A auxotrophic strain of Escherichia coli, W12-1ΔmurI, and its application
By constructing the Escherichia coli auxotrophic strain W12-1ΔmurI, the problem of antibiotic dependence in the treatment of bovine mastitis was solved, and the virulence of the strain was reduced while the immune protection effect was enhanced, making it suitable for the modification of bovine mastitis vaccines.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- LINYI UNIVERSITY
- Filing Date
- 2025-04-24
- Publication Date
- 2026-07-17
Smart Images
Figure CN120400004B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and more specifically to a auxotrophic strain of Escherichia coli, W12-1ΔmurI, and its applications. Background Technology
[0002] Mastitis in dairy cows is an inflammation of the mammary gland tissue. It has a high incidence and wide prevalence, significantly limiting the profitability of the dairy industry and the quality of dairy products, and is one of the most serious diseases causing economic losses to the dairy industry. Escherichia coli is a major Gram-negative pathogen causing mastitis in dairy cows, accounting for approximately 35% of cases. It frequently causes severe, acute clinical mastitis, leading to toxic shock and septicemia in some affected cows. Some strains of Escherichia coli can cause persistent intramammary gland infection and chronic mastitis.
[0003] The mainstream treatment for mastitis in dairy cows is the use of antibiotics. However, the long-term and excessive use of antibiotics can lead to bacterial resistance, antibiotic residues in milk, and disruption of the mammary gland flora balance, which in turn seriously affects human health and the healthy development of the dairy farming industry. Currently, safe, effective, and comprehensive vaccines are the primary means of preventing and controlling Escherichia coli-related mastitis in dairy cows. However, although existing vaccines can partially reduce the incidence rate, due to the complexity of the pathogen and limitations in immunization strategies, the overall protective efficiency (50-70%) and coverage rate (<30%) are still not ideal.
[0004] Auxotrophic strains are mutant strains formed by artificially mutating wild-type strains to synthesize genes for specific growth factors. These strains can only grow normally in culture media supplemented with the corresponding growth factor. D-glutamic acid (D-Glu) is an important component of peptidoglycan in bacterial cell walls. The absence of D-Glu inhibits bacterial cell wall synthesis, preventing bacterial replication. D-Glu is found in the cell walls of almost all bacteria, but is almost entirely absent in mammals. Studies have shown that D-Glu in *Escherichia coli* is biocatalyzed by glutamate racemic enzyme (MurI; EC 5.1.1.3). MurI converts L-Glu to D-Glu, which then participates in peptidoglycan synthesis, ultimately forming a complete bacterial cell wall structure that enables normal bacterial growth and reproduction. Deleting the MurI gene in *Escherichia coli* inhibits D-Glu synthesis, preventing its participation in peptidoglycan synthesis and resulting in an incomplete bacterial cell wall structure. This prevents bacterial proliferation and reduces pathogenicity while maintaining the structure and immunity of viable bacteria.
[0005] In summary, how to provide a auxotrophic strain of Escherichia coli that causes mastitis in dairy cows is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0006] In view of this, the present invention provides a auxotrophic strain of Escherichia coli W12-1ΔmurI and its applications.
[0007] To achieve the above objectives, the present invention adopts the following technical solution:
[0008] A strain of Escherichia coli auxotrophic (W12-1ΔmurI), classified as Escherichia coli, was deposited on April 1, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34055. The deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.
[0009] Furthermore, the aforementioned Escherichia coli auxotrophic strain W12-1ΔmurI has a genome size of 4,883,987 bp, a unique plasmid size of 77,976 bp, and acceptable plasmids pKD4, pKD46, pCP20, and pGEN-lux CDABE.
[0010] Furthermore, the aforementioned Escherichia coli auxotrophic strain W12-1ΔmurI lacks the murI gene encoding glutamate racemic enzyme, meaning this strain cannot synthesize D-Glu (D-glutamate) and requires exogenous D-Glu.
[0011] Furthermore, the above-mentioned Escherichia coli auxotrophic strain W12-1ΔmurI was constructed by deleting the gene encoding glutamate racemase in Escherichia coli.
[0012] Furthermore, the construction of the above-mentioned Escherichia coli auxotrophic strain W12-1ΔmurI was carried out using Escherichia coli λRed homologous recombination technology.
[0013] The application of the above-mentioned strains in the preparation of live bacterial vaccines for bovine mastitis.
[0014] Furthermore, the aforementioned bovine mastitis is caused by Escherichia coli.
[0015] A live bacterial vaccine for bovine mastitis, comprising the strains described above.
[0016] As can be seen from the above technical solution, compared with the prior art, the beneficial effects achieved by the present invention are as follows:
[0017] The auxotrophic strain of *Escherichia coli*, a bacterium causing mastitis, provided by this invention is a strain constructed by deleting the D-Glu synthesis gene *murI* from clinically isolated *Escherichia coli*. Compared to the original strain, the auxotrophic strain obtained by this invention exhibits weaker virulence in mice. When the auxotrophic strain of this invention is used to infect the peritoneum and mammary glands of mice, it cannot survive or proliferate in these areas, and does not produce pathological changes, compared to the original strain. This invention has significant value and importance for the modification of bovine mastitis vaccines and the development of live vector vaccines. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0019] Figure 1 This is the complete genome map of Escherichia coli W12-1 in Example 1 of the present invention;
[0020] Figure 2 This is a plasmid map of Escherichia coli W12-1 in Example 1 of the present invention;
[0021] Figure 3 This is a schematic diagram of the λRed homologous recombination technology in Embodiment 2 of the present invention;
[0022] Figure 4 This refers to the first homologous recombination PCR identification result of W12-1ΔmurI::gm in Example 2 of this invention;
[0023] Figure 5 This is the PCR identification result of the Escherichia coli auxotrophic strain W12-1ΔmurI in Example 2 of the present invention;
[0024] Figure 6 The results show the dependence of the Escherichia coli auxotrophic strain W12-1ΔmurI on D-Glu in Example 3 of this invention;
[0025] Figure 7 This is an in vivo virulence test of Escherichia coli auxotrophic strain W12-1ΔmurI and wild-type strain W12-1 in mice in Example 4 of the present invention;
[0026] Figure 8The growth of W12-1ΔmurI-lux obtained after transforming the Escherichia coli auxotrophic strain W12-1ΔmurI into the plasmid pGEN-lux CDABE containing luciferase in Example 5 of the present invention.
[0027] Figure 9 The luminescence of the W12-1ΔmurI-lux and W12-1-lux strains containing luciferase in Example 5 of the present invention is shown in a live imaging system.
[0028] Figure 10 The correlation between luminescence intensity and bacterial quantity of W12-1ΔmurI-lux and W12-1-lux strains containing luciferase in a live imaging system in Example 5 of the present invention.
[0029] Figure 11 This is a dynamic migration diagram of the infection of the auxotrophic strain W12-1ΔmurI-lux containing luciferase and the wild-type strain W12-1-lux in the mammary gland of mice in Example 6 of the present invention.
[0030] Figure 12 This is a diagram showing the immunogenicity of Escherichia coli auxotrophic strain W12-1ΔmurI-lux in mouse mammary glands in Example 7 of the present invention.
[0031] Figure 13 This is a pathological section of the mammary gland of a mouse inoculated with the Escherichia coli auxotrophic strain W12-1ΔmurI in Example 7 of the present invention. Detailed Implementation
[0032] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0033] The reagents required for this invention are conventional experimental reagents, purchased from commercially available channels; the experimental methods not mentioned are conventional experimental methods, and will not be described in detail here.
[0034] Example 1
[0035] Whole genome sequencing of an Escherichia coli strain that causes mastitis in dairy cows (clinically isolated)
[0036] (1) Isolation and identification of Escherichia coli
[0037] Milk samples were collected from dairy cows suffering from mastitis. The samples were inoculated onto eosin methylene blue agar for isolation and culture. After 24 hours of incubation at 37°C, typical colonies with a metallic sheen were selected and transferred to ordinary LB nutrient agar plates for pure culture. Gram staining and microscopic examination of the pure cultures revealed Gram-negative red bacilli. Bacterial genomic DNA was extracted and amplified by PCR using 16S rDNA-specific primers (e.g., 27F / 1492R). The product was purified and sequenced. The sequenced sequences were compared with databases such as NCBI, and based on sequence similarity, the bacterial species was identified as *Escherichia coli*. This strain was named W12-1.
[0038] (2) Whole genome sequencing of Escherichia coli W12-1 in dairy cows (bacterial genome de novo)
[0039] Single colonies of W12-1 were picked from solid culture medium and inoculated into liquid culture. After incubation at 37°C for 12 hours, the bacteria were inoculated into liquid culture medium at a 1% inoculation ratio. The bacteria were allowed to grow to the logarithmic OD phase. 600 The value is approximately 0.8. After centrifugation at 5000 rpm for 15 minutes, bacteria (≥5 × 10⁸) are collected. 8 Three replicates were prepared. Samples were sequenced following the workflow of DNA extraction, library construction, library quality testing, and sequencing. After sequencing, the sequencing data were assembled, and genomic component analysis and gene function analysis were performed to obtain the whole genome map of W12-1 (this bacterium contains one plasmid). The whole genome map is shown below. Figure 1 (Genre size is 4,883,987 bp), plasmid map can be found here. Figure 2 (Plasmid size is 77,976 bp).
[0040] Example 2
[0041] Construction of Escherichia coli auxotrophic strain W12-1ΔmurI
[0042] Primer design: Based on the whole genome sequence of W12-1, the target gene murI was determined. The sequences about 50 bp before and after the gene were selected as homologous fragments for the primers. The upstream and downstream primer sequences of the gentamicin resistance gene were added to the 3' end of the primers, respectively.
[0043] Target gene murI sequence:
[0044] GTGCTGGTGTTTGACTCCGGCGTCGGTGGGTTGTCGGTCTATGACGAGATCCGGCATCTCTTACCGGATCTCCATTACATTTATGCTTTCGATAACGTCGCTTTTCCGTATGGCGAAAAAAGCGAAGAGTTTATTGTTGAGCGAGTGGTGGCAATTGTCACCGCAGTGCAAGAACGTTATCCCCTTGCGCTGGCTGTGGTCGCTTGCAACACCGCCAGTACCGTTTCACTTCCTGCATTACGCGAAAAGTTCGACTTCCCGGTTGTTGGTGTCGTGCCGGCGATTAAACCTGCTGCACGTCTGACGGCAAATGGCATTGTCGGATTACTGGCAACCCGCGGAACTGTTAAACGTTCTTATACTCATGAGCTGATCGCGCGTTTCGCTAATGAATGCCAGATAGAAATGCTGGGCTCGGCAGAGATGGTTGAGTTGGCTGAAGCGAAGCTGCATGGCGAAGATGTTTCTCTGGATGCACTAAAACGTATCCTACGCCCGTGGTTAAGAATGAAAGAGCCGCCAGATACCGTTGTATTGGGTTGCACCCATTTCCCTCTACTACAAGAAGAACTCTTACAGGTGCTGCCAGAGGGAACCCGGCTGGTGGATTCTGGCGCAGCGATTGCTCGCAGAACGGCCTGGCTGTTAGAACATGAAGCTCCGGATGCAAAATCTGCCGATGCGAATATTGCCTTTTGTATGGCAATGACGCCAGAAGCTGAACAATTATTGCCCGTTTTACAGCGTTACGGCTTCGAAACGCTCGAAAAACTGGCAGTTTTAGGCTGA, SEQ ID No.1.
[0045] Upstream primer sequence:
[0046] ACCAAACTGCAGGACGGGAATACACCTTGTCTGGCAGCTACACCT TCTGACCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCAT GAGGAGGCAGATTGCCTTGAAT, SEQ ID No.2.
[0047] Downstream primer sequence:
[0048] GACAAGAGGAAATTTAAAATAATTTTCTGACCGCGCAACATTCAA CCAAAGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCCTATAGTGA GTCGTATTACAGG, SEQ ID No. 3.
[0049] Using plasmid pKD4 (containing the corresponding resistance and FRT sites, which can be recognized by FLP) or its diluted product as a template, and the designed primer pair (long primers) as primers, PCR amplification of the gm resistance gene fragment with FRT flanks was performed using a high-fidelity enzyme. The amplification procedure is as follows: Figure 3 first step.
[0050] W12-1 cells were cultured overnight at 37°C. The following day, they were transferred to LB liquid medium at a ratio of 1:100 and cultured at 37°C and 180 rpm until OD600nm = 0.6–0.8, at which point competent W12-1 cells were prepared. 10 μL of pKD46 plasmid (containing the λRed homologous recombinase system) was electroporated into W12-1 cells to obtain W12-1 / pKD46.
[0051] The overnight culture of W12-1 / pKD46 was transferred to LB liquid medium at a ratio of 1:100 and cultured at 28°C and 180 rpm until OD500. 600nm L-arabinose was added at 0.2–0.4 μmol / L to induce λRed homologous recombination expression. W12-1 / pKD46 competent cells were then prepared. The PCR fragment containing the homologous arms of the FRT-flanked gm resistance gene was electroporated into the cells for infection. The first homologous recombination product of W12-1ΔmurI::gm (containing pKD46) was obtained through screening. PCR identification was performed using primers for the first homologous recombination. Results are shown in [Figure number missing]. Figure 4 , Figure 4 The control group labeled W12-1 is the wild-type control, with an amplification result of approximately 1011 bp; W12-1ΔmurI::gm represents the result of the first homologous recombination, where the murI gene is replaced by the gm gene, and the target fragment is 1900 bp. Figure 4 It is evident that the first homologous recombinant strain W12-1ΔmurI::gm was successfully obtained.
[0052] The primers used for the first homologous recombination identification were:
[0053] Upstream primer: GCTATGATAAGGATTACTCATCTTA, SEQ ID No. 4;
[0054] Downstream primer: TCAGCCTAAAACTGCCAGTTTTTCG, SEQ ID No. 5.
[0055] pKD46 was eliminated from strain W12-1ΔmurI::gm, and competent cells were prepared after elimination. pCP20 (encoding the FLP fragment, which can recognize and excise the FRT fragment, thus completing the deletion of the resistance gene) was transferred into W12-1ΔmurI::gm to obtain W12-1ΔmurI (containing pCP20). The pCP20 plasmid was then eliminated from W12-1ΔmurI containing pCP20. After the pCP20 plasmid elimination was completed, the auxotrophic strain of *Escherichia coli* W12-1ΔmurI was successfully obtained. (See...) Figure 5 , Figure 5 The control group labeled W12-1 is the wild-type control, with an amplification result of approximately 1011 bp. The W12-1ΔmurI strain is the result of the second homologous recombination. After the murI gene was deleted, the amplified fragment was about 300 bp, and the W12-1ΔmurI deletion strain was successfully obtained.
[0056] The same pair of primers were used to identify the first and second homologous recombinations.
[0057] The auxotrophic strain of Escherichia coli, W12-1ΔmurI, classified as Escherichia coli, was deposited on April 1, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34055. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0058] Example 3
[0059] Dependence of Escherichia coli auxotroph strain W12-1ΔmurI on D-Glu
[0060] To verify the auxotrophic phenotype of D-Glu by W12-1ΔmurI, the dependence of W12-1ΔmurI on D-Glu was determined.
[0061] W12-1ΔmurI and W12-1 were inoculated at a rate of 1% (the absorbance OD was measured at 600 nm after inoculation). 600 Approximately 0) were inoculated into LB medium and LB medium containing 10 mM D-Glu, respectively, and then placed in a fully automated microbial growth curve measuring instrument to measure the growth of W12-1ΔmurI and W12-1 in different media within 12 h, in order to evaluate the dependence of W12-1ΔmurI on D-Glu and whether it has a nutritional auxotroph phenotype.
[0062] The results are as follows Figure 6 As shown, the results indicate that W12-1ΔmurI does not grow on LB medium but grows in D-Glu-supplemented medium, while W12-1 grows normally in both media.
[0063] Example 4
[0064] Virulence of Escherichia coli auxotroph strain W12-1ΔmurI in mice
[0065] Single colonies of W12-1 and W12-1ΔmurI were inoculated into LB and LB+D-Glu (10 mM) media, respectively, and cultured at 37°C with shaking at 200 rpm for 10 h before colony counting. Finally, the bacterial concentration of all strains was adjusted to 1×10⁻⁶. 9 CFU / mL, 2.5×10 9 CFU / mL, 5×10 9 CFU / mL and 1×10 10 Four CFU / mL concentration gradients were provided, and the mice were washed three times with sterile saline before each concentration gradient. Healthy BALB / c female mice aged 6–8 weeks were randomly divided into 9 groups (n = 10), with groups 1–4 being the W12-1ΔmurI experimental groups. Each group received an intraperitoneal (ip) injection of 0.1 mL (1 × 10⁻⁶) of different concentration gradients of W12-1ΔmurI. 8 CFU, 2.5×10 8 CFU, 5×10 8 CFU and 1×10 9 CFU (Cellular Fuel Cells) bacterial suspension; groups 5-8 were the W12-1 test groups, receiving intraperitoneal (ip) injections of 0.1 mL (1×10⁻⁶) of different concentration gradients of W12-1. 8 CFU, 2.5×10 8 CFU, 5×10 8 CFU and 1×10 9 The mice were given a bacterial culture containing CFU (cytotoxic urea nitrogen); nine groups served as the control group, receiving the same dose of sterile saline. After injection, the mice's condition and mortality were observed for seven consecutive days to assess the virulence of the strain.
[0066] The results are as follows Figure 7 As shown, strain W12-1 died completely at all injection doses, while W12-1ΔmurI died at 1×10⁻⁶. 9 The strain died at CFU doses but survived at other doses, indicating that the virulence of the auxotrophic strain W12-1ΔmurI was reduced compared to the original strain W12-1.
[0067] Example 5
[0068] Construction of luciferase-containing Escherichia coli auxotroph strain W12-1ΔmurI-lux and luciferase-containing Escherichia coli W12-1-lux
[0069] To perform in vivo imaging of mice, the plasmid pGEN-lux CDABE containing luciferase was introduced into W12-1ΔmurI and W12-1 via electroporation, respectively, to obtain Escherichia coli auxotrophic strains W12-1ΔmurI-lux and W12-1-lux that can bioluminesce under in vivo imaging. The growth of the two strains was then measured.
[0070] The growth patterns of W12-1ΔmurI-lux and W12-1-lux were completely consistent with the original strain W12-1. Figure 8 Both liquid and solid cultures of the strain can be imaged using a live imaging system. Figure 9 ), and established the correlation between bacterial quantity and luminescence intensity ( Figure 10 ).
[0071] Example 6
[0072] Migration of Escherichia coli auxotroph strain W12-1ΔmurI-lux in mice
[0073] Single colonies of W12-1ΔmurI-lux and W12-1-lux were inoculated into LB+D-Glu (10 mM) and LB media, respectively, and cultured at 37°C with shaking at 200 rpm for 10 h before colony counting. The bacterial concentration of all strains was adjusted to 1×10⁻⁶. 9 CFU / mL, rinsed 3 times with sterile saline before inoculation. Lactating BALB / c female mice 8 days postpartum were randomly divided into 3 groups (n=5), one of which was the W12-1ΔmurI-lux experimental group, receiving 50 μl of W12-1ΔmurI-lux injected into each mammary gland (total 1×10⁻⁶). 8 CFU) bacterial suspension; Group 2 was the W12-1-lux experimental group, with 50 μl of W12-1-lux injected into each breast (total 1×10⁻⁶). 8 The mice were given a bacterial culture containing CFU (carbohydrate, hydroxychloroquine, sodium) and three control groups, which received the same dose of sterile saline. The migration of the bacterial strain within the mice was continuously recorded after injection.
[0074] The results are as follows Figure 11 As shown, the bacterial content in the body decreased after infection with W12-1ΔmurI-lux and disappeared after 120 hours; the bacterial content in the body increased after infection with W12-1-lux and died after 48 hours, indicating that W12-1ΔmurI-lux cannot proliferate in the mammary glands of mice and has low virulence.
[0075] Example 7
[0076] Immunoprotection of Escherichia coli auxotroph strain W12-1ΔmurI
[0077] A single colony of W12-1ΔmurI was inoculated into LB+D-Glu (10 mM) medium and cultured at 37°C with shaking at 200 rpm for 10 h before colony counting. Finally, the bacterial concentration was adjusted to 1 × 10⁻⁶. 9 CFU / mL, rinsed 3 times with sterile saline before inoculation. Lactating BALB / c female mice 2 days postpartum were randomly divided into 3 groups (n=5). Groups 1 and 2 were saline control groups, receiving 100 μl of saline intraperitoneally; Group 3 was the W12-1ΔmurI immunization group, receiving 100 μl of saline intraperitoneally (total 1×10⁻⁶ CFU / mL). 8 CFU (Cellular Fuel Cell) bacterial culture. Ten days after inoculation, administer 50 μl of W12-1-lux into each breast (total 1 × 10⁻⁶ cells / mL). 9 High doses of CFU were used to challenge groups 2 and 3, while group 1 was injected with saline as a negative control, to detect whether W12-1ΔmurI had immune protection in addition to low toxicity.
[0078] See results Figure 12 Two groups of mice died within 24 hours after being infected with W12-1-lux; the mice in the W12-1ΔmurI-inoculated experimental group were cleared of W12-1-lux 120 hours after infection, indicating that W12-1ΔmurI has a certain effect on preventing breast infection. The mice in the negative control group were in good condition throughout the process.
[0079] Mammary gland sections were taken from mice 24 hours after viral challenge and infection for pathological examination. Results are shown below. Figure 13 In control group 1, mice injected with saline showed no obvious pathological changes in their mammary glands. In control group 2, mice immunized with saline for 10 days showed obvious pathological changes 24 hours after infection with W12-1. In experimental group 3, mice immunized with W12-1ΔmurI for 10 days showed significantly reduced pathological changes 24 hours after infection with W12-1 compared to control group 2. This indicates that W12-1ΔmurI has a certain mitigating effect on preventing pathological damage from mammary gland infection. (The last sentence appears to be incomplete and possibly refers to a measurement or index.) 9 Under high-dose CFU challenge, none of the five mice in the experimental group died and no pathological changes were observed, resulting in a 100% protection rate.
[0080] The auxotrophic strain of *Escherichia coli*, a bacterium causing mastitis, provided by this invention is a strain constructed by deleting the D-Glu synthesis gene *murI* from clinically isolated *Escherichia coli*. Compared to the original strain, the auxotrophic strain obtained by this invention exhibits weaker virulence in mice. When the auxotrophic strain of this invention is used to infect the peritoneum and mammary glands of mice, it cannot survive or proliferate in these areas, and does not produce pathological changes, compared to the original strain. This invention can be directly used as a candidate vaccine strain and also has significant value and importance for the modification of bovine mastitis vaccines and the development of live vector vaccines.
[0081] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.
[0082] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A strain of Escherichia coli auxotrophic genotype W12-1Δ murI Its characteristics are, Its classification name is Escherichia coli (Escherichia coli) Escherichia coli It was deposited on April 1, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34055 and address at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The glutamate racemic enzyme encoding gene of the strain murI Missing.
2. The use of the strain according to claim 1 in the preparation of a live bacterial vaccine for the prevention or mitigation of bovine mastitis caused by Escherichia coli.
3. The application as described in claim 2, characterized in that, The strain exhibits self-limiting growth within the host.
4. A live bacterial vaccine for the prevention or mitigation of mastitis in dairy cows, characterized in that, Includes the strain described in claim 1 and a veterinary-acceptable carrier or diluent.