Recombinant feline herpesvirus co-expressing feline calicivirus gi, gii and giii group combination antigens, live vector vaccine and application thereof

Abstract

This invention discloses a recombinant feline herpesvirus co-expressing feline calicivirus (FCV) type GⅠ, GⅡ, and GⅢ combined antigens, its live vector vaccine, and its applications, belonging to the fields of animal biological products and virology technology. This invention prepares the feline calicivirus type GⅠ, GⅡ, and GⅢ VP1 combined antigen, the nucleotide sequence of which is shown in SEQ ID NO.7. Recombinant feline herpesvirus rFHV-1-△TK / gI / gE-VP1 is constructed using homologous recombination and CRISPR-Cas9 gene knockout technology. The recombinant feline herpesvirus live vector vaccine constructed in this invention can prevent and control feline calicivirus infection and feline infectious rhinotracheitis, covering FCV type GⅠ, GⅡ, and GⅢ strains, enhancing cross-protection against heterologous FCV strains, overcoming the limited immunoprotection of current vaccines against feline calicivirus and feline herpesvirus, reducing the number of vaccinations and improving immunization efficacy, and has good application prospects.

Description

Technical Field

[0001] This invention relates to the fields of animal biological products and virology, and in particular to a recombinant feline herpesvirus co-expressing combined antigens of feline calicivirus types GⅠ, GⅡ and GⅢ, its live vector vaccine and its application. Background Technology

[0002] Feline calicivirus (FCV), belonging to the Caliciviridae family, is a significant pathogen infecting felines, exhibiting high prevalence and severity. It can cause respiratory symptoms in cats, such as oral ulcers, rhinitis-conjunctivitis, and pneumonia. In addition, highly virulent strains of FCV-VSD, which can cause lameness, abortion, skin edema, skin ulceration, and other systemic organ diseases (VSD) and even death in infected cats, have been reported. The mortality rate of cats infected with these virulent strains ranges from 50% to 100%. FCV is primarily transmitted through contact with infected cats or their secretions, excrement, and contaminated environments (such as cages). Notably, a high carrier rate exists in clinically healthy cat populations; this persistent infection not only provides a hidden route for viral transmission but may also accelerate viral mutation, leading to the emergence of highly lethal strains. Although vaccination remains the core method for preventing FCV infection, the widely used F9 strain attenuated vaccines and IV inactivated vaccines, while effective in reducing disease incidence, still have limitations: first, vaccination cannot completely block viral infection, only alleviating clinical symptoms; second, delayed-onset cases can still be observed in vaccinated cat populations. These characteristics suggest the need for continuous optimization of vaccine strategies to address the challenges of viral mutations.

[0003] The FCV gene is highly variable, classified into GⅠ and GⅡ genotypes. Antigenic differences exist between these two genotypes, resulting in weak cross-neutralization protection and less than ideal vaccine efficacy. Currently, FCV strains include GⅠ, GⅡ, and GⅢ types. The prevalence of different genotypes has also led to the emergence of recombinant strains, further complicating FCV antigenicity and increasing the difficulty of disease control. Since existing imported or domestically produced inactivated FCV vaccines contain only a single FCV strain antigen, their cross-protective effect against heterologous strains is limited. However, combining antigens from different strains can broaden the coverage of FCV strains and provide stronger immunoprotective effects against heterologous strains. Therefore, developing a trivalent vaccine covering GⅠ / GⅡ / GⅢ antigens holds promise for expanding antigenic coverage and improving control efficacy.

[0004] The FCV genome is a single-stranded positive-sense RNA. From the 5' to the 3' end, the genome consists of polyA, ORF1, ORF2, ORF3, and VPg. ORF1, located at the 5' end, primarily encodes non-structural proteins of FCV, mainly including proteases essential for viral replication and proliferation. ORF2 encodes VP1, the major capsid protein of FCV. ORF3 encodes smaller structural proteins. VP1 can be recognized by the host's immune system, inducing the production of neutralizing antibodies in animals, making it an important target for FCV vaccine development, therapeutic formulations, and detection methods. ORF2 can be divided into six functional regions, A through F. Region E contains major B-cell epitopes and is a key target for neutralizing antibodies. The CDE region of the FCV VP1 protein, which includes region E, has been identified as a potential candidate subunit vaccine. However, region C exhibits high variability, especially in the neutralizing epitopes, leading to weak cross-protection between different FCV strains. Using the combination of VP1 protein CDE from GⅠ / GⅡ / GⅢ type FCV strains as an antigen enhances the cross-immunoprotective effect against the three FCV genotypes.

[0005] FCV vaccines are divided into inactivated vaccines and live attenuated vaccines. Inactivated vaccines (IV) primarily stimulate the body's humoral immunity to produce neutralizing antibodies (NAbs), while live attenuated vaccines induce humoral and cellular immunity by mimicking natural infection. However, inactivated vaccines suffer from incomplete inactivation and limited cellular immune response. Existing live attenuated FCV vaccines have safety concerns regarding virulence reversion and are prone to recombination with wild-type FCV strains. Besides humoral immunity-induced virus-neutralizing antibodies, cellular and mucosal immunity play crucial roles in FCV prevention. Therefore, developing a vaccine that can simultaneously stimulate humoral, cellular, and mucosal immunity, while being convenient and safe to use, would effectively address the limited immunoprotective efficacy of current FCV vaccines.

[0006] Feline infectious rhinotracheitis, also known as feline herpesvirus (FHV-1), is a highly contagious disease caused by feline herpesvirus type 1 (FHV-1). Symptoms are characterized by acute upper respiratory tract infections, including keratoconjunctivitis, upper respiratory tract infection, and abortion, but are predominantly upper respiratory symptoms such as sneezing, excessive salivation, and increased ocular and nasal discharge. It is clinically common in cats, with a morbidity rate as high as 100%. The mortality rate varies greatly among cats of different ages; adult cats generally do not die, but the mortality rate in kittens can reach 50%. Infected animals can carry and shed the virus for life and can be repeatedly infected under certain stimuli. It is often co-infected with feline calicivirus. Furthermore, the feline herpesvirus genome is large and has multiple non-essential insertion sites for viral replication, allowing the insertion of various antigen genes. Recombinant attenuated live vaccines using feline herpesvirus as a vector and incorporating other viral immunogens exhibit good safety profiles. In addition to humoral immunity, they elicit strong cellular and mucosal immunity. In particular, activated cellular immunity enhances the body's immune response to exogenous antigens, thus their immunoprotective effect is generally superior to inactivated vaccines. Furthermore, these recombinant feline herpesvirus live vector vaccines are combination vaccines, offering the advantage of protecting against multiple diseases with a single injection, significantly simplifying the immunization schedule and reducing immunization costs and immune stress. However, most current research often involves inserting a single antigen gene into the feline herpesvirus vector, such as a single antigen gene from feline calicivirus, feline leukemia virus, feline HIV, or rabies virus. These recombinant viruses exhibit varying immunoprotective effects against these diseases due to differences in the immunogenicity of the exogenous antigen and the insertion site. The insertion of multiple antigen genes into the feline herpesvirus genome is rare, possibly because the insertion of multiple antigen genes could, to some extent, affect the replication efficiency and stability of the feline herpesvirus. Summary of the Invention

[0007] The purpose of this invention is to provide a recombinant feline herpesvirus co-expressing feline calicivirus GⅠ, GⅡ, and GⅢ type combined antigens, its live vector vaccine, and its application, in order to solve the problems existing in the prior art. This invention constructs a recombinant feline herpesvirus co-expressing feline calicivirus GⅠ, GⅡ, and GⅢ type combined antigens. This recombinant feline herpesvirus lacks the major virulence genes TK, gI, and gE of feline herpesvirus type I, while stably expressing the feline calicivirus GⅠ, GⅡ, and GⅢ type combined antigens. It can be used in vaccine preparation and has good application prospects.

[0008] To achieve the above objectives, the present invention provides the following solution:

[0009] This invention provides a combined antigen of feline calicivirus types GⅠ, GⅡ and GⅢ, the nucleotide sequence of which is shown in SEQ ID NO.7.

[0010] This invention also provides a method for constructing a recombinant feline herpesvirus co-expressing combined antigens of feline calicivirus types GⅠ, GⅡ, and GⅢ, comprising the following steps:

[0011] Homologous arms TKhm1 and TKhm2 of the TK gene of feline herpesvirus were ligated to both sides of the combined antigen genes of feline calicivirus GⅠ, GⅡ and GⅢ types to obtain homologous recombinant plasmids.

[0012] Using primers for the sgRNA of the feline herpesvirus TK, gI, or gE genes, sgRNA expression vectors for the TK, gI, or gE genes were constructed, respectively. The sgRNA expression vectors were then transfected into cells to rescue lentiviruses. The lentiviruses were used to infect cells to obtain stable TK gene knockout cell lines, stable gI gene knockout cell lines, or stable gE gene knockout cell lines.

[0013] The feline herpesvirus was successively infected with gI gene knockout stable cell lines and gE gene knockout stable cell lines to obtain the FHV-1-ΔgI / gE deletion strain.

[0014] Homologous recombinant plasmids were transfected into TK gene knockout stable cell lines, and then the transfected cells were used to infect FHV-1-ΔgI / gE deletion strains to obtain recombinant feline herpesvirus co-expressing feline calicivirus type GⅠ, GⅡ and GⅢ combined antigens;

[0015] The nucleotide sequences of the feline calicivirus GⅠ, GⅡ and GⅢ type combined antigen genes are shown in SEQ ID NO.7;

[0016] The sgRNA primers for the feline herpesvirus TK, gI, or gE genes are shown in SEQ ID NO.16-SEQ ID NO.21.

[0017] The present invention also provides recombinant feline herpesvirus co-expressing feline calicivirus type GⅠ, GⅡ and GⅢ combined antigens obtained according to the construction method described above.

[0018] The present invention also provides the application of the recombinant feline herpesvirus co-expressing feline calicivirus type GⅠ, GⅡ and GⅢ combined antigens in the preparation of a vaccine for the prevention and treatment of feline calicivirus disease.

[0019] The present invention also provides the application of the recombinant feline herpesvirus co-expressing feline calicivirus type GⅠ, GⅡ and GⅢ combined antigens in the preparation of a vaccine for the prevention and treatment of feline infectious rhinotracheitis.

[0020] The present invention also provides a live vector vaccine for the prevention and treatment of feline calicivirus disease and / or feline infectious rhinotracheitis, wherein the live vector vaccine comprises recombinant feline herpesvirus co-expressing feline calicivirus type GⅠ, GⅡ and GⅢ combined antigens.

[0021] Optionally, it also includes auxiliary ingredients.

[0022] The present invention discloses the following technical effects:

[0023] This invention obtains homologous recombinant plasmids by ligating the left and right homologous arms TKhm1 and TKhm2 of the feline herpesvirus TK gene to both sides of the feline calicivirus GⅠ, GⅡ, and GⅢ type combined antigen genes. Based on the sgRNA primers of the feline herpesvirus TK, gI, or gE genes, sgRNA expression vectors for the TK, gI, or gE genes are constructed respectively. Cells are transfected using these sgRNA expression vectors to rescue lentiviruses. Cells are then infected with the lentiviruses to obtain stable TK gene knockout cells. Transfected cell lines, gI gene knockout stable cell lines, or gE gene knockout stable cell lines; feline herpesvirus was successively infected with gI gene knockout stable cell lines and gE gene knockout stable cell lines to obtain FHV-1-ΔgI / gE deletion strain; homologous recombinant plasmid was transfected into TK gene knockout stable cell lines, and then the transfected cells were used to infect the FHV-1-ΔgI / gE deletion strain to construct recombinant feline herpesvirus co-expressing feline calicivirus type GⅠ, GⅡ, and GⅢ combined antigens.

[0024] This invention constructs a live vector vaccine based on recombinant feline herpesvirus (FCV) co-expressing combined antigens of feline calicivirus types GⅠ, GⅡ, and GⅢ, expanding the coverage of antigens against different FCV genotypes and improving cross-immunoprotection against heterologous strains or strains of different genotypes. This addresses the challenge of FCV mutations. In immunized animals, this recombinant live vector vaccine induces good humoral, cellular, and mucosal immune responses, compensating for the deficiency of conventional inactivated vaccines in effectively activating cellular immunity. The live vector vaccine obtained by this invention (rFHV-1-ΔTK / gI / gE-VP1 CDE) possesses the characteristics of a feline herpesvirus type I attenuated vaccine strain and can be used as a bivalent live vector vaccine for the prevention and control of feline calicivirus disease and feline infectious rhinotracheitis. It can significantly reduce the number of immunizations required for cats, lower immunization costs, and is of great significance for improving the economic benefits of cat ownership and pet welfare, showing promising application prospects. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 Nucleotide phylogenetic tree of VP1 of FCV strains GⅠ, GⅡ, and GⅢ;

[0027] Figure 2Amino acid phylogenetic tree of FCV strains VP1 of types GⅠ, GⅡ, and GⅢ;

[0028] Figure 3 A comparison diagram of amino acids of FCV strains VP1 of types GⅠ, GⅡ, and GⅢ;

[0029] Figure 4 To identify lentiviruses expressing sgRNA targeting FHV-1TK, gI, gE genes and cas9 protein;

[0030] Figure 5 PCR detection of TK, gI, and gE genes in the FHV-1-ΔTK / gI / gE strain;

[0031] Figure 6 PCR identification of FHV-1-ΔTK / gI / gE-VP1;

[0032] Figure 7 Observation of cell morphology after CRFK cells were infected with the FHV-1-ΔTK / gI / gE-VP1 strain; A: Normal CRFK cells; B: CRFK cells infected with the FHV-1-ΔTK / gI / gE-VP1 strain;

[0033] Figure 8 The results of specific antibody detection 21 days after the second immunization of cats are shown. A is the serum antibody result detected by ELISA with FHV-1 as the antigen, and B is the specific antibody result of FCV VP1 CDE combination antigen detected with GⅠ (FCVCatCZ5), GⅡ (FCVAH44), and GⅢ (FCVCatCZ10) as antigens, respectively.

[0034] Figure 9 The changes in serum neutralizing antibody titers and serum β-interferon levels were observed 21 days after the second immunization of kittens. A: Neutralizing antibody titer against FHV-1; B: Neutralizing antibody titers against GⅠ (FCVCatCZ5), GⅡ (FCVAH44), and GⅢ (FCVCatCZ10); C: Changes in serum β-interferon levels. Detailed Implementation

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0037] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0038] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0039] The terms "comprising," "including," "having," and "containing," etc., used in this document are all open-ended, meaning they include but are not limited to. The feline herpesvirus FHV-1 used in this invention was provided by the Jiangsu Academy of Agricultural Sciences. The nucleotide sequences of VP1 from feline caliciviruses GⅠ (derived from FCVCatCZ5 strain), GⅡ (derived from FCVAH44 strain), and GⅢ (derived from FCVCatCZ10 strain) are shown in SEQ ID NO. 1-3, and their amino acid sequences are shown in SEQ ID NO. 4-6, respectively. The phylogenetic tree of the VP1 nucleotide sequences of feline caliciviruses GⅠ, GⅡ, and GⅢ is shown below. Figure 1 See the phylogenetic tree of amino acid sequences. Figure 2 The amino acid comparison diagram is shown below. Figure 3 .

[0040] The nucleotide sequences of the fusion antigens of the CDE region of the VP1 gene of feline calicivirus GⅠ, GⅡ, and GⅢ types are shown in SEQ ID NO.7, and the amino acid sequences are shown in SID NO.8. This gene sequence was synthesized by General Biotechnology (Anhui) Co., Ltd. and placed in the vector pUC57-simple to form the plasmid pUC57-FCV VP1 CDE(Ⅰ-Ⅲ), which was used as a template for PCR amplification of this fusion gene.

[0041] CRFK cells and 293T cells were cultured in DMEM medium containing 10% fetal bovine serum (GBiCO).

[0042] SEQ ID NO.1 (nucleotide sequence of feline calicivirus GⅠ type VP1):

[0043]

[0044] SEQ ID NO.2 (nucleotide sequence of feline calicivirus GII type VP1):

[0045]

[0046] SEQ ID NO.3 (nucleotide sequence of feline calicivirus GⅢ type VP1):

[0047]

[0048] SEQ ID NO. 4

[0049] ;

[0050] SEQ ID NO. 5

[0051] MCSTCANVLKYYNWDPHIRLTINPNDFLSIGFCDNPLMCCYPELLPEFGTVWDCNDSPLQIYLESILGDDEWSSTYEAIDPVVPPMHWDEAGKIFQPHPGVLMHHLISKVAKGWDPNLPSFRLEADDGSITAPEQGTVVGGVIAEPSTQMASAADMATGKTVDSEWEAFFSFHTSVNWSTSETQGKILFKQNLGPLLNPYLEHISQLYVAWSGSVDVRFSISGSGVFGGKLAAIVVPPGVQPIQSTSMLQYPHVLFDARQVEPVIFSIPDLRSNLYHLMSDTDTTSLVIMVYNDLINPYANDSNSSGCIITVETKPGPDFKFHLLKPPGSMLVHGSIPSNLIPKSSSLWIGNRHWSDITDFVIRPSVFQANRHFDFKQETAGWSTPRFRPMTITISQKEQAKLGIAVALDAIVPGIPDGWPDTTIAGTLTPAGDYAITDHTNSDITTPDKYDSAIKIINNTNFKSMYICGALQRAWGDKKISNTAFITTADLNGNNITGNNIINQSRIIVFQDNHVNRDVQTSEVTLGVLGYTGIGEEVIGSDRDRVVRINILPEVSARGGNHPIFYKNKLKLGYVLRSIDVFNSQILHTSRQLALNNYLLDPDSFAVYRITDSNGSWFDIGIDYSGFSFVGVSNIGNLEFPLTASYMGIQLAKIRLASNIRSSMTKL;

[0052] SEQ ID NO.6 (Amino acid sequence of feline calicivirus genotype GⅢ VP1):

[0053] ;

[0054] SEQ ID NO.7 (nucleotide sequence of the combined antigen of the CDE region of the VP1 gene of feline calicivirus GⅠ, GⅡ and GⅢ types):

[0055]

[0056] SEQ ID NO.8 (Amino acid sequence of the combined antigen of the CDE region of the VP1 gene of feline calicivirus GⅠ, GⅡ and GⅢ types):

[0057]

[0058] In SEQ ID NO.7 and SEQ ID NO.8, the double underline represents the GⅠ type VP1 CDE zone, and the wavy line represents the GⅡ type VP1.

[0059] The CDE area, with the dotted underline, represents the GⅢ type VP1 CDE area, and the underline sequence is a 6×His tag.

[0060] Example 1: Construction of recombinant feline herpesvirus rYT / 2023-△TK / gI / gE-VP1 CDE combined antigen stably expressing feline calicivirus GⅠ, GⅡ, and GⅢ type VP1 CDE combined antigen.

[0061] 1. Construction of recombinant vectors

[0062] Using FHV-1 strain as a template, upstream primer (TKhm1-F) and downstream primer (TKhm1-R) were designed. BamHI and HindIII restriction sites were introduced at the 5' end of the downstream primer. The left homologous arm of the TK gene was amplified by PCR and ligated into the PMD19Tsimple vector to construct PMD19T-TKhm1.

[0063] Similarly, using the FHV-1 strain as a template, upstream primers (TKhm2-F) and downstream primers (TKhm2-R) were designed. BamHI and XbalHI restriction sites were introduced at the 5' end of the upstream primer, and a HindIII restriction site was introduced at the 3' end of the downstream primer to amplify the right homologous arm of the TK gene. The PMD19T-TKhm1 plasmid was double-digested with BamHI and HindIII, and then the amplified TKhm2 was ligated into the PMD19T-TKhm1 plasmid using T4 ligase to construct PMD19T-TKhm1-TKhm2.

[0064] The VP1 CDE combined antigen was amplified using plasmid pUC57-simple-FCV VP1 CDE as a template. An upstream primer CDE-F and a downstream primer CDE-R were designed, and BamHI was introduced at the 5' end of the upstream primer and XbalHI was introduced at the 5' end of the downstream primer. The FCV VP1 CDE combined antigen was obtained by PCR amplification. PMD19T-TKhm1-TKhm2 and the amplified FCVVP1 CDE combined antigen were double-digested with BamHI and XbalHI enzymes, and ligated with T4 ligase to obtain the homologous recombinant plasmid PMD19T-TKhm1-VP1 CDE-TKhm2.

[0065] The PCR amplification system consisted of: 25 μL of 2×phanta MIX, 2 μL of upstream primer, 2 μL of downstream primer, 2 mL of template, and 19 μL of ddH2O.

[0066] Mix the above reagents thoroughly and amplify under the following conditions: denature at 95℃ for 5 min, then enter the cycle with the following cycle parameters: 95℃ for 15 s, 55℃ for 15 s, 72℃ for 1 min, for 35 cycles; extension at 72℃ for 5 min, followed by extension at 16℃ for 2 min.

[0067] TKhm1-F: 5'-gttggctcacgccaataatcc-3' (SEQ ID NO.9);

[0068] TKhm1-R: 5'-CCC AAGCTT GGGCGC GGATCC CATCGTCTGATCTGTGTATGATG-3'(HindⅢ, BamHI) (SEQ ID NO. 10);

[0069] TKhm2-F:5'- GGATCC GCGGC TCTAGA ATTAAACATTAGTGGTGTTCCCT-3' (BamHI, XbalI) (SEQ ID NO. 11);

[0070] TKhm2-R: 5'-CCACAAGACATGGACGGA AAGCTT GGG-3'(HindⅢ)(SEQ ID NO.12);

[0071] CDE-F: 5'-CG GGATCC ATGCAAAGTGGTGGTGCTAAA-3'(BamHI) (SEQ ID NO. 13);

[0072] CDE-R: 5'-GC TCTAGA TTA ATGGTGATGGTGATGATG ATCA-3' (XbalⅠ, 6×His) (SEQ ID NO. 14).

[0073] 2. Construction of CRFK stable cell lines

[0074] The TK gene, gI gene, and gE gene were designed using the guidRNA online design tool ( http: / / crispr.mit.edu / The sgRNA target sequence was determined by comparison with BLAST tools, and the 5'-GN(20)GG or 5'-N(21)GG sequence sites were selected respectively. The selected sgRNA target sequence was unique in the gene to minimize the possibility of off-target effects. The designed and synthesized sgRNA (see Table 1) was placed in boiling water and allowed to cool naturally to room temperature for denaturation and annealing. After annealing, a DNA double strand with sticky ends was formed, which could be ligated into the LentiCRISPRv2 eukaryotic expression vector that had been linearized by BsmBI restriction enzyme digestion.

[0075] The BsmBI digestion system for the LentiCRISPRv2 vector consisted of 1 mL of BsmBI enzyme, 5 mL of 10×3.1 buffer, 1 μg of LentiCRISPR vector, and ddH2O to a final volume of 50 mL. The digestion was carried out in a 55°C water bath for 1 h, followed by inactivation at 80°C for 20 min.

[0076] After electrophoresis identification, the sgRNA was purified using an omega gel extraction kit. The ligation product of the sgRNA and the linearized LentiCRISPR vector was transformed into *E. coli* competent cells (DH5α), plated on ampicillin-resistant plates, and single colonies were picked. Positive clones were identified by sequencing using the universal primers for the U6 promoter (gactatcatatgcttaccgt, SEQ ID NO.15). Positive clones were cultured in a shaker at 37°C for 12-16 h, and plasmids were extracted to obtain expression vectors for LentiCRISPRv2-TK-sgRNA, LentiCRISPRv2-gI-sgRNA, and LentiCRISPRv2-gE-sgRNA. These expression vectors, along with helper plasmids pSPAX2 and pMD2.0G, were co-transfected into 293T cells. Lentiviral viruses were harvested 48-72 h after transfection, and the lentiviruses expressing sgRNAs targeting FHV-1TK, gI, and gE genes and Cas9 protein were identified. Results are shown in [Figure 1]. Figure 4 C represents the control line, and T represents the test line. A red band at C indicates that the test plate is valid, a red band at T indicates a positive test result, and no red band indicates a negative test result. The blank control is DMEM medium.

[0077] CRFK cells were infected with lentiviruses and selected using puromycin pressure to obtain stable cell lines: TK-sgRNA-CRFK, gI-sgRNA-CRFK, and gE-sgRNA-CRFK (CRFK stable cell lines expressing sgRNA targeting TK, gI, and gE genes and Cas9 protein, respectively, abbreviated as TK, gI, and gE gene knockout CRFK stable cell lines).

[0078] Table 1. Primer information for sgRNAs targeting TK, gE, and gI.

[0079] TK-sgRNA-F CACCGGAGTTTAACGGCGAAGTACC(SEQ ID NO.16) TK-sgRNA-R AAACGGTACTTCGCCGTTAAACTCC(SEQ ID NO.17) gI-sgRNA-F CACCGAAAGCATTATTGCGTACACG(SEQ ID NO.18) gI-sgRNA-R AAACCGTGTACGCAATAATGCTTTC(SEQ ID NO.19) gE-sgRNA-F CACCGGTGCCGCACTTTTAGTCGAT(SEQ ID NO.20) gE-sgRNA-R AAACATCGACTAAAAGTGCGGCACC(SEQ ID NO.21)

[0080] 3. Construction of FHV-1 strain with gI / gE gene knockout deletion

[0081] CRFK cells with the gI gene knocked out were cultured in 6-well plates (containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 U / mL streptomycin). When the cell confluence reached 70-80%, they were infected with the FHV-1 strain (MOI = 0.01). 1 mL of virus solution was incubated at 37°C for 2 hours, and then the medium was changed. After 36-48 hours of culture, cytopathic plaques were observed under a microscope. Once these plaques appeared, they were picked and purified through multiple rounds. The completely purified virus was then inoculated into CRFK cells, and the virus solution was harvested. DNA was extracted using standard methods, and PCR amplification was performed using primers gI-F (cgtgtacgcaataatgcttt, SEQ ID NO. 22) and gI-R (cacctttctgtctggtg, SEQ ID NO. 23). The amplified fragments were sequenced, and the purified recombinant virus was named the FHV-1-ΔgI deletion strain. CRFK cells with the gE gene knocked out were cultured in 6-well plates (containing 10% fetal bovine serum, 100 mL of penicillin, and 100 U / mL of streptomycin). After the cells reached 70-80% confluence, they were infected with the FHV-1-ΔgI deletion strain. After observing the appearance of cytopathic plaques under a microscope, multiple rounds of plaque purification were performed. The completely purified virus was inoculated into CRFK cells, and the viral fluid was harvested. DNA was extracted using conventional methods, and PCR amplification was performed using primers gE-F (gtgccgcacttttagtcgat, SEQ ID NO.24) and gE-R (ttgttgctgaaaattctg, SEQ ID NO.25). The amplified fragments were sequenced, and the purified recombinant virus was named the FHV-1-ΔgI / gE deletion strain.

[0082] 5. Recombinant virus construction

[0083] TK gene knockout CRFK stable cell lines were cultured in 6-well plates (containing 10% fetal bovine serum, 100 mL penicillin, and 100 U / mL streptomycin). Transfection was performed after cell confluence reached 70-80%. The homologous recombinant plasmid PUC57-TKhm1-FCV VP1 CDE combination antigen was transfected into TK-CRFK stable cells at a ratio of 1:1,800 μL, and incubated at 37°C for 4 h. After transfected cell incubation, the cells were infected with an FHV-1-ΔgI / gE deletion strain (MOI = 0.01), and incubated at 37°C for 2 h with 1 mL of virus solution, followed by medium replacement. After 36-48 h of culture, cytopathic plaques were observed under a microscope. These plaques were then picked and purified through multiple rounds of purification. The completely purified virus was then inoculated into CRFK cells. Figure 7Viral fluid was harvested, and DNA was extracted using standard methods. PCR amplification was then performed using primers TK-F (GAGTTTAACGGCGAAGTACC, SEQ ID NO.26), TK-R (aataatgtgtcacataaatct, SEQ ID NO.27), and primers FCV VP1-F (ATGCAAAGTGGTGGTGCTAAA, SEQ ID NO.28), FCV VP1-R (TTAATGGTGATGGTGATGATGATC, SEQ ID NO.29). The amplified fragments were sequenced, and the purified recombinant virus was named rFHV-1-ΔTK / gI / gE-VP1. PCR detection of the TK, gI, and gE genes in the rFHV-1-ΔTK / gI / gE-VP1 strain was performed, and the results are shown below. Figure 5 PCR detection of the TK, gI, and gE genes in the FHV-1 strain was positive; PCR detection of the TK, gI, and gE genes in the rFHV-1-ΔTK / gI / gE-VP1 strain was negative. PCR identification of rFHV-1-ΔTK / gI / gE-VP1 was performed, and the results are shown below. Figure 6 Lanes 1-4 contain the FHV-1 strain; lanes 5-6 contain the rFHV-1-ΔTK / gI / gE-VP1 strain. It can be seen that only the rFHV-1-ΔTK / gI / gE-VP1 strain expresses the VP1CDE combined antigen.

[0084] 5. Preservation of recombinant viruses

[0085] The identified rFHV-1-ΔTK / gI / gE-VP1 virus was inoculated into CRFK cells using standard methods. After culturing until more than 90% of the cells showed CPE (cytopathic effect), the viral supernatant was harvested, aliquoted, and stored at -80°C.

[0086] Example 2: Pathogenicity test of recombinant virus rFHV-1-ΔTK / gI / gE-VP1

[0087] rFHV-1-ΔTK / gI / gE-VP1 was inoculated into CRFK cells, and the viral fluid was harvested when more than 90% of cells showed cytopathic effects. Nine kittens approximately 2 months old, which tested negative for both FHV antigen and antibody, were randomly divided into three groups, labeled as group 1, 2, and 3. The challenge experiment was conducted according to the grouping, challenge dose, and inoculation method as shown in Table 2. DMEM culture medium was used as a blank control. The kittens were observed continuously for 21 days after challenge.

[0088] Table 2 shows the pathogenicity tests of rFHV-1-ΔTK / gI / gE-VP1 and YT2023 in kittens.

[0089] Group 1 rFHV-1-ΔTK / gI / gE-VP1 <![CDATA[10 8.5 TCID5]]> Nasal drops 2 groups rFHV-1 <![CDATA[10 8.5 TCID5]]> Nasal drops 3 groups DMEM culture medium 1.0mL Nasal drops

[0090] Clinical symptoms and body temperature were observed daily in kittens after challenge. Results are shown in Table 3: No FHV-related clinical symptoms appeared after intranasal administration of rFHV-1-ΔTK / gI / gE-VP1, while kittens inoculated with FHV-1 intranasally developed feline infectious rhinotracheitis-related clinical symptoms such as fever, nasal and ocular discharge, sneezing, and coughing on day 5 post-challenge, with no deaths observed. The blank control group showed no clinical symptoms.

[0091] Table 3. Statistical analysis of pathogenicity test results of rFHV-1-ΔTK / gI / gE-VP1 and FHV-1 in kittens.

[0092] Group 1 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 2 groups 3 / 3 2 / 3 3 / 3 3 / 3 2 / 3 3 groups 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3

[0093] Example 3: Immunogenicity of recombinant FHV-1 live vector vaccine rFHV-1-ΔTK / gI / gE-VP1 at CDE

[0094] In Example 2, groups 1 and 3 received a second immunization with the same dose and method 21 days after the first intranasal vaccination. 21 days after the second immunization, blood samples were collected from all experimental cats for serum-specific antibody testing, and the results are as follows: Figure 8 As shown, antibodies could be detected using FHV-1 as the antigen or using GⅠ, GⅡ, and GⅢ as antigens. Twenty-one days after the second immunization, the rFHV-1-ΔTK / gI / gE-VP1 CDE vaccine immunization group produced higher levels of FHV-1, FCV VP1-specific antibodies and neutralizing antibodies, and the serum level of interferon-β was also higher than that of the control group. Figure 9 ).

[0095] FCVs of types GⅠ, GⅡ, and GⅢ were mixed with FHV-1 (10 per strain). 8 TCID 50 Cats were co-vaccinated in groups 1 and 3, and the results are shown in Table 4. No FCV and FHV-1 related clinical symptoms were observed in group 1, which was vaccinated with the recombinant FHV-1 live vector vaccine rFHV-1-ΔTK / gI / gE-VP1 CDE; while in group 3, which was vaccinated with DMEM, FCV and FHV-1 related clinical symptoms were observed, and death occurred. This indicates that the recombinant FHV-1 live vector vaccine rFHV-1-ΔTK / gI / gE-VP1 CDE can provide immune protection against FCV and FHV-1.

[0096] Table 4. Statistical analysis of pathogenicity test results of rFHV-1-ΔTK / gI / gE-VP1CDE and YT2023 in kittens.

[0097] Group 1 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 3 groups 3 / 3 3 / 3 3 / 3 3 / 3 3 / 3 2 / 3

[0098] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A combination antigen of feline calicivirus types Gl, G2 and G3, characterized in that, The nucleotide sequence of the gene for the combined antigen is shown in SEQ ID NO.

7.

2. A method for constructing a recombinant feline herpesvirus co-expressing feline calicivirus group I, group II and group III combination antigens, characterized in that, Includes the following steps: Homologous arms TKhm1 and TKhm2 of the TK gene of feline herpesvirus were ligated to both sides of the combined antigen genes of feline calicivirus GⅠ, GⅡ and GⅢ types to obtain homologous recombinant plasmids. Using primers for the sgRNA of the feline herpesvirus TK, gI, or gE genes, sgRNA expression vectors for the TK, gI, or gE genes were constructed, respectively. The sgRNA expression vectors were then transfected into cells to rescue lentiviruses. The lentiviruses were used to infect cells to obtain stable TK gene knockout cell lines, stable gI gene knockout cell lines, or stable gE gene knockout cell lines. Feline herpesvirus was used to infect a stable cell line with gI gene knockout to obtain an FHV-1-ΔgI-deficient strain. The FHV-1-ΔgI-deficient strain was then used to infect a stable cell line with gE gene knockout to obtain an FHV-1-ΔgI / gE-deficient strain. Homologous recombinant plasmids were transfected into TK gene knockout stable cell lines, and then the transfected cells were used to infect FHV-1-ΔgI / gE deletion strains to obtain recombinant feline herpesvirus co-expressing feline calicivirus type GⅠ, GⅡ and GⅢ combined antigens; The nucleotide sequences of the feline calicivirus GⅠ, GⅡ and GⅢ type combined antigen genes are shown in SEQ ID NO.7; The sgRNA primers for the feline herpesvirus TK, gI, and gE genes are shown in SEQ ID NO.16-SEQ ID NO.

21.

3. The recombinant feline herpesvirus co-expressing feline calicivirus type GⅠ, GⅡ and GⅢ combined antigens obtained by the construction method according to claim 2.

4. The use of the recombinant feline herpesvirus co-expressing feline calicivirus type GⅠ, GⅡ and GⅢ combined antigens as described in claim 3 in the preparation of a vaccine for the prevention and treatment of feline calicivirus disease.

5. The use of the recombinant feline herpesvirus co-expressing feline calicivirus type GⅠ, GⅡ and GⅢ combined antigens as described in claim 3 in the preparation of a vaccine for the prevention and treatment of feline infectious rhinotracheitis.

6. A live vector vaccine for the control of feline calicivirus disease and / or feline infectious rhinotracheitis, characterized in that, The live vector vaccine comprises recombinant feline herpesvirus co-expressing feline calicivirus type GⅠ, GⅡ and GⅢ combined antigens as described in claim 3.

7. Live vector vaccine according to claim 6, characterized in that It also includes auxiliary materials.

Images