Trichoderma virens strain and application thereof

CN120442408BActive Publication Date: 2026-09-25贵州煜宏生物科技有限公司 +1
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202510418565.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-03
Publication Date
2026-09-25
Estimated Expiration
2045-04-03

AI Technical Summary

Technical Problem

目前对生姜块茎腐烂病生物防治方法的相关研究较少,并且没有绿木霉在这方面的应用

Benefits of technology

[0025]1.本发明所得绿木霉菌株Trichoderma virens GZUAS831026具有较好的生物酶活性,纤维素酶活为2236.1±141.7U/mL,滤纸酶活为799.5±28.3U/mL,锰过氧化物酶活为79±6.1U/mL,木质素降解率为48.5%。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005344596560000071
    Figure BDA0005344596560000071
  • Figure BDA0005344596560000091
    Figure BDA0005344596560000091
  • Figure BDA0005344596560000101
    Figure BDA0005344596560000101
Patent Text Reader

Abstract

The present application relates to a strain of Trichoderma virens and application thereof.A strain of Trichoderma virens GZUAS831026 is isolated from a soil sample of a pepper field, and the strain is preserved in the Guangdong Microbial Culture Collection Center with a preservation number of GDMCC No: 65370.The Trichoderma virens obtained in the present application has good degradation effect on pepper straw and growth promotion effect, and has good inhibitory effect on the pathogen of ginger tuber rot disease, and can be used for the prevention and treatment of ginger tuber rot disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a strain of Trichoderma viride and its applications. Background Technology

[0002] Chili pepper stalks are a byproduct of chili pepper harvesting, and the annual yield is enormous. Due to their high cellulose and lignin content, chili pepper stalks are difficult to utilize directly. Traditional methods of burning and discarding not only pollute the environment but also result in significant resource waste. Returning straw to the field is the main method for resource utilization of crop straw. However, because the lignin in straw decomposes slowly, it severely impacts soil quality and the growth of subsequent crops. Therefore, developing a method for rapidly decomposing straw is particularly important.

[0003] Trichoderma fungi are widely found in nature and are recognized as beneficial fungi due to their ability to improve soil environment, promote plant growth, degrade agricultural straw, and be healthy and pollution-free. Trichoderma fungi can produce enzymes such as cellulase and manganese peroxidase, including species like *Trichoderma harzianum*, *Trichoderma longibrachiatum*, and *Trichoderma atroviride*. Some Trichoderma fungi can produce high levels of IAA (inhibitory-associated acid), such as *Trichoderma asperellum*, *Trichoderma brevicompactum*, and *Trichoderma hamatum*.

[0004] Ginger (Zingiber officinale Roscoe) is a perennial herbaceous plant belonging to the genus Zingiber of the family Zingiberaceae. It is an important economic vegetable crop used for both medicinal and culinary purposes, and my country is one of the major ginger-producing countries. The recurring occurrence of diseases such as ginger tuber rot severely impacts ginger yield and quality, causing significant economic losses. The pathogens reported to cause ginger tuber rot mainly include Ralstonia solanacearum, Erwinia spp., Bacillus pumilus, Pythium myriotylum, and Fusarium oxysporum. Currently, there is limited research on biological control methods for ginger tuber rot, and there is no application of Trichoderma viride in this area.

[0005] To this end, the invention team screened a strain of Trichoderma viride that can degrade straw, promote growth, and has antagonistic effects against Erwinia viride. This strain can be applied to degrade and return chili straw to the field, promote the growth of corn and rapeseed, and prevent ginger tuber rot. Summary of the Invention

[0006] The purpose of this invention is to provide a Trichoderma virens strain GZUAS831026.

[0007] Another objective of this invention is to provide the application of the Trichoderma virens strain GZUAS831026 in the preparation of a chili straw degrading agent.

[0008] Another objective of this invention is to provide the application of Trichoderma virens GZUAS831026 in the preparation of growth promoters for maize and rapeseed.

[0009] Another objective of this invention is to provide the application of Trichoderma virens GZUAS831026 in the preparation of a control agent for ginger tuber rot.

[0010] The ginger tuber rot disease described in this invention is caused by Erwinia bifidum.

[0011] The method for isolating and screening the Trichoderma virens GZUAS831026 strain described in this invention includes the following steps:

[0012] (1) Collect soil from chili fields, weigh 10g of soil into 90mL of sterile water, shake for 15min, let stand for 10min, take the supernatant, spread it on screening medium 1, and incubate at 28℃ for 5 days. Pick single colonies on modified PDA agar medium for purification, and resuspend the purified strain with 25% glycerol solution and store at -80℃.

[0013] (2) The purified strain was inoculated onto screening medium 2, inverted at 28°C for 2 days, stained with 30 mL of Congo red solution for 20 min, washed 3 times with 30 mL of sodium chloride solution, and the colonies with the largest transparent zone were selected for sequencing identification.

[0014] The formulation of the screening culture medium 1 described in this invention is as follows: 10 g / L chili straw powder, 20 g / L ammonium chloride, 0.1 g / L magnesium sulfate, 0.2 g / L calcium chloride, 0.5 g / L dipotassium hydrogen phosphate, 0.5 g / L potassium dihydrogen phosphate, 0.1 g / L ferrous sulfate, 15 g / L agar, and natural pH.

[0015] The chili straw powder described in screening culture medium 1 of this invention is passed through a 60-mesh sieve.

[0016] The formulation of the screening medium 2 described in this invention is as follows: CMC-Na 10g / L, ammonium sulfate 20g / L, magnesium sulfate 0.1g / L, calcium chloride 0.1g / L, potassium chloride 0.3g / L, dipotassium hydrogen phosphate 0.5g / L, potassium dihydrogen phosphate 0.5g / L, ferrous sulfate 0.1g / L, pH natural.

[0017] The modified PDA agar medium of the present invention has the following formula: potato extract 20 g / L, glucose 14 g / L, agar 20 g / L, streptomycin 200 mg / L, pH natural.

[0018] In this invention, streptomycin is added to the modified PDA agar medium after sterilization.

[0019] The concentration of the Congo red solution in step (2) of this invention is 1 g / L.

[0020] The concentration of the sodium chloride solution in step (2) of this invention is 58.5 g / L.

[0021] The identification method for the *Trichoderma* strains described in this invention includes morphological identification and molecular biological identification.

[0022] The morphological identification method of the *Trichoderma viride* strain described in this invention is as follows: inoculate the *Trichoderma viride* strain onto PDA agar medium, incubate at 28°C for 5 days, and observe the colony morphology characteristics.

[0023] The molecular biological identification method for the *Trichoderma viride* strain described in this invention is as follows: the purified strain is sent to Guangzhou Aiji Biotechnology Co., Ltd. for sequencing, and the obtained sequence is compared on NCBI.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] 1. The *Trichoderma virens* strain GZUAS831026 obtained in this invention exhibits good bioenzyme activity, with cellulase activity of 2236.1±141.7 U / mL, filter paper enzyme activity of 799.5±28.3 U / mL, manganese peroxidase activity of 79±6.1 U / mL, and lignin degradation rate of 48.5%.

[0026] 2. The *Trichoderma virens* strain GZUAS831026 obtained in this invention exhibits good degradation effect on chili straw. Degradation tests showed that the degradation rate of chili straw in the experimental group was 42.4% after 20 days, while the degradation rate in the blank control group was 15.1%. Soil-covered degradation tests showed that the degradation rate of chili straw in the experimental group was 39.3% after 20 days, while the degradation rate in the blank control group was 10.7%.

[0027] 3. The Trichoderma virens strain GZUAS831026 obtained in this invention has a good growth-promoting effect. The IAA content of the fermentation broth of strain GZUAS831026 was measured to be 46.6±5.9ug / mL, which has a significant growth-promoting effect on corn and rapeseed plants.

[0028] 4. The *Trichoderma virens* strain GZUAS831026 obtained in this invention has a good control effect on ginger tuber rot. The fermentation broth of strain GZUAS831026 has an inhibition index of 2.11 against *Erwinia bifurcaria*, the pathogen of ginger tuber rot, and the control effect on ginger tuber rot reaches 71.39%.

[0029] Preservation Information:

[0030] Strain name: Trichoderma virens GZUAS831026;

[0031] Preservation institution: Guangdong Provincial Microbial Culture Collection Center (GDMCC);

[0032] Address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou;

[0033] Deposit date: October 30, 2024;

[0034] The accession number is GDMCC No: 65370. Attached Figure Description

[0035] Figure 1 Colony morphology and spore morphology of Trichoderma virens GZUAS831026 (where a is colony morphology; b is spore morphology);

[0036] Figure 2 Phylogenetic tree of Trichoderma virens GZUAS831026;

[0037] Figure 3 Comparison of chili straw before and after degradation (where a is before degradation; b is after degradation; c is microscopic examination of chili straw before degradation; d is microscopic examination of chili straw after degradation);

[0038] Figure 4 Comparison of chili straw before and after degradation by soil covering (where a is before degradation of chili straw; b is after degradation of chili straw; c is microscopic examination before degradation of chili straw; d is microscopic examination after degradation of chili straw).

[0039] Figure 5Comparison of maize plant growth between the experimental group and the control group (where a is the experimental group and b is the control group);

[0040] Figure 6 Comparison of rapeseed plant growth between the experimental group and the control group (where a is the experimental group and b is the control group);

[0041] Figure 7 Plate confrontation test between strain GZUAS831026 and Erwinia bifida, the pathogen of ginger tuber rot. Detailed Implementation

[0042] The technical solution of the present invention will be further described in detail below through specific embodiments.

[0043] Example 1: Application of Trichoderma virens strain GZUAS831026 in the degradation of chili straw

[0044] (1) After culturing strain GZUAS831026 at 28℃ for 5 days in a constant temperature incubator, the spores were washed off with sterile purified water and diluted to 10. 8 CFU / mL available for use.

[0045] (2) Chili straw was dried at 75℃ to constant weight. Spores were sprayed onto the chili straw. An equal volume of sterile purified water was used as a blank control. Each treatment was repeated in triplicate. Solid-state fermentation was carried out at 28℃ for 20 days. The morphological changes of the chili straw were observed regularly. White mycelium began to appear on the surface of the chili straw 3 days after inoculation, and green mycelium appeared after 7 days. No obvious changes were observed in the control group.

[0046] (3) When fermentation reaches 20 days, each treatment is removed, the mycelium on the surface of the chili straw is washed off, dried at 75℃ to constant weight, the weight of the chili straw is weighed, and the relative weight loss is calculated.

[0047] Example 2: Application of Trichoderma virens strain GZUAS831026 in promoting rapeseed growth

[0048] (1) Inoculate strain GZUAS831026 into PDA liquid medium and culture in a shake flask at 28℃ and 180rpm / min for 3 days. Centrifuge the culture at 10000rpm at 4℃ for 10min, and the supernatant is the fermentation broth. Dilute the fermentation broth 100 times with sterile purified water before use.

[0049] (2) Select plump, uniform-sized, and disease-free rapeseed seeds. Soak them in a 1% sodium hypochlorite solution for 10 seconds, rinse them 3-4 times with sterile purified water, and dry them. Lay 4 layers of sterile gauze flat in a petri dish, place the seeds on the gauze, spray with sterile purified water, and germinate at 26℃ in the dark (12h). After germination, select seedlings with good and uniform growth and transplant them.

[0050] (3) The experiment set up an experimental group and a control group, with 3 replicates in each group and 30 seedlings in each replicate. Each seedling was irrigated with 20 mL of diluted fermentation liquid. Foliar fertilizer was sprayed once every 5 days, with the dripping water from the leaves as the standard. An equal amount of sterile purified water was used as the control group. The plant growth status was observed and the growth indicators of the plants were measured at 20 days.

[0051] Example 3: Application of Trichoderma virens strain GZUAS831026 in promoting maize growth

[0052] (1) Inoculate strain GZUAS831026 into PDA liquid medium and culture in a shake flask at 28℃ and 180rpm / min for 3 days. Centrifuge the culture at 10000rpm at 4℃ for 10min, and the supernatant is the fermentation broth. Dilute the fermentation broth 100 times with sterile purified water before use.

[0053] (2) Select plump, uniform-sized, and disease-free corn seeds. Soak them in a 1% sodium hypochlorite solution for 10 seconds, rinse them 3-4 times with sterile purified water, and dry them. Lay 4 layers of sterile gauze flat in a petri dish, place the seeds on the gauze, spray with sterile purified water, and germinate at 26℃ in the dark (12h). After germination, select seedlings with good and uniform growth and transplant them.

[0054] (3) The experiment set up an experimental group and a control group, with 3 replicates in each group and 30 seedlings in each replicate. Each seedling was irrigated with 20 mL of diluted fermentation liquid. Foliar fertilizer was sprayed once every 5 days, with the dripping water from the leaves as the standard. An equal amount of sterile purified water was used as the control group. The plant growth status was observed and the growth indicators of the plants were measured at 20 days.

[0055] Example 4: Application of Trichoderma virens strain GZUAS831026 in the control of ginger tuber rot.

[0056] (1) Inoculate strain GZUAS831026 into PDA liquid medium and culture it in a shake flask at 28℃ and 180rpm / min for 3 days. Take the culture medium and centrifuge at 10000r at 4℃ for 10min. The supernatant is the fermentation broth. When using it, dilute the fermentation broth 100 times with sterile purified water.

[0057] (2) Dilute the pathogen of ginger tuber rot, Erwinia billingiae, to 1×10⁻⁶. 8 Mix CFU / mL with nutrient soil at a volume ratio of 1:10. Select healthy ginger seeds that have already sprouted, disinfect the surface of the ginger seeds with an alcohol swab, break the ginger to make a wound, and bury it in nutrient soil mixed with pathogens.

[0058] (3) 60 mL of diluted fermentation broth of each ginger seedling root irrigation strain GZUAS831026 was used as a control group with the same volume of sterile water used for root irrigation.

[0059] (4) Three ginger plants were used for each treatment, with three replicates. The disease index and control effect were statistically analyzed after 20 days.

[0060] (5) The disease index grading standard for ginger tuber rot is as follows:

[0061] Level 1: No disease or almost no disease, represented by a value of 0;

[0062] Level 2: Less than 25% of the part is soft and rotten, with a representative value of 1;

[0063] Level 3: Soft rot accounts for 25%-50%, with a representative value of 2;

[0064] Level 4: Soft rot exceeds 50%, with a representative value of 3.

[0065] (6) The formulas for calculating the incidence rate, disease index, and prevention and control effectiveness are as follows:

[0066] Incidence rate (%) = (Number of diseased plants / Total number of plants) × 100;

[0067] Disease index = 100 × ∑(number of plants at each disease level × representative value at each level) / (total number of plants surveyed × highest representative value);

[0068] Prevention and control effect (%) = 100 × (disease index of control group - disease index of treatment group) / disease index of control group.

[0069] Example 5 Screening medium 1

[0070] The formulation of screening medium 1 is as follows: 10 g / L chili straw powder, 20 g / L ammonium chloride, 0.1 g / L magnesium sulfate, 0.2 g / L calcium chloride, 0.5 g / L dipotassium hydrogen phosphate, 0.5 g / L potassium dihydrogen phosphate, 0.1 g / L ferrous sulfate, 15 g / L agar, pH natural. The chili straw powder is passed through a 60-mesh sieve.

[0071] Example 6 Screening medium 2

[0072] The formulation of screening medium 2 is as follows: CMC-Na 10g / L, ammonium sulfate 20g / L, magnesium sulfate 0.1g / L, calcium chloride 0.1g / L, potassium chloride 0.3g / L, dipotassium hydrogen phosphate 0.5g / L, potassium dihydrogen phosphate 0.5g / L, ferrous sulfate 0.1g / L, pH natural.

[0073] Example 7: Modified PDA Agar Medium

[0074] The modified PDA agar medium formula is as follows: potato extract 20 g / L, glucose 14 g / L, agar 20 g / L, streptomycin 200 mg / L (streptomycin added after sterilization), pH natural.

[0075] The culture media from Examples 5-7 were applied to the separation and screening method of Example 8.

[0076] Example 8: Isolation and screening method of Trichoderma virens GZUAS831026

[0077] (1) Collect soil from chili fields, weigh 10g of soil into 90mL of sterile water, shake for 15min, let stand for 10min, take the supernatant, spread it on screening medium 1, and incubate at 28℃ for 5 days. Pick single colonies on modified PDA agar medium for purification, and resuspend the purified strain with 25% glycerol solution and store at -80℃.

[0078] (2) The purified strain was inoculated onto screening medium 2 and incubated upside down at 28°C for 2 days. It was stained with 30 mL of 1 g / L Congo red solution for 20 min and eluted 3 times with 30 mL of 58.5 g / L sodium chloride solution. The colonies with the largest transparent zone were selected for sequencing identification.

[0079] Example 9: Identification method of Trichoderma virens strain GZUAS831026

[0080] (1) Morphological identification

[0081] Trichoderma viride was inoculated onto PDA agar medium and incubated at 28°C for 7 days. The colonies were initially green or yellowish-green and later dark green. The colony surface was felt-like. The spores were oval or ovoid, 3.2-4.5 × 4.3-4.9 μm in size. The hyphae were septate, 3.1-5.9 μm in diameter, and the lateral branches were oppositely branched.

[0082] (2) Molecular biological identification

[0083] The purified strain was sent to Guangzhou Aiji Biotechnology Co., Ltd. for sequencing. The obtained sequences were uploaded to the NCBI database. BLAST alignment showed that strain GZUAS831026 had 100% similarity to *Trichoderma virens*. A phylogenetic tree of strain GZUAS831026 was constructed using MEGAX software, revealing that strain GZUAS831026 and MK841029.1 belonged to the same branch. Based on the morphological characteristics of strain GZUAS831026 and the ITS sequence alignment results, strain GZUAS831026 was identified as *Trichoderma virens*.

[0084] To verify the effectiveness of the invention, the inventive team conducted a series of experiments, as follows:

[0085] 1. Isolation and screening method of Trichoderma virens GZUAS831026

[0086] 1.1 Culture medium preparation

[0087] The formulation of screening medium 1 is as follows: 10 g / L chili straw powder, 20 g / L ammonium chloride, 0.1 g / L magnesium sulfate, 0.2 g / L calcium chloride, 0.5 g / L dipotassium hydrogen phosphate, 0.5 g / L potassium dihydrogen phosphate, 0.1 g / L ferrous sulfate, 15 g / L agar, pH natural. The chili straw powder is passed through a 60-mesh sieve.

[0088] The formulation of screening medium 2 is as follows: CMC-Na 10g / L, ammonium sulfate 20g / L, magnesium sulfate 0.1g / L, calcium chloride 0.1g / L, potassium chloride 0.3g / L, dipotassium hydrogen phosphate 0.5g / L, potassium dihydrogen phosphate 0.5g / L, ferrous sulfate 0.1g / L, pH natural.

[0089] The modified PDA agar medium formula is as follows: potato extract 20 g / L, glucose 14 g / L, agar 20 g / L, streptomycin 200 mg / L (streptomycin added after sterilization), pH natural.

[0090] 1.2 Separation and Screening Methods

[0091] (1) Collect soil from chili fields, weigh 10g of soil into 90mL of sterile water, shake for 15min, let stand for 10min, take the supernatant, spread it on screening medium 1, and incubate at 28℃ for 5 days. Pick single colonies on modified PDA agar medium for purification, and resuspend the purified strain with 25% glycerol solution and store at -80℃.

[0092] (2) The purified strain was inoculated onto screening medium 2 and cultured upside down at 28°C for 2 days. It was stained with 30 mL of 1 g / L Congo red solution for 20 min and eluted 3 times with 30 mL of 58.5 g / L sodium chloride solution. The colony with the largest transparent zone was selected for sequencing identification and named GZUAS831026.

[0093] 2. Identification method for Trichoderma virens strain GZUAS831026

[0094] (1) Morphological identification

[0095] Trichoderma viride was inoculated onto PDA agar medium and incubated statically at 28°C for 7 days. Early colonies were green or yellowish-green, turning dark green later. The colony surface was felt-like. Spores were oval or ovoid, 3.2-4.5 × 4.3-4.9 μm in size. Hyphae were septate, 3.1-5.9 μm in diameter, with opposite branches on lateral branches. See [link to Trichoderma viride colony morphology] for details. Figure 1 .

[0096] (2) Molecular biological identification

[0097] The purified strain was sent to Guangzhou Aiji Biotechnology Co., Ltd. for sequencing. The obtained ITS rRNA gene sequence was uploaded to the NCBI database and compared by BLAST. The results are shown in Table 1. The similarity between strain GZUAS831026 and *Trichoderma virens* was 100%. A phylogenetic tree of strain GZUAS831026 was constructed using MEGAX software (e.g., ...). Figure 2 The strain GZUAS831026 was found to be in the same branch as MK841029.1. Based on the morphological characteristics of strain GZUAS831026 and the results of ITS sequence alignment, strain GZUAS831026 was identified as Trichoderma virens.

[0098] Table 1. BLAST alignment results of strain GZUAS831026

[0099]

[0100] 3. Investigation on the degradation effect of Trichoderma virens GZUAS831026 on chili straw

[0101] 3.1 Determination of bioenzyme activity of strain GZUAS831026

[0102] (1) Inoculate strain GZUAS831026 into PDA liquid medium and culture at 28℃ with shaking at 180r for 4 days.

[0103] (2) Take the culture medium and centrifuge at 10000r at 4℃ for 10min. The supernatant is the crude enzyme solution.

[0104] (3) Cellulase and filter paper enzyme activities were determined by DNS method. The cellulase activity was 2236.1±141.7U / mL and the filter paper enzyme activity was 799.5±28.3U / mL.

[0105] (4) The manganese peroxidase activity was determined using a kit, and the manganese peroxidase activity was 79±6.1U / mL.

[0106] (5) The lignin degradation rate was determined to be 48.5%.

[0107] 3.2 Degradation test of chili straw by strain GZUAS831026

[0108] (1) After culturing strain GZUAS831026 at 28℃ for 5 days in a constant temperature incubator, the spores were washed off with sterile purified water and diluted to 10. 8 CFU / mL available for use.

[0109] (2) Chili straw was dried at 75℃ to constant weight. Spores were sprayed onto the chili straw. An equal volume of sterile purified water was used as a blank control. Each treatment was repeated in triplicate. Solid-state fermentation was carried out at 28℃ for 20 days. The morphological changes of the chili straw were observed regularly. White mycelium began to appear on the surface of the chili straw 3 days after inoculation, and green mycelium appeared after 7 days. No obvious changes were observed in the control group.

[0110] (3) When fermentation reaches 20 days, each treatment is removed, the mycelium on the surface of the chili straw is washed off, dried at 75℃ to constant weight, the weight of the chili straw is weighed, and the relative weight loss is calculated.

[0111] (4) After 20 days, the surface of the chili straw was covered with dark green mycelium and softened. The degradation rate of the chili straw in the experimental group after 20 days was measured to be 42.4%, while the degradation rate of the chili straw in the blank control group was 15.1%. A comparison of chili straw degradation before and after is shown in the figure below. Figure 3 As shown.

[0112] 3.3 Degradation test of chili straw covered with soil by strain GZUAS831026

[0113] (1) After culturing strain GZUAS831026 at 28℃ for 5 days in a constant temperature incubator, the spores were washed off with sterile purified water and diluted to 10. 8 CFU / mL available for use.

[0114] (2) The chili straw was dried at 75℃ to constant weight, cut into 5cm sections, and placed in nylon bags. The spore liquid was sprayed onto the chili straw until it was thoroughly moistened. Three replicates were made for each treatment. The straw was placed in a basin and covered with 10cm of soil. An equal amount of sterile purified water was used as a blank control. After 20 days, the mycelium on the surface of the chili straw was washed off, dried at 75℃ to constant weight, and the weight of the chili straw was weighed. The relative weight loss was calculated.

[0115] (3) The degradation rate of chili straw in the experimental group after 20 days was 39.3%, while the degradation rate in the blank control group was 10.7%. A comparison of chili straw degradation before and after soil covering is shown in the figure below. Figure 4 As shown.

[0116] 4. Investigation on the growth-promoting effect of Trichoderma virens GZUAS831026

[0117] 4.1 Determination of IAA content in strain GZUAS831026

[0118] The strain GZUAS831026 was inoculated into liquid PDA medium and cultured in a shake flask at 28℃ and 180 rpm for 3 days. The culture solution was then centrifuged at 10000 rpm for 10 min at 4℃, and the supernatant was used as the test solution.

[0119] The method for determining IAA content is as follows:

[0120] (1) Salkowski reagent: 0.5mol / L FeCl3 (1.5mL) + concentrated sulfuric acid (30mL) + distilled water (50mL), mix and shake well before use, and store away from light.

[0121] (2) Prepare IAA standard solution: Weigh 10 mg of IAA, dissolve it in a small amount of ethanol, and then dilute it to 100 mL with distilled water (concentration is 100 μg / mL).

[0122] (3) Take 8 test tubes and add 2 mL of IAA solution with concentration gradients of 0, 5.0, 10.0, 15.0, 20.0 and 25.0 μg / mL in sequence. Add 8 mL of Salkowski reagent to each tube and mix well. React in the dark for 30 min and measure the absorbance value on a spectrophotometer with the wavelength set at 530 nm.

[0123] (4) Plot the IAA standard curve with IAA concentration on the x-axis and absorbance value on the y-axis.

[0124] (5) Take 1 mL of the test solution and add 9 mL of Salkowski reagent. Mix well and react in the dark for 30 min. Repeat each group 3 times. Use purified water as a control.

[0125] (6) The absorbance value was measured on a spectrophotometer with the wavelength set to 530 nm, and the OD530 was obtained.

[0126] (7) The IAA content was determined to be 46.6±5.9ug / mL.

[0127] 4.2 Effect of strain GZUAS831026 on maize growth promotion

[0128] (1) Inoculate strain GZUAS831026 into PDA liquid medium and culture in a shake flask at 28℃ and 180rpm / min for 3 days. Centrifuge the culture at 10000rpm at 4℃ for 10min, and the supernatant is the fermentation broth. Dilute the fermentation broth 100 times with sterile purified water before use.

[0129] (2) Select plump, uniform-sized, and disease-free corn seeds. Soak them in a 1% sodium hypochlorite solution for 10 seconds, rinse them 3-4 times with sterile purified water, and dry them. Lay 4 layers of sterile gauze flat in a petri dish, place the seeds on the gauze, spray with sterile purified water, and germinate at 26℃ in the dark (12h). After germination, select seedlings with good and uniform growth and transplant them.

[0130] (3) The experiment set up an experimental group and a control group, with 3 replicates in each group and 30 seedlings in each replicate. Each seedling was irrigated with 20 mL of diluted fermentation solution. Foliar fertilizer was sprayed once every 5 days, with the dripping water from the leaves as the standard. An equal amount of sterile purified water was used as the control group. The growth status of the plants was observed and the growth indicators of the plants were measured at 20 days. The results are shown in Table 2.

[0131] Table 2. Results of the growth-promoting effect of fermentation broth of strain GZUAS831026 on maize plants.

[0132]

[0133] Table 2 shows that the fermentation broth of strain GZUAS831026 has a significant growth-promoting effect on maize plants. A comparison of the growth of the experimental group and the control group is shown below. Figure 5 .

[0134] 4.3 Effect of strain GZUAS831026 on the growth-promoting effect of rapeseed

[0135] (1) Inoculate strain GZUAS831026 into PDA liquid medium and culture in a shake flask at 28℃ and 180rpm / min for 3 days. Centrifuge the culture at 10000rpm at 4℃ for 10min, and the supernatant is the fermentation broth. Dilute the fermentation broth 100 times with sterile purified water before use.

[0136] (2) Select plump, uniform-sized, and disease-free rapeseed seeds. Soak them in a 1% sodium hypochlorite solution for 10 seconds, rinse them 3-4 times with sterile purified water, and dry them. Lay 4 layers of sterile gauze flat in a petri dish, place the seeds on the gauze, spray with sterile purified water, and germinate at 26℃ in the dark (12h). After germination, select seedlings with good and uniform growth and transplant them.

[0137] (3) The experiment set up an experimental group and a control group, with 3 replicates in each group and 30 seedlings in each replicate. Each seedling was irrigated with 20 mL of diluted fermentation solution. Foliar fertilizer was sprayed once every 5 days, with the dripping water from the leaves as the standard. An equal amount of sterile purified water was used as the control group. The growth status of the plants was observed and the growth indicators of the plants were measured at 20 days. The results are shown in Table 3.

[0138] Table 3. Results of the growth-promoting effect of fermentation broth of strain GZUAS831026 on rapeseed plants.

[0139]

[0140] Table 3 shows that the fermentation broth of strain GZUAS831026 has a significant growth-promoting effect on rapeseed plants. A comparison of the growth of the experimental group and the control group is shown below. Figure 6 .

[0141] 5. Investigation on the anti-ginger rhizome rot effect of Trichoderma virens GZUAS831026

[0142] 5.1 Antagonistic test between strain GZUAS831026 and Erwinia billingiae, the pathogen of ginger tuber rot.

[0143] (1) Inoculate strain GZUAS831026 into PDA liquid medium and culture it in a shake flask at 28℃ and 180rpm / min for 3 days. Take the culture liquid and centrifuge at 10000r at 4℃ for 10min. The supernatant is the fermentation liquid.

[0144] (2) The pathogen Erwinia bifurcata was streaked onto LB agar medium and incubated at 28°C for 36 hours to activate it. The activated bacteria were then prepared to a concentration of 1×10⁻⁶. 6 CFU / mL bacterial suspension.

[0145] (3) Prepare LB solid medium. After sterilization, when the medium cools to 50°C, add 25 μL of bacterial suspension to every 50 mL of medium, mix well and let stand to solidify.

[0146] (4) After the culture medium solidifies, punch a hole in the center of the culture medium with a hole puncher, inject 100 μL of fermentation broth into the hole, and place it in a constant temperature incubator at 28℃ for 24 h after the fermentation broth has been completely absorbed. Observe the experimental results and calculate the inhibition index. The calculation formula is as follows: Inhibition index = (diameter of inhibition zone - diameter of hole) / diameter of inhibition zone.

[0147] (5) Results are as follows Figure 7 As shown, strain GZUAS831026 has an inhibition index of 2.11 against the pathogen Erwinia bifurcata.

[0148] 5.2 Application of strain GZUAS831026 in the prevention and control of ginger tuber rot disease

[0149] (1) Inoculate strain GZUAS831026 into PDA liquid medium and culture it in a shake flask at 28℃ and 180rpm / min for 3 days. Take the culture medium and centrifuge at 10000r at 4℃ for 10min. The supernatant is the fermentation broth. When using it, dilute the fermentation broth 100 times with sterile purified water.

[0150] (2) Dilute the pathogen of ginger tuber rot, Erwinia billingiae, to 1×10⁻⁶. 8 Mix CFU / mL with nutrient soil at a volume ratio of 1:10. Select healthy ginger seeds that have already sprouted, disinfect the surface of the ginger seeds with an alcohol swab, break the ginger to make a wound, and bury it in nutrient soil mixed with pathogens.

[0151] (3) 60 mL of diluted fermentation broth of each ginger seedling root irrigation strain GZUAS831026 was used as a control group with the same volume of sterile water used for root irrigation.

[0152] (4) Three ginger plants were used for each treatment, with three replicates. The disease index and control effect were statistically analyzed after 20 days.

[0153] (5) The disease index grading standard for ginger tuber rot is as follows:

[0154] Level 1: No disease or almost no disease, represented by a value of 0;

[0155] Level 2: Less than 25% of the part is soft and rotten, with a representative value of 1;

[0156] Level 3: Soft rot accounts for 25%-50%, with a representative value of 2;

[0157] Level 4: Soft rot exceeds 50%, with a representative value of 3.

[0158] (6) The formulas for calculating the incidence rate, disease index, and prevention and control effectiveness are as follows:

[0159] Incidence rate (%) = (Number of diseased plants / Total number of plants) × 100;

[0160] Disease index = 100 × ∑(number of plants at each disease level × representative value at each level) / (total number of plants surveyed × highest representative value);

[0161] Prevention and control effect (%) = 100 × (disease index of control group - disease index of treatment group) / disease index of control group.

[0162] (7) As shown in Table 4, the incidence rate and disease index of the potted plant experimental group were significantly lower than those of the control group, and the control efficacy was 71.39%.

[0163] Table 4. Results of the control efficacy of strain GZUAS831026 against ginger tuber rot.

[0164]

[0165] 6. ITS rRNA gene sequence of Trichoderma virens strain GZUAS831026

[0166] CGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTATTGTATA CCCCCTCGCGGGTTTTTTACTATCTGAGCCATCTCGGCGCCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAG AATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTTTACGGGGCCGGCCCCGAAAT ACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCCAAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATA

[0167] Although the present invention has been described in detail above with general descriptions, specific embodiments, and experiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A strain of *Trichoderma virens* GZUAS831026, characterized in that, The Trichoderma virens strain GZUAS831026 is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 65370.

2. The application of the *Trichoderma virens* strain GZUAS831026 as described in claim 1, characterized in that, Application of the Trichoderma virens strain GZUAS831026 in the preparation of chili straw degradation agent.

3. The application of the *Trichoderma virens* strain GZUAS831026 as described in claim 1, characterized in that, Application of the Trichoderma virens strain GZUAS831026 in the preparation of growth promoters for maize and rapeseed.

4. The application of the *Trichoderma virens* strain GZUAS831026 as described in claim 1, characterized in that, The application of the *Trichoderma virens* strain GZUAS831026 in the preparation of a control agent for ginger tuber rot; the ginger tuber rot is caused by *Erwinia bifurcaria*.

Citation Information

Patent Citations

  • Trichoderma viride strain, and applications thereof

    CN105647813A

  • Microorganism bacterium agent for preventing and treating ginger basal stem rot and preparation method and application thereof

    CN107212021A

  • Trichoderma atroviride Ta102, multifunctional organic fertilizer and application thereof

    CN115820433A

  • Trichoderma aureoviride strain, trichoderma aureoviride agent and preparation method and application thereof

    CN118460383A

  • Trichoderma asperellum HM-8 and application thereof

    CN118995429A