5 μL. The amplification program was: 94℃ for 15 min; [94℃ for 30 s, 61-55℃ for 60 s (-0.6 rpm per cycle), 20 cycles]; [94℃ for 30 s, 55℃ for 60 s, 26 cycles].

[0069] Meanwhile, the seed oil content of peanut germplasm was measured, and the results are shown in Table 3.

[0070] Table 3. Genotypes at different SNP loci and seed oil content of 3166 peanut germplasms.

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077] Table 3 shows that the oil content of peanut seeds identified as having the GG genotype at the SNP locus (average 55.78% in 2023 and 53.93% in 2024) was significantly higher than that of the TT genotype (average 53.48% in 2023 and 51.49% in 2024). This is consistent with the results of Example 1, demonstrating that the haplotype molecular marker Chr19_156236840 has a high accuracy rate in identifying peanut seed oil content.

[0078] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A haplotype molecular marker Chr19_156236840 related to peanut oil content, characterized in that, The nucleotide sequence of the haplotype molecular marker Chr19_156236840 is shown in SEQ ID NO.

1. There is a G / T polymorphism at the 99th base of the sequence, including two haplotypes: Chr19_156236840-G and Chr19_156236840-T.

2. The application of the reagent for detecting the haplotype molecular marker Chr19_156236840 as described in claim 1 in identifying the oil content of peanut seeds, characterized in that, If the peanut to be tested is detected to be a homozygous line containing the Chr19_156236840-G haplotype, then the peanut to be tested is a high-oil-content peanut. If the peanut to be tested is detected to be a homozygous line containing the Chr19_156236840-T haplotype, then the peanut to be tested is a low-oil-content peanut.

3. The application of the reagent for detecting the haplotype molecular marker Chr19_156236840 described in claim 1 in the early prediction of oil content in peanut seeds, characterized in that, If the leaves of the early-stage peanut plants to be tested are found to be homozygous lines containing the Chr19_156236840-G haplotype, then the peanut to be tested is predicted to be a high-oil-content peanut. If the leaf is detected to be a homozygous line containing the Chr19_156236840-T haplotype, then the peanut to be tested is predicted to be a low-oil-content peanut.

4. The application of the reagent for detecting the haplotype molecular marker Chr19_156236840 described in claim 1 in marker-assisted breeding of high-oil-content peanuts, characterized in that, If the leaves of the early-stage peanut plants to be tested are found to be homozygous lines containing the Chr19_156236840-G haplotype, then the peanut to be tested is predicted to be a high-oil-content peanut. If the leaf is detected to be a homozygous line containing the Chr19_156236840-T haplotype, then the peanut to be tested is predicted to be a low-oil-content peanut. Homozygous lines containing the Chr19_156236840-G haplotype were selected for cultivation.

5. The application according to claim 2, claim 3 or claim 4, characterized in that, The reagents include primers for amplifying the haplotype molecular marker Chr19_156236840.

6. The application according to claim 5, characterized in that, The primers include KASP primers, which consist of upstream primer F1 as shown in SEQ ID NO.2, upstream primer F2 as shown in SEQ ID NO.3, and a universal downstream primer as shown in SEQ ID NO.4.

Images