Method for nucleic acid u-turn self-priming amplification and application thereof

Abstract

The application provides a method for U-type self-rotation amplification of nucleic acid and application thereof, and belongs to the field of molecular biology. The method comprises the following steps: adding a specific adapter to the 3' end of a single-stranded nucleic acid, wherein the specific adapter comprises a hairpin structure and an adapter sequence which is used for complementary binding with the 3' end of the single-stranded nucleic acid; after the single-stranded nucleic acid is combined with the specific adapter, the single-stranded nucleic acid is extended from the 3' end of the single-stranded nucleic acid by using the specific adapter as a template, the extended single-stranded nucleic acid has the hairpin structure, so as to form a self-rotation, and then the original single-stranded nucleic acid is used as a template to extend and amplify to form an amplification product. The method for U-type self-rotation amplification of nucleic acid provided by the application uses the original single-stranded nucleic acid as a template to efficiently convert a single-stranded DNA molecule into a double-stranded DNA molecule, and all sequence information of the single-stranded DNA molecule, including the 5' and 3' ends, is completely retained, so that the library construction efficiency of a single-stranded or damaged nucleic acid molecule can be greatly improved, and the sequencing cost can be greatly saved.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to a method for U-shaped self-rotation amplification of nucleic acids and its application. Background Technology

[0002] Single-stranded DNA (ssDNA) plays a crucial role in molecular biology research, but double-stranded DNA (dsDNA) is more commonly used in many experiments. Converting single-stranded DNA to double-stranded DNA is a key step in gene cloning, sequencing, and mutation analysis. In vitro synthesis is a classic and efficient method that converts single-stranded DNA into double-stranded DNA through enzymatic reactions. It uses single-stranded DNA as a template, guided by primers, to synthesize a complementary strand, ultimately forming double-stranded DNA. Its core principle is the catalytic action of DNA polymerase, using single-stranded DNA as a template and deoxynucleoside triphosphates (dNTPs) as raw materials to synthesize a DNA strand complementary to the template.

[0003] Although in vitro synthesis is an efficient and widely used method for converting single-stranded DNA into double-stranded DNA, it also has some limitations and drawbacks. The main disadvantages of in vitro synthesis are as follows:

[0004] 1) Primer design dependency: Improper primer design may lead to non-specific amplification or synthesis failure; primer design may be very difficult for complex templates (such as single-stranded DNA rich in secondary structures); effective primer design cannot be provided for templates with unknown sequences; if random primers are used, some single-stranded 3' end sequences may not be converted into double strands.

[0005] 2) Limitations of DNA polymerases: Some DNA polymerases (such as Taq polymerase) lack 3'→5' exonuclease activity, which may lead to synthesis errors; high-fidelity polymerases (such as Pfu polymerase) have a low error rate, but their synthesis rate is slow; polymerases are sensitive to the secondary structure of the template, which may lead to synthesis interruption.

[0006] 3) Dependence on template quality: Impure or degraded templates will significantly reduce synthesis efficiency; long single-stranded DNA fragments have lower synthesis efficiency and are prone to producing incomplete products;

[0007] 4) Optimization of reaction conditions: Temperature, pH, ion concentration, and other conditions need to be strictly optimized, otherwise the synthesis may fail; for different templates, the reaction conditions may need to be adjusted repeatedly.

[0008] 5) Non-specific amplification: Non-specific amplification reduces the yield and purity of the target product; it requires gel electrophoresis or purification steps to remove non-specific products, increasing experimental complexity.

[0009] In summary, while in vitro synthesis is a highly efficient method for converting single-stranded DNA to double-stranded DNA, its application is limited by drawbacks such as reliance on primer design, limitations imposed by DNA polymerase, high requirements for template quality, and the need for optimized reaction conditions. In particular, it cannot convert some single-stranded 3' ends to double strands, resulting in information loss. Furthermore, the addition of extension primers produces non-specific products, causing problems for subsequent experiments.

[0010] Existing synthetic methods cannot add a specific adapter sequence to the 3' end of the original single-stranded DNA strand and simultaneously convert it into double-stranded DNA.

[0011] Next-generation sequencing (NGS) is a high-throughput DNA sequencing technology that can sequence a large number of DNA molecules in parallel, thereby obtaining a large amount of genetic information quickly and at low cost. NGS technology has applications in many fields, including but not limited to whole-genome sequencing, targeted region sequencing, RNA sequencing (RNA-Seq), epigenetics research, cancer genomics, and microbiome research.

[0012] The current difficulties and challenges in constructing next-generation sequencing (NGS) libraries are as follows: Constructing an NGS library involves ligating adapter sequences to DNA fragments. These adapters provide the key sequences necessary for sequencing primers, sample identification, and PCR amplification to generate a sufficient library volume for sequencing runs. Adding adapters is a significant challenge, typically requiring high-quality double-stranded DNA as input for successful results. However, different sample types present challenges for adapter addition, such as low-quality / low-volume DNA, formaldehyde-fixed paraffin-embedded (FFPE) DNA or other damaged DNA, circulating cell-free DNA, etc. These factors can lead to reduced library yield, sequencing failures, or result bias.

[0013] There are currently two main methods for attaching adapters to DNA molecules:

[0014] 1. Connection: This can be the connection between a double-stranded or single-stranded linker and the template molecule.

[0015] 2. Extension: This involves using a primer containing a adapter, which binds to the template DNA strand and extends to replicate the template sequence. Sometimes, a combination of extension and ligation is used to connect the adapter to both ends.

[0016] However, each of the above methods has its limitations:

[0017] • Double-strand ligation: Requires clean, blunt-ended DNA or DNA with an A-protruding base at the end. Preparing these ends involves a complex, multi-step workflow using multiple enzymes. This process can also tamper with the original molecule and introduce mutations, affecting DNA methylation information. Furthermore, ligation requires high concentrations of DNA ligases, which can lead to adapter dimer formation and reduced sequencing efficiency.

[0018] • Single-strand ligation: While this method may be necessary for certain specific applications, such as analyzing archaeological DNA or bisulfite-treated DNA, it is generally less efficient and more laborious than double-strand ligation.

[0019] • Random primer extension: This method is simpler and avoids multiple enzymatic reactions. However, it may introduce bias and lack specificity. Furthermore, it may fail to retain crucial information from the original DNA molecule, such as fragment length, start / stop locations, and DNA methylation patterns.

[0020] In summary, current methods for adding adapters during NGS library preparation have limitations, especially when dealing with challenging samples. Improved techniques are needed to offer greater efficiency, reduce bias, and better preserve original DNA information.

[0021] Constructing next-generation sequencing (NGS) libraries from double-stranded DNA (dsDNA) is a common method in genome research. However, some potential problems may arise during library preparation that could affect the quality and usability of sequencing data. Below are some common issues encountered when preparing dsDNA NGS libraries:

[0022] 1. Connector connection efficiency:

[0023] Inefficient adapter ligation can result in lower yields of usable library fragments. This can occur if sequence specificity affects end repair, leading to poor adapter ligation, or due to problems with the ligation response itself (such as suboptimal ligation conditions in different samples).

[0024] 2. End-of-pipe repair issues:

[0025] End-repair steps may introduce sequence errors during DNA strand repair through polymerase extension, gap translation, or other means, and may result in the loss of DNA methylation.

[0026] 3. Low DNA input:

[0027] Libraries prepared from small amounts of starting material may encounter problems such as higher error rates and lower complexity due to the excessive PCR cycles required.

[0028] 4. Formation of the connector dimer:

[0029] During PCR, adapter dimers may form, and these dimers may be amplified along with the library. They consume sequencing capacity without containing useful sequence information.

[0030] 5. Fragment loss:

[0031] Vulnerable or degradable DNA (such as FFPE DNA, which also contains a large amount of single-stranded DNA) may result in significant material loss during library preparation, leading to reduced library yield.

[0032] 6. Loss of single-stranded DNA (ssDNA):

[0033] The ssDNA in the sample cannot be linked in the double-stranded system, resulting in information loss and thus affecting the research results.

[0034] Preparing NGS libraries from single-stranded DNA (ssDNA) can present more challenges compared to preparing them from double-stranded DNA (dsDNA). Here are some common issues encountered when preparing ssDNA NGS libraries:

[0035] 1. Adapter sub-connection efficiency:

[0036] Adapters are typically designed to attach efficiently to the ends of dsDNA. Attaching adapters to ssDNA is generally less efficient due to the structural and kinetic differences between ssDNA and dsDNA.

[0037] 2. Formation of secondary structure:

[0038] Single-stranded DNA can form hairpin loops and other secondary structures that may hinder aptamer ligation or PCR amplification.

[0039] 3. Low yield:

[0040] ssDNA is more easily degraded than dsDNA, which may result in lower yields during library preparation.

[0041] 4. Processing and Operation:

[0042] ssDNA is more susceptible to degradation by nucleases and requires careful handling to prevent damage during preparation.

[0043] 5. Convert to double-stranded DNA:

[0044] Some library preparation protocols require the conversion of ssDNA to dsDNA, which may introduce errors in the synthesis steps.

[0045] 6. Formation of aptamer dimers:

[0046] ssDNA may increase the formation of adapter dimers during PCR amplification, which wastes sequencing capacity.

[0047] 7. The complexity of the document library:

[0048] If the ssDNA originates from a complex mixture, maintaining the complexity of the library during preparation can be difficult because there may be a loss of sequence representativeness.

[0049] Current library construction methods require separate DNA extraction and quantification steps before processing raw samples (such as cell lysates, blood, or plasma). This significantly increases workload and cost, and can become a bottleneck for large-scale studies. Summary of the Invention

[0050] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide a method for nucleic acid U-shaped self-rotation amplification and its application, in order to solve the problems in the prior art.

[0051] To achieve the above and other related objectives, the present invention first provides a method for U-shaped self-rotation amplification of nucleic acids. The method involves adding a specific adapter to the 3' end of a single-stranded nucleic acid. The specific adapter includes a hairpin structure and a linker sequence, the linker sequence being used to bind complementary to the 3' end of the single-stranded nucleic acid. After the single-stranded nucleic acid binds to the specific adapter, it is extended from the 3' end of the single-stranded nucleic acid using the specific adapter as a template. The extended single-stranded nucleic acid has a hairpin structure to form self-rotation, and then the original single-stranded nucleic acid is used as a template for further extension and amplification to form an amplification product.

[0052] The present invention also provides the use of the above methods in DNA amplification, library construction, qPCR detection, ddPCR detection, DNA methylation detection, second-generation sequencing, third-generation sequencing and / or fourth-generation sequencing.

[0053] The present invention also provides a nucleic acid molecular adapter, the nucleic acid molecular adapter comprising a first adapter, the first adapter comprising a hairpin structure and a random sequence, the hairpin structure comprising a stem region and a loop region, the two strands of the stem region being complementary, the two strands of the stem region being an adapter template and an adapter sequence complementary to the adapter template, respectively, the random sequence being connected to the end of the adapter template, the random sequence comprising a sequence complementary to the 3' end portion of the nucleic acid molecule to be tested.

[0054] The present invention also provides the use of the nucleic acid molecular adapter in the addition of adapters to nucleic acid molecules to be tested or in the preparation of DNA library construction products.

[0055] The present invention also provides a DNA library construction kit, the kit including the nucleic acid molecular adapter, and further including any one or more of the following: nucleic acid polymerase, library construction reagent, nucleic acid purification reagent, and single-stranded nuclease.

[0056] This invention also provides a method for constructing an NGS library by U-shaped self-rotation amplification of nucleic acids, the method comprising the following steps:

[0057] 1) The nucleic acid molecule to be tested, a nucleic acid polymerase with strand displacement activity, and the first adapter are mixed and reacted to copy the adapter sequence to the 3' end of the original strand of the nucleic acid molecule to be tested;

[0058] 2) Synthesize the complementary strand of the original strand of the nucleic acid molecule to be tested so that the nucleic acid molecule to be tested forms a double strand;

[0059] 3) The product of step 2), the second adapter, and the DNA ligase are mixed and reacted to add the second adapter to the original strand and / or synthetic strand of the nucleic acid molecule to be tested.

[0060] 4) The product from step 3) is purified with magnetic beads, then mixed with PCR amplification reagents and subjected to PCR reaction to obtain an NGS library containing the target nucleic acid molecule with a dual-end adapter structure and / or its complementary strand.

[0061] This invention also provides a method for constructing an NGS library by U-shaped self-rotation amplification of nucleic acids, the method comprising the following steps:

[0062] 1) The double-stranded nucleic acid molecule to be tested, transposase, and second adapter are mixed and reacted to add the second adapter sequence to the 5' end of the nucleic acid molecule to be tested; the second adapter is a hairpin structure and has an ME sequence;

[0063] 2) Denaturation to convert the product from step 1) into a single strand, resulting in a single-stranded nucleic acid molecule to be tested with a second adapter;

[0064] 3) The single-stranded nucleic acid molecule to be tested, the nucleic acid polymerase with strand displacement activity, and the first adapter are mixed and reacted to copy the first adapter sequence to the 3' end of the nucleic acid molecule to be tested;

[0065] 4) Synthesize the complementary strand of the original strand of the nucleic acid molecule to be tested so that the nucleic acid molecule to be tested forms a double strand;

[0066] 5) The product from step 4) is purified with magnetic beads, then mixed with PCR amplification reagents and subjected to PCR reaction to obtain an NGS library containing the target nucleic acid molecule with a dual-end adapter structure and / or its complementary strand.

[0067] The present invention also provides an NGS library prepared by the method for constructing the NGS library.

[0068] As described above, the present invention provides a method for U-shaped self-rotation amplification of nucleic acids and its application, which has the following beneficial effects: Unlike the prior art, which only has two methods to add adapter sequences, namely double-stranded / single-stranded ligation, or by extending random primers or sequence-specific primers with adapter sequences to add adapter sequences to the replicating strand rather than the original strand, the present invention adds adapter sequences to the original strand rather than the replicating strand of the nucleic acid molecule being tested by extending the adapter with random primers on the nucleic acid molecule being tested.

[0069] This invention can efficiently convert single-stranded DNA molecules into double-stranded DNA molecules, simultaneously transforming the original single-copy DNA into two copies. During the conversion, all sequence information of the single-stranded DNA molecule, including the 5' and 3' ends, is completely preserved. No amplification primers are required, completely avoiding the formation of primer dimers and multimers. The conversion relies entirely on the extension of the 3' end sequence inherent in the single-stranded DNA molecule, achieving self-amplification without primers. For a single double-stranded DNA molecule, this invention can amplify both single strands separately to obtain two double-stranded DNA molecules without the need for amplification primers, while retaining all sequence information of each single-stranded DNA molecule, including the 5' and 3' ends. This application is of great significance for research on damaged double-stranded DNA; it also includes:

[0070] 1) Compared with traditional single-stranded library construction methods, this invention significantly improves the efficiency of adapter addition or library construction for single-stranded or damaged nucleic acid molecules;

[0071] 2) Enables single-tube library construction, eliminating the need for tube switching during experiments, greatly simplifying experimental operations. Convenient, efficient, and automated operation;

[0072] 3) The prepared library does not produce primer dimers, which greatly saves sequencing costs;

[0073] 4) This invention can be used for DNA methylation research. Sulfite-treated DNA is highly susceptible to breakage. This invention converts sulfite-treated single-stranded DNA into double-stranded DNA, making the structure of the sulfite-treated DNA more stable and thus protected. Simultaneously, the extended complementary strand completely retains the information from the original sulfite-treated DNA. Since the extended complementary strand has not undergone sulfite treatment and has not been subjected to severe chemical damage, its structure is more stable than that of sulfite-treated DNA.

[0074] 5) Can be used to construct NGS libraries from FFPE DNA;

[0075] 6) This invention can be used to construct NGS libraries from ancient DNA. Ancient DNA is often extremely low in content, extensively damaged, and highly degraded: ancient DNA is typically broken down into short fragments, usually between 50-200 nucleotides in length. This invention converts single-stranded ancient DNA into double-stranded DNA, multiplying the information contained within the ancient DNA. Simultaneously, the conversion to a double-stranded DNA structure makes the ancient DNA structure more stable, thus providing protection. The extended complementary strand completely preserves the information of the ancient DNA. The extended complementary strand is a newly synthesized strand, unaffected by severe damage, and structurally more stable than the ancient DNA structure; greatly improving the success rate of research.

[0076] 7) It can achieve blood extraction-free direct construction of whole-genome NGS libraries;

[0077] 8) It can directly construct whole-genome NGS libraries from blood card samples without extraction;

[0078] 9) It can achieve plasma extraction-free, direct NGS library construction;

[0079] 10) It can achieve plasma library construction without extraction from pregnant women and complete NIPT NGS sequencing detection;

[0080] 11) It can achieve plasma extraction-free construction of plasma cfDNA bisulfite treated (BS Treatment) NGS libraries for methylation sequencing;

[0081] 12) Enables direct NGS library creation for FFPE slides. Attached Figure Description

[0082] Figure 1 This diagram illustrates the principle of the connector addition in this invention. Figure 1 .

[0083] Figure 2 This diagram illustrates the principle of the connector addition in this invention. Figure 2 .

[0084] Figure 3 The diagram shows the results of the NGS library constructed in Example 1; qsep400 spectrum (A); results without dimers (B).

[0085] Figure 4 This is a flowchart showing the process of directly building a library from FFPE raw samples.

[0086] Figure 5 The following are displayed: qsep400 map of the constructed NGS library; qsep400 map of the constructed NGS library in Example 2 (A); qsep400 map of the constructed NGS library in Example 3 (B).

[0087] Figure 6This is a flowchart showing the process of directly building a library from blood samples.

[0088] Figure 7 The results are shown in the NGS library constructed in Example 4; qsep400 spectrum (A); and agarose gel electrophoresis results (B).

[0089] Figure 8 This is a flowchart showing the direct library construction of plasma samples.

[0090] Figure 9 The results of agarose gel electrophoresis of the NGS library constructed in Example 5 are shown.

[0091] Figure 10 This diagram illustrates the principle of the connector addition in this invention. Figure 3 .

[0092] Figure 11 This diagram illustrates the principle of the connector addition in this invention. Figure 4 .

[0093] Figure 12 The results of agarose gel electrophoresis of the NGS library constructed in Example 6 are shown.

[0094] Figure 13 The results are shown in the schematic diagram of the NGS library constructed in Example 7; agarose gel electrophoresis results (A); and the qsep400 spectrum of the constructed NGS library (B).

[0095] Figure 14 The results are shown in the following diagrams: NGS library constructed in Example 8; agarose gel electrophoresis results (A); qsep400 map of NIPT positive DNA library (B); qsep400 map of NIPT negative DNA library (C).

[0096] Figure 15 This shows the direct construction of methylation sequencing libraries from raw plasma samples.

[0097] Figure 16 The results are shown in the schematic diagram of the NGS library constructed in Example 9; agarose gel electrophoresis results (A); NGS library qsep400 spectrum (B).

[0098] Figure 17 This is shown as FFPE DNA library construction method two.

[0099] Figure 18 A shows the agarose gel electrophoresis results of the NGS library constructed in Example 10.

[0100] Figure 18 B shows the agarose gel electrophoresis results of the NGS library constructed in Example 11.

[0101] Figure 19 The diagram shows the results of the NGS library constructed in Example 11; qsep400 map (A); length distribution map of the constructed NGS library (B). Detailed Implementation

[0102] The present invention first provides a method for U-shaped self-rotation amplification of nucleic acids, wherein the method involves adding a specific adapter to the 3' end of a single-stranded nucleic acid, the specific adapter including a hairpin structure and an adapter sequence, the adapter sequence being used to bind complementary to the 3' end of the single-stranded nucleic acid;

[0103] After the single-stranded nucleic acid binds to the specific adapter, it extends from the 3' end of the single-stranded nucleic acid using the specific adapter as a template. The extended single-stranded nucleic acid has a hairpin structure to form a self-rotation. Then, it is extended and amplified using the original single-stranded nucleic acid as a template to form an amplification product.

[0104] In some embodiments of the present invention, the hairpin structure includes a stem region and a loop region, with the two strands in the stem region being complementary. Preferably, the sequence length of the stem region is 5–40 bp; preferably, the sequence of the loop region is TTTTT, AAAAAA, ACTCTTTCCCTA, or AATAA.

[0105] In a preferred embodiment of the present invention, the two chains in the stem region are a joint template and a joint sequence, the joint template and the joint sequence are complementary, and the joint sequence is connected to the end of the joint template.

[0106] In some embodiments of the present invention, the single-stranded nucleic acid is selected from DNA or RNA.

[0107] In some embodiments of the present invention, the 3' end of the single-stranded nucleic acid includes the natural 3' end of the single-stranded nucleic acid or a 3' end that has been extended or modified. For example... Figure 1 In the illustrated embodiment, the natural 3' end of the single-stranded nucleic acid binds complementary to the linker sequence. After complementary binding, the single-stranded nucleic acid extends using a hairpin structure as a template. The extended single-stranded nucleic acid carries the hairpin structure to form a self-rotation pattern, and then the original single-stranded nucleic acid is used as a template for further extension and amplification to form the amplification product. Figure 10 or Figure 11 In the embodiment shown, the end of the single-stranded nucleic acid is first extended. The 3' end of the extended and modified nucleic acid binds complementary to the linker sequence. After complementary binding, the single-stranded nucleic acid is extended using a hairpin structure as a template. The extended single-stranded nucleic acid has a hairpin structure to form a self-rotation. Then, the original single-stranded nucleic acid is used as a template for extension and amplification to form an amplification product.

[0108] In some embodiments of the present invention, the adapter template is selected from sequencing primer binding sites, protein binding sequences, or promoter sequences. Preferably, the sequence of the sequencing primer binding site is selected from partial or full-length sequences of sequencing primer binding sites R1, R2, or their respective complementary sequences R1', R2'.

[0109] In some embodiments of the invention, the linker sequence consists of 6 to 25 degenerate bases N. The degenerate base "N" can represent any one of A, T, C, or G.

[0110] In some embodiments of the present invention, the 3' end of the linker sequence is provided with a blocking group, which is a 3' terminal hydroxyl active blocking group. Preferably, the blocking group is selected from NH2 modification, MGB modification, Spacer modification, ddNTP, phosphate group, Cy3, Cy5, VIC, FAM, BHQ1 or BHQ2.

[0111] The specific adapter includes a sequencing primer binding site R1, a circular structure, a sequence R1' complementary to the sequencing primer binding site R1, an adapter sequence, and a blocking group; or, the specific adapter includes a sequencing primer binding site R2, a circular structure, a sequence R2' complementary to the sequencing primer binding site R2, an adapter sequence, and a blocking group.

[0112] The present invention also provides the use of the above methods in DNA amplification, library construction, qPCR detection, ddPCR detection, DNA methylation detection, second-generation sequencing, third-generation sequencing and / or fourth-generation sequencing.

[0113] The present invention also provides a nucleic acid molecular adapter, the nucleic acid molecular adapter comprising a first adapter, the first adapter comprising a hairpin structure and a random sequence, the hairpin structure comprising a stem region and a loop region, the two strands of the stem region being complementary, the two strands of the stem region being an adapter template and an adapter sequence respectively, the adapter template and the adapter sequence being complementary, the random sequence being connected to the end of the adapter template, the random sequence comprising a sequence complementary to the 3' end portion of the nucleic acid molecule to be tested.

[0114] In this invention, "the random sequence includes a sequence complementary to the 3' end portion of the nucleic acid molecule to be tested" means that the random sequence can bind to the 3' end of the nucleic acid molecule to be tested through complementary base pairing; that is, the random sequence is used to bind complementary to the 3' end of the nucleic acid molecule to be tested. Depending on the specific application, the random sequence can be designed using the following two implementation methods:

[0115] In some embodiments, the random sequence is a completely randomized design. In this embodiment, by designing a sufficient number of random sequence combinations, it is ensured that the nucleic acid molecule to be tested can find a complementary sequence that matches it. When the random sequence binds to the 3' end of the nucleic acid molecule to be tested, the two form a local double-stranded structure, allowing the nucleic acid molecule to extend from the 3' end using the hairpin structure as a template.

[0116] In other embodiments, the random sequence is designed to complement the 3' end sequence of the nucleic acid molecule to be tested. Its sequence composition has a definite complementary relationship with the 3' end extension sequence of the target nucleic acid molecule. When the random sequence combines with the 3' end extension sequence of the nucleic acid molecule to be tested, the two form a local double-stranded structure, so that the nucleic acid molecule to be tested can extend from the 3' end using the hairpin structure as a template.

[0117] The 3' end of the nucleic acid molecule to be tested includes the natural 3' end or the extended 3' end. The natural 3' end refers to the 3' end of the nucleic acid molecule to be tested that has not been artificially modified; the extended 3' end refers to the structure formed by adding nucleotides to the natural 3' end through polymerase (such as terminal transferase), ligase or chemical synthesis.

[0118] In some embodiments of the invention, the extended modified sequence consists of 2 to 30 degenerate bases N. The degenerate base "N" can represent any one of A, T, C, or G.

[0119] The nucleic acid molecules to be tested are selected from DNA or RNA.

[0120] The adapter template is an arbitrary sequence, that is, any sequence that is to be attached to the nucleic acid molecule to be tested according to the experimental purpose.

[0121] The adapter template is selected from sequencing primer binding sites, protein binding sequences, or promoter sequences, etc. The promoter sequence is, for example, part or all of the T7 promoter sequence.

[0122] The sequencing primer binding site is the region where the sequencing primer binds during the sequencing process, and is used to indicate the position where the sequence reading begins.

[0123] The sequencing primer binding site is selected from sequencing primer binding sites R1, R2, or their respective complementary sequences R1' or R2'. In this invention... Figure 1 , Figure 2 , Figure 10 and Figure 11 In the embodiment shown, the sequencing binding site R1 or R2 is the adapter sequence, and the complementary sequence R1' or R2' of each is the adapter template.

[0124] R1 stands for Rd1 SP. In existing technologies, Rd1 SP (Read1 Sequencing Primer) is the primer binding site used for first-strand sequencing. It is usually located at one end of the DNA fragment. During sequencing, the sequencing primer binds to this site to begin sequencing the first strand of the DNA fragment.

[0125] R2 stands for Rd2 SP. In existing technologies, Rd2 SP (Read2 Sequencing Primer) is a primer binding site used for second-strand sequencing. It is usually located at the other end of the DNA fragment. In paired-end sequencing, this site is used to read DNA information that is complementary to the first strand.

[0126] The sequence of the sequencing primer binding site is selected from a partial or full-length sequence of the sequencing primer binding sites R1, R2 or their respective complementary sequences R1', R2', with a partial sequence being preferred.

[0127] In some embodiments of the present invention, the random sequence consists of 6 to 25 degenerate bases N. The degenerate base "N" can represent any one of A, T, C, or G. In the present invention as... Figure 1 , Figure 2 , Figure 10 , Figure 11 In the embodiments shown in other flowcharts, the 3' end of the random sequence is provided with a blocking group, which is a 3' terminal hydroxyl active blocking group of the nucleic acid molecule linker.

[0128] In some embodiments of the invention, the blocking group is attached to the last base at the 3' end of the random sequence.

[0129] The blocking group is selected from NH2 modification, MGB modification, spacer modification, ddNTP, phosphate groups, cy3, cy5, VIC, FAM, BHQ1, or BHQ2, etc. The NH2 modification is, for example, NH2-C6 modification, NH2-C7 modification, NH2-C12 modification, etc. The MGB (Minor Groove Binder) is a minor groove binder in the DNA helix, a dihydrocyclopyrrole tripeptide that can selectively bind to the minor groove of the DNA molecule, i.e., the shallow groove in the DNA helix. The spacer modification is, for example, spacer C3 modification.

[0130] like Figure 1 or Figure 2 As shown in Step 1, in some embodiments of the present invention, the first adapter includes a sequencing primer binding site R1, a circular structure, a sequence R1' complementary to the sequencing primer binding site R1, a random sequence, and a blocking group.

[0131] In some embodiments of the present invention, the first adapter includes, from the 5' end to the 3' end, a sequencing primer binding site R1, a circular structure, a sequence R1' complementary to the sequencing primer binding site R1, a random sequence, and a blocking group.

[0132] like Figure 1 or Figure 2 As shown, the first adapter with a hairpin structure partially complements and extends the 3' end of the nucleic acid molecule to be tested. The sequencing primer binding site R1 (using R1 as an example in this section, R2 is similar) in the first adapter is copied to the original strand end of the nucleic acid molecule to be tested. The resulting template sequence has a hairpin structure. This hairpin structure allows the nucleic acid molecule to synthesize a second strand by extending the hairpin structure, thus enabling the synthesis of the contralateral adapter through methods such as double-strand ligation. Nucleic acid molecules with bilateral adapters can be amplified and sequenced using universal primers.

[0133] like Figure 10 As shown in Steps 1 and 2 of section 14, the first adapter with a hairpin structure is complementary to and extends the 3' extension sequence of the nucleic acid molecule to be tested. The sequencing primer binding site R1 in the first adapter (R1 is used as an example in this section, and R2 is similar) is copied to the end of the original strand of the nucleic acid molecule to be tested. The resulting template sequence has a hairpin structure. The hairpin structure allows the nucleic acid molecule to synthesize a second strand by rotating the hairpin structure, thus enabling the nucleic acid molecule to synthesize the contralateral adapter through methods such as double-strand ligation. Nucleic acid molecules with bilateral adapters can be amplified and sequenced using universal primers.

[0134] In some embodiments of the present invention, the sequence length of the first connector stem region is 5 to 40 bp, for example, 5 to 10 bp, 10 to 15 bp, 15 to 20 bp, 20 to 25 bp, 25 to 30 bp, 30 to 35 bp, or 35 to 40 bp.

[0135] The loop region sequence of the first adapter typically contains 3 to 20 nucleotides or more, such as 3 to 5, 5 to 7, 7 to 10, 10 to 15, 15 to 20, 20 to 25 or more nucleotides.

[0136] In some embodiments of the present invention, the ring region sequence only needs to be non-complementary, for example, TTTTT, AAAAAA, ACTCTTTCCCTA, AATAA, etc.

[0137] In some embodiments of the present invention, the nucleic acid molecular adapter further includes a second adapter.

[0138] exist Figure 1 or Figure 11In the embodiment shown, the second connector is a hairpin structure, comprising a stem region and a loop region. The two strands of the stem region are complementary and serve as sequencing primer binding sites. The sequencing primer binding sites are selected from sequencing primer binding sites R1, R2, or their respective complementary sequences R1' or R2'. The sequencing primer binding sites are different from those in the first connector. That is, when the sequencing primer binding sites in the first connector are R1 and / or R1', the sequencing primer binding sites in the second connector are R2 and R2'; when the sequencing primer binding sites in the first connector are R2 and / or R2', the sequencing primer binding sites in the second connector are R1 and R1'.

[0139] In some embodiments of the invention, the second connector has a flat end or an adhesive end.

[0140] In some embodiments of the invention, the end of the second connector with the adhesive end is T and / or C. In one specific embodiment, the 3' end of the second connector with the adhesive end protrudes by a T.

[0141] In some embodiments of the present invention, the length of the stem region of the second connector is typically 5 to 40 bp, for example 5 to 10 bp, 10 to 15 bp, 15 to 20 bp, 20 to 25 bp, 25 to 30 bp, 30 to 35 bp, or 35 to 40 bp.

[0142] In some embodiments of the present invention, the loop region of the second linker typically contains 3 to 10 nucleotides, for example 3 to 5, 5 to 7, or 7 to 10 nucleotides.

[0143] In some embodiments of the present invention, the ring region sequence of the second connector can be ensured to be non-complementary, for example, TTTTT, AACTCCAGTCA, ACTCCAGTC, CTCCAGT or AAAAAA.

[0144] exist Figure 2 or Figure 10 In the illustrated embodiment, the second adapter is a Y-type adapter, which includes a head and a tail. The head and tail each include two strands. The head consists of two non-complementary strands, while the tail consists of two complementary strands. The two strands at the tail are sequencing primer binding sites. The sequencing primer binding sites are selected from sequencing primer binding sites R1, R2, or their respective complementary sequences R1' or R2'. The sequencing primer binding sites are different from the sequencing primer binding sites in the first adapter. That is, when the sequencing primer binding sites in the first adapter are R1 and / or R1', the sequencing primer binding sites in the second adapter are R2 and R2'. When the sequencing primer binding sites in the first adapter are R2 and / or R2', the sequencing primer binding sites in the second adapter are R1 and R1'.

[0145] The head is 2-15 nucleotides or more in length, and the tail is 15-30 nucleotides or more in length.

[0146] In some embodiments, the tail is blunt-ended, meaning the two strands are of equal length. In other embodiments, the tail is sticky-ended, with a T nucleotide protruding from the end of one strand; preferably, a T nucleotide protrudes from the 3' end of the tail; for example, a T nucleotide protrudes from the 3' end of the sequencing primer binding site R2 or R1 at the tail.

[0147] In some embodiments of the present invention, the second connector is free of phosphorylation modification; in other embodiments, the second connector is phosphorylated. Adjustments can be made flexibly based on sample size and specific circumstances during the experiment.

[0148] In this invention, the connector added to the 3' end of the original chain is the first connector, and the connector added to the 5' end of the original chain is the second connector.

[0149] like Figure 2 and Figure 17 In the illustrated embodiment, the second adapter is not phosphorylated and is added to the target nucleic acid molecule, but not to its replication strand. The second adapter functions through the following principle, see details below. Figure 2 In Step 3, the 5' end of the test nucleic acid molecule (original strand) and the replicated strand (synthetic strand) of the test nucleic acid molecule generated by the random primers form a double-stranded structure. The sequencing primer binding site R2 in the unphosphorylated second adapter is added to the original strand using either blunt-end or A / T sticky-end double-strand ligation methods; or see [link to details]. Figure 17 Steps 1 and 2 utilize the transposase function of Tn5 transposase to add an unphosphorylated second adapter to the 5' end of the DNA sequence (ME sequence). Because the second adapter is unphosphorylated, only the original strand can be ligated, creating a nick between the synthetic strand and the second adapter. Due to the Y-shaped design of the second adapter, the correctly oriented R2 sequence (not the complementary R2' sequence) can be added to the original strand. Alternatively, blocking the 3' end of a strand can also ensure the correct orientation of the R2 sequence (not the complementary R2' sequence) is added to the original strand. Figure 1 As shown in step 4, the original strand now has a complete paired-end adapter structure and can be amplified and library constructed using universal primer PCR.

[0150] like Figure 15In the illustrated embodiment, the second adapter contains phosphorylation modification and is added to the target nucleic acid molecule and its replication strand. The second adapter functions through the following principle, see details below. Figure 15 In Step 7, the 5' end of the original strand and the synthetic strand generated by the random primers form a double-stranded structure. The sequencing primer binding site R2' from the second adapter is added to the original strand using either blunt-end or A / T sticky-end double-strand ligation methods, and the sequencing primer binding site R2' from the second adapter is added to the synthetic strand. This results in both the original and synthetic strands having complete double-end adapter structures, both of which can serve as templates for PCR amplification. Universal primer PCR can be used for amplification and library construction.

[0151] The present invention also provides the use of the nucleic acid molecular adapter in the addition of adapters to nucleic acid molecules to be tested or in the preparation of DNA library construction products.

[0152] The nucleic acid molecule to be tested is single-stranded DNA, double-stranded DNA, or RNA.

[0153] The nucleic acid molecules to be tested are derived from blood, plasma, FFPE samples, cell lysates, trace amounts, and damaged DNA samples.

[0154] The present invention also provides a DNA library construction kit, the kit including the nucleic acid molecular adapter, and further including any one or more of the following: nucleic acid polymerase, library construction reagent, nucleic acid purification reagent, and single-stranded nuclease.

[0155] The nucleic acid polymerase is a nucleic acid polymerase with chain substitution activity and / or a nucleic acid polymerase without chain substitution activity.

[0156] The aforementioned nucleic acid polymerases with chain displacement activity can be purchased, for example, Vent(exo-)DNAPolymerase (NEB), SD Polymerase (BIORON), DoGene Waq Polymerase (DoGene), and Deep... (exo–)DNA Polymerase(NEB), Klenow Fragment(3′→5′exo-)(NEB), Bst DNAPolymerase, Large Fragment(NEB), Bst DNA Polymerase(NEB), Bst 3.0DNA Polymerase(NEB).

[0157] The library construction reagents include any one or more of the following: nucleic acid fragmentation reagents, end-completion reagents, A-addition reagents, DNA ligase, Tn5 transposase, phosphorylation reagents, and PCR amplification reagents.

[0158] The PCR amplification reagents include primer sets and PCR reaction premix.

[0159] The library construction reagents can be commercially available kits, such as HRK-CC220-24 from Huaruikang.

[0160] The nucleic acid purification reagent is, for example, magnetic beads, specifically AMPure XP magnetic beads.

[0161] The single-stranded nuclease, such as nuclease S1 or mung bean nuclease, has endonuclease and exonuclease hydrolytic activity on phosphodiester bonds of single-stranded DNA and RNA, producing 5'-mononucleotide and 5'-oligonucleotide end products. These end products can be used to digest unannealed polynucleotide tails and hairpin loops in RNA and DNA duplexes, and can also be used to convert supercoiled DNA into linear form.

[0162] The Tn5 transposase can efficiently insert adapter sequences (with ME sequences) randomly into target DNA fragments, so that each DNA fragment has an adapter sequence at its 5' end.

[0163] This invention also provides a method for constructing an NGS library using nucleic acid U-shaped self-rotation amplification, the method comprising the following steps:

[0164] 1) The nucleic acid molecule to be tested, a nucleic acid polymerase with strand displacement activity, and the first adapter are mixed and reacted to copy the adapter sequence to the 3' end of the original strand of the nucleic acid molecule to be tested;

[0165] 2) Synthesize the complementary strand of the original strand of the nucleic acid molecule to be tested so that the nucleic acid molecule to be tested forms a double strand;

[0166] 3) The product of step 2), the second adapter, and the DNA ligase are mixed and reacted to add the second adapter to the original strand and / or synthetic strand of the nucleic acid molecule to be tested.

[0167] 4) The product from step 3) is purified with magnetic beads, then mixed with PCR amplification reagents and subjected to PCR reaction to obtain an NGS library containing the target nucleic acid molecule with a dual-end adapter structure and / or its complementary strand.

[0168] In some embodiments of the present invention, step 1) further includes extending the 3' end of the nucleic acid molecule to be tested, the terminal deoxynucleotidyl transferase, and dNTPs separately or in combination.

[0169] In some embodiments of the present invention, in step 1), the molar ratio of the nucleic acid molecule to be tested to the terminal deoxynucleotidyl transferase is 1:(0.5-2).

[0170] In some embodiments of the present invention, in step 1), the molar ratio of the nucleic acid molecule to be tested to dNTPs is 1:(10-100). The molar ratio of the nucleic acid molecule to be tested to dNTPs is selected from any of the following ranges: 1:(10-30), 1:(30-50), 1:(50-70), 1:(70-90), 1:(90-100).

[0171] In some embodiments of the present invention, in step 1), the amount of the nucleic acid molecule to be tested is 1 pg to 1000 ug.

[0172] In some embodiments of the present invention, in step 1), the concentration of the nucleic acid polymerase with chain displacement activity is 0.5 U to 20 U.

[0173] In some embodiments of the present invention, in step 1), the concentration of the first connector is 0.5 μM to 5 μM.

[0174] In the present invention as Figure 1 In the illustrated embodiment, denaturation is first used to open the junction between the first adapter and the original strand of the nucleic acid molecule to be tested, and then the complementary strand is synthesized by nucleic acid polymerase to form a double strand. Specifically, in step 2), denaturation is first used to open the junction between the first adapter and the original strand of the nucleic acid molecule to be tested, and the hairpin structure sequence carried on the original strand of the nucleic acid molecule to be tested undergoes a U-turn to form a hairpin structure. The 3' end is then extended by nucleic acid polymerase to synthesize a complementary strand to form a double strand.

[0175] In some embodiments of the present invention, step 3) may further include a DNA ligation buffer for providing a reaction environment for ligating the second adapter. The DNA ligation buffer may be a commercially available reagent, such as HRK-CC220-24.

[0176] In some embodiments of the present invention, in step 3), the second connector is a flat-ended second connector or a sticky-ended second connector.

[0177] In this invention, when the second adapter is blunt-ended, the molar ratio of the second adapter to the nucleic acid molecule to be tested is (20-100):1.

[0178] In this invention, when the second adapter is a sticky end, the molar ratio of the second adapter to the nucleic acid molecule to be tested is (10-50):1.

[0179] In some embodiments of the present invention, in step 3), the reaction conditions are: placed in a PCR instrument at 20°C and reacted for 25 minutes.

[0180] In some embodiments of the present invention, step 3) further includes mixing the nucleic acid molecule to be tested with the second adapter and a single-stranded nuclease to remove the single-stranded portion (i.e., the loop region of the hairpin structure or the head of the Y-shaped structure) in the first adapter and / or the second adapter; in this embodiment, it further includes mixing the reaction buffer with the nucleic acid molecule to be tested with the second adapter and the single-stranded nuclease. Based on the total volume of the reaction system, the final concentration of the nuclease is 0.3–3 U / µl.

[0181] In some embodiments of the present invention, step 4) further includes purifying the PCR product by mixing it with magnetic beads after the PCR reaction is completed.

[0182] This invention also provides another method for constructing an NGS library using nucleic acid U-shaped self-rotation amplification, the method comprising the following steps:

[0183] 1) The double-stranded nucleic acid molecule to be tested, transposase, and second adapter are mixed and reacted to add the second adapter sequence to the 5' end of the nucleic acid molecule to be tested; the second adapter is a hairpin structure and has an ME sequence;

[0184] 2) Denaturation to convert the product from step 1) into a single strand, resulting in a single-stranded nucleic acid molecule to be tested with a second adapter;

[0185] 3) The single-stranded nucleic acid molecule to be tested, the nucleic acid polymerase with strand displacement activity, and the first adapter are mixed and reacted to copy the first adapter sequence to the 3' end of the nucleic acid molecule to be tested;

[0186] 4) Synthesize the complementary strand of the original strand of the nucleic acid molecule to be tested so that the nucleic acid molecule to be tested forms a double strand;

[0187] 5) The product from step 4) is purified with magnetic beads, then mixed with PCR amplification reagents and subjected to PCR reaction to obtain an NGS library containing the target nucleic acid molecule with a dual-end adapter structure and / or its complementary strand.

[0188] In some embodiments of the present invention, step 3) further includes mixing the single-stranded nucleic acid molecule to be tested, the terminal deoxynucleotidyl transferase, and dNTPs before the mixing reaction to extend and modify the 3' end of the nucleic acid molecule to be tested.

[0189] In some embodiments of the present invention, in step 4), the nucleic acid molecule to be tested with the first adapter is mixed with a single-stranded nuclease to remove the single-stranded portion of the first adapter and / or the second adapter.

[0190] The method for constructing an NGS library by adding adapters to the nucleic acid molecules to be tested is not specifically limited in terms of reaction procedures or conditions. It is only necessary to meet the corresponding effects, such as denaturation, extension, and digestion. The specific procedures can be followed according to the instructions provided by the reagent manufacturer.

[0191] The present invention also provides an NGS library prepared by the method for constructing the NGS library.

[0192] This invention also provides the use of the method for constructing NGS libraries in any one or more of the following:

[0193] I. Used for constructing NGS libraries from FFPE DNA;

[0194] II. Used for constructing NGS libraries from ancient DNA;

[0195] III. Enables blood extraction-free construction of whole-genome NGS libraries;

[0196] IV. Enables blood card samples to be extracted without extraction, for direct construction of whole-genome NGS libraries;

[0197] V. Enables plasma extraction-free construction of cfDNA NGS libraries;

[0198] VI. Achieve plasma extraction-free construction of NGS libraries for plasma cfDNA bisulfite treatment for methylation sequencing;

[0199] VII. Enables plasma extraction from pregnant women without extraction, for constructing cffDNA NGS libraries;

[0200] VIII. Enable FFPE slide to directly build NGS libraries.

[0201] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0202] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.

[0203] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0204] Example 1: Short DNA Fragment Library Construction Method 1

[0205] like Figure 1 or Figure 2 As shown, the process includes the following steps: Step 1: Under the action of a nucleic acid polymerase with strand displacement activity, the 3' end of the single-stranded DNA (original strand) forms partial complementarity with the hairpin-structure adapter template R1', which has a 3' random sequence, and extends, replicating the adapter sequence R1 to the end of the original strand. Because the 3' end of the adapter template R1' is blocked by a blocking group, the adapter template will not produce random extension. The hairpin structure further ensures that random extension between adapter templates will not cause adapter dimers;

[0206] Step 2: Through nucleic acid denaturation, the double-stranded structures of the original strand / linker template generated in the previous step are separated. The hairpin structure sequence on the original strand will undergo a U-turn to form a hairpin structure. The 3' end can be further extended by polymerase to synthesize a complementary synthetic strand;

[0207] The experimental steps for Step 1 and Step 2 are as follows: Take 2 μl of 10X Add 2 μl of dNTP Mix (2.5 mM) and 1 μl of Vent(exo-)DNA Polymerase (NEB) to Reaction Buffer, mix with 3.5 μl of 20 μM NAP5-N15 NH2 (sequence shown in SEQ ID NO.1), and add 9.5 μl of water. Incubate at 94 °C for 30 seconds, then cool to 55 °C for 1 minute, and then cool to 4 °C for 1 minute.

[0208] SEQ ID NO.1:

[0209] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0210] Add 2 μL of water containing 10 ng of a 160 bp DNA fragment (a mixture of cellular DNA digestion products); total 20 μL of reaction solution; place on a PCR instrument, and the reaction program is as follows:

[0211]

[0212] Step 3: The synthetic chain generated by the U-turn of the 5' end and 3' end of the original chain forms a double-chain structure. The unphosphorylated second connector R2 (the second connector is a hairpin structure) is connected by a method of flat-end, A / T, or G / C sticky-end double-chain connection. Figure 1 The second connector is a Y-type connector. Figure 2 The second linker is added to the original strand. Since the second linker is not phosphorylated, only the original strand can be joined, creating a nick between the synthetic strand and the second linker. The second linker can be added to the original strand by using a Y-shaped structure design or by blocking the 3' end of a strand, with the correct orientation of the R2 sequence (instead of the complementary R2' sequence) added to the original strand.

[0213] Step 3 is as follows: Add 9 μl of Ligation Buffer and 1.5 μl of DNAligase V3 (HRK-CC220-24) to 20 μl of reaction solution. Simultaneously add 1 μl of TP72 adapter (final concentration 1 μM) with the sequence shown in SEQ ID NO.2 and 1.5 μL of TP7B2 adapter (final concentration 1.5 μM) with the sequence shown in SEQ ID NO.3. Incubate at 20℃ for 25 min in a PCR instrument, then cool to 4℃ until proceeding to the next step.

[0214] SEQ ID NO.2:

[0215] TGACCAAGATCGGAAGAGCACACGTCTGTTTTTCAGACGTGTGCTCTTCCGATCTTGGTCAT

[0216] SEQ ID NO.3:

[0217] CAGTCAAGATCGGAAGAGCACACGTCTGTTTTTCAGACGTGTGCTCTTCCGATCTTGACTG

[0218] Step 4: Digestion with single-stranded nuclease removes the single-stranded portion from the hairpin structure and the single-stranded portion from the second adapter, so that the template strand and the synthetic strand can be separated during denaturation in the next step.

[0219] Step 4 is as follows: Add 8 μl of 5X Reaction Buffer (ThermoScientific EN0321) and 2 μl of S1 nuclease (10 U / μl) to 33 μl of reaction solution. Place in a PCR instrument at 23℃ for 20 min, then cool to 4℃ until proceeding to the next step.

[0220] Step 5: The template strand and the synthetic strand are separated during PCR denaturation. The original strand now has a complete paired-end adapter structure and is amplified and library constructed using universal primers PCR.

[0221] Add 69 μL of Ampure beads to bind DNA and wash twice with 85% ethanol; carefully remove the 85% ethanol wash buffer and air dry at room temperature for 5 minutes.

[0222] Add 18 μl of water, 1.5 μl of mixed primers (LP5-UDI0021 and LP7-UDI0021, each at 10 μM, with sequences as shown in SEQ ID NO.4 and 5, respectively) and 19 μl of 2X HiFiPCR MasterMix (Huaruikang HRK-CC220-24) to the Ampure beads in sequence.

[0223] SEQ ID NO.4:

[0224] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC

[0225] SEQ ID NO.5:

[0226] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT

[0227] Place it on a PCR instrument, and follow the reaction procedure as follows:

[0228]

[0229] The PCR product was purified by adding 54 μL of Ampure beads and eluted with 50 μL of water to obtain an NGS library with intact paired-end adapter structures. The constructed NGS library qsep400 spectrum is shown below. Figure 3 As shown in Figure A.

[0230] 8 μl of the NGS library was subjected to 1% agarose gel electrophoresis at 100 V for 20 minutes. The results are as follows: Figure 3As shown in B, it is demonstrated that no primer dimers are generated in the constructed NGS library.

[0231] The library was sequenced using NovaSeq X Plus, and the sequencing was successful, resulting in data splitting. Sequence analysis showed that the library sequences conformed to human cell sequences.

[0232] Sequencing analysis of Read2 data revealed that 46.05% of the start positions were the sequence TGGTCAT, and 47.62% were the sequence TGACTG. Based on the experimental design, TGGTCAT is the product of TA ligation, while TGACTG is the product of blunt-end ligation. This result strongly demonstrates that our method can ligate DNA products with blunt ends and 3' A protrusions.

[0233] Example 2: Direct library construction using FFPE DNA

[0234] like Figure 4 As shown, Step 1: Pre-process the original sample by treating the sample with chemical reagents to denature proteins and release nucleic acids; remove the proteins and chemical reagents while retaining the DNA;

[0235] Step 2: Randomly bind the sample DNA with primer OH-NNNNUNN, and extend the NNNNNUNN binding site using a polymerase with strand displacement activity. Copy the sample sequence to obtain a 5' end of each molecule containing NNNNNN.

[0236] The experimental steps for Step 2 are as follows: Take 1 μl of 10X Add 1 μl of dNTPMix (2.5 mM) and 0.5 μl of Vent(exo-)DNA Polymerase (NEB) to the reaction buffer, mix with 0.5 μl of 20 μM N8U (sequence: NNNNUNUN), add 4 μl of water, and add 3 μl of FFPE DNA (16 ng / μl). The total reaction solution is 10 μl. Perform the following reaction program on a PCR instrument:

[0237] 98℃ 70s 10℃ 10s 60℃ 10s 72℃ 10s 37℃ 10s

[0238] Step 3: The sample amplification products were treated with UDG and Endonuclease VIII. The U position of each molecule was cleaved. After cleavage, the extended copy molecule yielded an OH-NNNN-P molecule and an extended copy molecule with a 5' phosphate structure. The OH-NNNNUNN random primer failed to extend, and after digestion, an OH-NNNN-P molecule and a P-NN were obtained. Only the extended copy molecule with the 5' phosphate structure could proceed to subsequent experiments after treatment.

[0239] Step 3: Add 1 μl of USER (NEB, M5505S) and place at 37℃ for 20 minutes.

[0240] Step 4: Under the action of a nucleic acid polymerase with chain displacement activity, the 3' end of the extended copy molecule with the 5' phosphate structure partially complements and extends the hairpin-structured linker template R1' with a 3' random sequence, copying the linker sequence R1 to the original chain end. Since the 3' end of the linker template R1' is blocked by a blocking group, the linker template does not undergo random extension. The hairpin structure further ensures that random extension between linker templates does not cause linker dimers.

[0241] Step 5: By denaturing nucleic acid molecules, the double-stranded structure of the original strand / linker template generated in the previous step is separated. The hairpin structure sequence on the original strand will self-turn in a U-shape to form a hairpin structure. The 3' end can be further extended by polymerase to synthesize complementary synthetic strands.

[0242] The experimental procedure is as follows: Add 1 μl of 10X Add 1 μl of dNTP Mix (2.5 mM) and 0.5 μl of Vent (exo-) DNA Polymerase (NEB) to Reaction Buffer, then add 3.5 μl of 20 μM NTP5-N15 NH2 (nucleotide sequence as shown in SEQ ID NO.6), and add 4 μl of water to make a total of 20 μl of reaction solution.

[0243] SEQ ID NO.6 (NTP5-N15 NH2):

[0244] AGATCGGAAGAGCGTCGTTTTTTACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0245] Place it on a PCR instrument, and follow the reaction procedure as follows:

[0246]

[0247] Next, the second adapter was ligated and PCR amplification and library construction were performed in the same manner as in Example 1.

[0248] The experimental steps are as follows:

[0249] 1) Add 9 μl of Ligation Buffer and 1.5 μl of DNA ligase V3 (HRK-CC220-24) to 20 μl of reaction solution. Simultaneously add 1 μl of TP72 adapter (30 μM) and 1.5 μl of TP7B2 adapter (30 μM). Incubate at 20°C for 25 min in a PCR instrument, then cool to 4°C until proceeding to the next step.

[0250] 2) Add 8 μl of 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl of S1 nuclease (10 U / μl) to 33 μl of reaction solution. Incubate at 23°C for 20 min in a PCR instrument, then cool to 4°C until proceeding to the next step.

[0251] 3) Add 69 μL of Ampure beads to bind DNA and wash twice with 85% ethanol; carefully remove the 85% ethanol washing solution and air dry at room temperature for 5 minutes;

[0252] 4) Add 18 μl of water, 1.5 μl of mixed primers (LP5-UDI0021 and LP7-UDI0021, each at 10 μM) and 19 μl of 2X HiFiPCR MasterMix (Huaruikang HRK-CC220-24) to the Ampure beads in sequence;

[0253] Place it on a PCR instrument, and follow the reaction procedure as follows:

[0254]

[0255] 5) Add 54 μL of Ampure beads to purify the PCR product and wash with 50 μL of water;

[0256] The constructed NGS library qsep400 map is as follows Figure 5 As shown in Figure A, the map shows that the DNA length is distributed in the 100bp-1000bp range.

[0257] The library was sequenced using NovaSeq X Plus, and the sequencing was successful, resulting in data splitting. Sequence analysis showed that the library sequence conformed to the human genome sequence.

[0258] Example 3: Adding adapter sequence to the 3' end of the DNA fragment

[0259] Take 1.5 μl of 10X Mix 3 μl of 20 μM UT7-N15 NH2 with Reaction Buffer, add 1.2 μl of dNTP Mix (2.5 mM), and then add 5.8 μl of water. Incubate at 94°C for 30 seconds, then cool to 55°C for 1 minute, and then cool to 4°C for 1 minute. Add 2.5 μL of water containing approximately 10 ng of a 160 bp DNA fragment, and add 1 μl of Vent(exo-)DNAPolymerase (NEB); for a total of 15 μl of reaction solution.

[0260] Place it on a PCR instrument, and follow the reaction procedure as follows:

[0261]

[0262] The above steps correspond to Figure 2 Step 1 and Step 2;

[0263] Add 4 μl of 5X Reaction Buffer (Thermo Scientific EN0321) and 1 μl of S1 nuclease (10 U / μl) to 15 μl of reaction solution. Incubate at 23°C for 20 min in a PCR instrument, then cool to 4°C until proceeding to the next step.

[0264] The above steps correspond to Figure 2 In step 4, the single-stranded portion of the hairpin structure and the second linker is removed by digestion with single-stranded nuclease, so that the template strand and the synthetic strand can be separated during denaturation.

[0265] Add 32 μL of Ampure beads to bind DNA and wash twice with 85% ethanol; carefully remove the 85% ethanol wash solution and air dry at room temperature for 5 minutes;

[0266] Add 20 μl of water to the Ampure beads for elution;

[0267] Sequencing libraries were constructed using the Rapid DNA Library Kit (HRK-CC220-24) according to the instructions.

[0268] Sequencing and sequence analysis were performed using NovaSeq X Plus.

[0269] Library qsep400 atlas as Figure 5 As shown in B, the sequencing results analysis showed that the T7 adapter appeared at the very beginning of either Read1 or Read2, and there were no instances where Read1 and Read2 appeared simultaneously.

[0270] The sequencing results are consistent Figure 2The 3' end is added with a T7 connector sequence.

[0271] T7 adapter: TCCACTTTGCCTTTCT

[0272] read1 adapter proportion: 0.12

[0273] read2 adapter proportion: 0.08

[0274] This data confirms that only some of the 3' ends have been fitted with the T7 connector sequence.

[0275] Example 4: Direct Blood Sample Bank Construction

[0276] like Figure 6 As shown,

[0277] Step 1: Pre-processing raw samples: Add lysis buffer to the blood sample to lyse cells; add nuclease to lyse DNA; remove proteins and retain DNA;

[0278] Step 2: The 3' end sequence of the single-stranded DNA (original strand) binds complementary to the 3' random sequence of the first adapter of the hairpin structure. Under the action of a nucleic acid polymerase with strand displacement activity, the 3' end of the single-stranded DNA (original strand) continues to extend, copying the first adapter sequence R1 to the end of the original strand. Since the 3' end of the first adapter is blocked by the blocking group, the first adapter will not extend. The hairpin structure further ensures that random extension between adapter templates will not cause adapter dimers.

[0279] Step 3: By denaturing nucleic acid molecules, the double-stranded structures of the original strand / linker template generated in the previous step are separated. The hairpin structure sequence on the original strand will self-turn in a U-shape to form a hairpin structure; the 3' end can be further extended by polymerase to synthesize complementary synthetic strands;

[0280] Next, the second adapter was ligated and PCR amplification and library construction were performed in the same manner as in Example 1.

[0281] The specific experimental steps are as follows:

[0282] 1) Collect 20 μl of peripheral blood from the finger.

[0283] 2) Add 100 μl of 0.1% Tween 20, mix well, and incubate on ice for 1 minute. Centrifuge at 3000g for 2 minutes and discard the supernatant.

[0284] 3) Add 100 μl of 0.1% Tween 20 again, mix well and place in an ice bath for 1 minute. Centrifuge at 3000g for 2 minutes and discard the supernatant.

[0285] 4) Wash cells with 100 μl of Atlantis Digestion Buffer (ZYMO Cat: D5220). Centrifuge at 3000g for 2 minutes and discard the supernatant.

[0286] 5) Resuspend the cell lysis buffer in 10 μl Atlantis Digestion Buffer, and add 0.3 U of Atlantis dsDNase (ZYMO Cat: D5220) and 1 μl RNase A (Thermo Scientific EN0531).

[0287] 6) Place at 42℃ for 30 minutes.

[0288] 7) Add 10 μl of magnetic beads (Apostle A17622-250) and 32 μl of lysis binding buffer (Apostle A17622-250).

[0289] 8) Let stand at room temperature for 30 minutes, then shake to mix every 5 minutes.

[0290] 9) Place on the magnetic rack and let stand for 5 minutes, then discard the supernatant.

[0291] 10) Add 100 μl of washing buffer (Apostle A17622-250) and wash, then use magnetic adsorption. Discard the supernatant.

[0292] 11) Wash with 100 μl of 85% ethanol. Magnetic adsorption. Discard the supernatant.

[0293] 12) Wash again with 100 μl of 85% ethanol. Use magnetic adsorption. Discard the supernatant. Air dry for 5 minutes.

[0294] 13) Take 2 μl of 10X Add 2 μl of dNTP Mix (2.5 mM) and 1 μl of Vent (exo-) DNA Polymerase (NEB) to Reaction Buffer, mix with 3.5 μl of 20 μM NAP5-N15 NH2 (sequence shown in SEQ ID NO.1), add 11.5 μl of water, for a total of 20 μl.

[0295] SEQ ID NO.1:

[0296] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0297] 14) Place it on a PCR instrument, and follow the reaction procedure as follows:

[0298]

[0299] 15) Add 9 μl of Ligation Buffer and 1.5 μl of DNA ligase V3 (HRK-CC220-24) to 20 μl of reaction solution. Simultaneously add 1 μl of TP72 adapter (final concentration 1 μM) with the sequence shown in SEQ ID NO.2 and 1.5 μL of TP7B2 adapter (final concentration 1.5 μM) with the sequence shown in SEQ ID NO.3. Incubate at 20℃ for 25 min in a PCR instrument, then cool to 4℃ until proceeding to the next step.

[0300] SEQ ID NO.2:

[0301] TGACCAAGATCGGAAGAGCACACGTCTGTTTTTCAGACGTGTGCTCTTCCGATCTTGGTCAT

[0302] SEQ ID NO.3:

[0303] CAGTCAAGATCGGAAGAGCACACGTCTGTTTTTCAGACGTGTGCTCTTCCGATCTTGACTG

[0304] 16) Add 8 μl of 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl of S1 nuclease (10) to 33 μl of reaction solution.

[0305] Place in a PCR instrument at 23°C for 20 min, then cool to 4°C until proceeding to the next step.

[0306] Step 5: The template strand and the synthetic strand are separated during PCR denaturation. The original strand now has a complete paired-end adapter structure and is amplified and library constructed using universal primers PCR.

[0307] Add 69 μl of Ampure beads to bind DNA and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash buffer and air dry at room temperature for 5 minutes.

[0308] Add 18 μl of water, 1.5 μl of mixed primers (LP5-UDI0021 and LP7-UDI0021, each at 10 μM, with sequences as shown in SEQ ID NO.4 and 5, respectively) and 19 μl of 2X HiFiPCR MasterMix (Hua Ruikang HRK-CC220-24) to the Ampure beads.

[0309] SEQ ID NO.4:

[0310] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC

[0311] SEQ ID NO.5:

[0312] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT

[0313] Place it on a PCR instrument, and follow the reaction procedure as follows:

[0314]

[0315] The PCR product was purified by adding 54 μL of Ampure beads and eluted with 50 μL of water to obtain an NGS library with intact paired-end adapter structures. The constructed NGS library qsep400 spectrum is shown below. Figure 7 A.

[0316] 8 μl of the NGS library was subjected to 1% agarose gel electrophoresis at 100 V for 20 minutes. The results are as follows: Figure 7 As shown in Figure B, the DNA length is concentrated between 250 bp and 750 bp.

[0317] Example 5: Direct Library Construction of Plasma Samples

[0318] like Figure 8 As shown, Step 1: Pre-processing the raw sample: Add lysis buffer to the plasma sample; remove proteins and retain DNA;

[0319] Step 2: The 3' end sequence of the single-stranded DNA (original strand) binds complementary to the 3' random sequence of the first adapter in the hairpin structure; under the action of a nucleic acid polymerase with strand displacement activity, the 3' end of the single-stranded DNA (original strand) continues to extend, copying the first adapter sequence R1 to the end of the original strand; since the 3' end of the first adapter is blocked by the blocking group, the first adapter will not extend; the hairpin structure further ensures that random extension between adapter templates will not cause adapter dimers;

[0320] Step 3: By denaturing nucleic acid molecules, the double-stranded structures of the original strand / linker template generated in the previous step are separated. The hairpin structure sequence on the original strand will self-turn in a U-shape to form a hairpin structure; the 3' end can be further extended by polymerase to synthesize complementary synthetic strands;

[0321] Next, the second adapter was ligated and PCR amplification and library construction were performed in the same manner as in Example 1.

[0322] 1) Add 8 μl of proteinase K and 20 μl of sample lysis buffer (Apostle A17622-250) to 190 μl of human plasma.

[0323] 2) Place at 60℃ for 20 minutes, add 10 μl of magnetic beads (Apostle A17622-250), and add 125 μl of lysis binding buffer (Apostle A17622-250).

[0324] 3) Mix well on a shaker at 2000 rpm for 10 minutes.

[0325] 4) Place on the magnetic rack and let stand for 5 minutes, then discard the supernatant.

[0326] 5) Add 500 μl of washing buffer (Apostle A17622-250) and wash, then use magnetic adsorption. Discard the supernatant.

[0327] 6) Wash with 500 μl of 85% ethanol; use magnetic adsorption; discard the supernatant.

[0328] 7) Wash again with 500 μl of 85% ethanol. Use magnetic adsorption. Discard the supernatant. Air dry for 5 minutes.

[0329] 8) Take 2 μl of 10X Add 2 μl of dNTP Mix (2.5 mM) and 1 μl of Vent (exo-) DNA Polymerase (NEB) to Reaction Buffer, mix with 3.5 μl of 20 μM NAP5-N15 NH2 (sequence shown in SEQ ID NO.1), and add 11.5 μl of water, for a total of 20 μl.

[0330] SEQ ID NO.1:

[0331] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0332] 9) Place it on a PCR instrument, and follow the reaction procedure as follows:

[0333]

[0334] 10) Add 9 μl of Ligation Buffer and 1.5 μl of DNA ligase V3 (HRK-CC220-24) to 20 μl of reaction solution. Simultaneously add 1 μl of TP72 adapter (final concentration 1 μM) with the sequence shown in SEQ ID NO.2 and 1.5 μL of TP7B2 adapter (final concentration 1.5 μM) with the sequence shown in SEQ ID NO.3. Incubate at 20℃ for 25 min in a PCR instrument, then cool to 4℃ until proceeding to the next step.

[0335] SEQ ID NO.2:

[0336] TGACCAAGATCGGAAGAGCACACGTCTGTTTTTCAGACGTGTGCTCTTCCGATCTTGGTCAT

[0337] SEQ ID NO.3:

[0338] CAGTCAAGATCGGAAGAGCACACGTCTGTTTTTCAGACGTGTGCTCTTCCGATCTTGACTG

[0339] 11) Add 8 μl of 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl of S1 nuclease (10 U / μl) to 33 μl of reaction solution. Place in a PCR instrument at 23℃ for 20 min, then cool to 4℃ until proceeding to the next step.

[0340] 12) Add 69 μL of Ampure beads to bind DNA and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash buffer and air dry at room temperature for 5 minutes.

[0341] 13) Add 18 μl of water, 1.5 μl of mixed primers (LP5-UDI0021 and LP7-UDI0021 at 10 μM each, with sequences as shown in SEQ ID NO.4 and 5, respectively) and 19 μl of 2X HiFiPCR MasterMix (HRK-CC220-24) to the Ampure beads.

[0342] SEQ ID NO.4:

[0343] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC

[0344] SEQ ID NO.5:

[0345] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT

[0346] 14) Place it on a PCR instrument and follow the reaction procedure:

[0347]

[0348] 15) Add 54 μL of Ampure beads to purify the PCR product and wash with 50 μL of water to obtain an NGS library with complete paired-end adapter structures.

[0349] 16) Take 8 μl of the NGS library and perform electrophoresis on 1% agarose gel. The electrophoresis conditions are: voltage 100V, electrophoresis time 20 minutes. The results are as follows: Figure 9 As shown, the DNA length is concentrated between 100bp and 750bp.

[0350] Example 6: Short DNA Fragment Library Construction Method Two

[0351] like Figure 10 or Figure 11 As shown, the process includes the following steps: Step 1: Under the action of TdT (terminal deoxynucleotidyl transferase) and dCTP (or dATP, or dTTP, or dGTP, or dUTP, or a mixture of the above deoxymononucleotide triphosphates), the corresponding mononucleotide is added to the 3' end of the single-stranded DNA (original strand), thereby forming the 3' extended end of the single-stranded DNA.

[0352] Step 2: The 3' extension end sequence of the single-stranded DNA (original strand) is complementary to the 3' sequence of the first adapter of the hairpin structure. Under the action of base complementarity, the 3' extension end of the single-stranded DNA (original strand) specifically binds to the 3' sequence of the first adapter of the hairpin structure. Under the action of a nucleic acid polymerase with strand displacement activity, the 3' extension end of the single-stranded DNA (original strand) continues to extend, replicating the first adapter sequence R1 to the end of the original strand. Because the 3' end of the first adapter is blocked by the blocking group, random extension of the first adapter will not occur. The hairpin structure further ensures that random extension between adapter templates will not cause adapter dimers.

[0353] Step 3: Through nucleic acid denaturation, the double-stranded structures of the original strand / linker template generated in the previous step are separated. The hairpin structure sequence on the original strand will undergo a U-turn to form a hairpin structure. The 3' end can be further extended by polymerase to synthesize a complementary synthetic strand.

[0354] Step 4: The synthetic chain formed by the U-turn of the 5' end and 3' end of the original chain forms a double-chain structure. The unphosphorylated second connector R2 (the second connector is a hairpin structure) is then joined using a flat-end, A / T, or G / C sticky-end double-chain connection method. Figure 11 The second connector is a Y-type connector. Figure 10 The second linker is added to the original strand. Since the second linker is not phosphorylated, only the original strand can be joined, creating a nick between the synthetic strand and the second linker. The second linker can be added to the original strand by using a Y-shaped structure design or by blocking the 3' end of a strand, with the correct orientation of the R2 sequence (instead of the complementary R2' sequence) added to the original strand.

[0355] Step 5: Digestion with single-stranded nuclease removes the single-stranded portion of the hairpin structure (and Y-shaped structure), allowing the template strand and the synthetic strand to separate during denaturation.

[0356] The specific experimental steps for the above steps are as follows:

[0357] 1) Take about 10 ng of DNA fragment (approximately 160 bp), add 1 μl of 5X TdT Buffer (TAKARA 2230A), add 1 μl of 2 mM dCTP, and add 0.5 μl of TdT (TAKARA 2230A);

[0358] 2) After 10 minutes at 37℃ and 3 minutes at 90℃, transfer to an ice box;

[0359] 3) Add 1.6 μl of SD Polymerase Reaction Buffer incomplete (BIORON), add 2 μl of ldNTP Mix (2.5 mM) and 0.5 μl of SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 2.5 μM) (sequence shown in SEQ ID NO.1) and SNAP5-G12 NH2 (final concentration 2.5 μM) (sequence shown in SEQ ID NO.7), add MgCl2 (final concentration 3 mM), and add water, for a total of 16 μl;

[0360] SEQ ID NO.1:

[0361] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0362] SEQ ID NO.7:

[0363] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)

[0364] 4) Place it on a PCR instrument, and follow the reaction procedure as follows:

[0365]

[0366]

[0367] 5) Add 8 μl of Ligation Buffer and 1.5 μl of DNA ligase V3 (HRK-CC220-24) to 16 μl of reaction solution. Simultaneously add P-STP76 adapter (final concentration 1 μM) with the sequence shown in SEQ ID NO.8 and P-SCP77 with the sequence shown in SEQ ID NO.9.

[0368] The adapter (final concentration 1 μM) and the P-STP7B9 adapter (final concentration 1 μM) shown in SEQ ID NO.10 were used. A total volume of 28 μl was placed in a PCR instrument at 20 °C for 25 min, and then cooled to 4 °C until the next step was performed.

[0369] SEQ ID NO.8:

[0370] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTT

[0371] SEQ ID NO.9:

[0372] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTC

[0373] SEQ ID NO.10:

[0374] pTAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTA

[0375] 6) Add 7 μl of 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl of S1 nuclease (10 U / μl) to 28 μl of reaction solution. Place in a PCR instrument at 23°C for 20 min, then cool to 4°C until proceeding to the next step.

[0376] Step 6: The template strand and the synthetic strand are separated during PCR denaturation. The original strand now has a complete paired-end adapter structure and can be amplified and library constructed using universal primer PCR.

[0377] 7) Add 42 μL of Ampure beads to bind DNA, and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash buffer and air dry at room temperature for 5 minutes;

[0378] 8) Add 9 μl of water, 1 μl of mixed primers (LP5-UDI0021 and LP7-UDI0021 at 10 μM each, with sequences as shown in SEQ ID NO.4 and 5, respectively) and 10 μl of KAPA HiFi HotStart Ready Mix (Roche) to the Ampure beads in sequence;

[0379] SEQ ID NO.4:

[0380] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC

[0381] SEQ ID NO.5:

[0382] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT

[0383] 9) Place it on a PCR instrument, and follow the reaction procedure as follows:

[0384]

[0385]

[0386] 10) Add 24 μL of Ampure beads to purify the PCR product and wash with 50 μL of water to obtain an NGS library with complete paired-end adapter structures.

[0387] 11) Take 8 μl of the NGS library and perform electrophoresis on 1% agarose gel. The electrophoresis conditions are: voltage 100V, electrophoresis time 20 minutes. The results are as follows: Figure 12As shown, the DNA length is concentrated between 100bp and 750bp.

[0388] Example 7: Ancient DNA Fragment Library Construction Method

[0389] 1) Take about 0.1 ng of ancient DNA fragment, add 1 μl of 5X TdT Buffer (TAKARA 2230A), add 1 μl of 2 mM dCTP, and add 0.5 μl of TdT (TAKARA 2230A);

[0390] 2) After 10 minutes at 37℃ and 20 seconds at 90℃, transfer to an ice box;

[0391] 3) Add 1.6 μl of SD Polymerase Reaction Buffer incomplete (BIORON), add 2 μl of ldNTP Mix (2.5 mM) and 0.5 μl of SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 2.5 μM) (sequence shown in SEQ ID NO.1) and SNAP5-G12 NH2 (final concentration 2.5 μM) (sequence shown in SEQ ID NO.7), add MgCl2 (final concentration 3 mM), and add water, for a total of 16 μl;

[0392] SEQ ID NO.1:

[0393] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0394] SEQ ID NO.7:

[0395] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)

[0396] 4) Place it on a PCR instrument, and follow the reaction procedure as follows:

[0397]

[0398]

[0399] 5) Add 8 μl of Ligation Buffer and 1.5 μl of DNA ligase V3 (HRK-CC220-24) to 16 μl of reaction solution. Simultaneously add P-STP76 adapter (final concentration 1 μM) as shown in SEQ ID NO.8, P-SCP77 adapter (final concentration 1 μM) as shown in SEQ ID NO.9, and P-STP7B9 adapter (final concentration 1 μM) as shown in SEQ ID NO.10. The total volume is 28 μl. Incubate in a PCR instrument at 20℃ for 25 min, then cool to 4℃ until proceeding to the next step.

[0400] SEQ ID NO.8:

[0401] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTT

[0402] SEQ ID NO.9:

[0403] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTC

[0404] SEQ ID NO.10:

[0405] pTAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTA

[0406] 6) Add 7 μl of 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl of S1 nuclease (10) to 28 μl of reaction solution.

[0407] Place in a PCR instrument at 23°C for 20 min, then cool to 4°C until proceeding to the next step.

[0408] At this point, the template strand and the synthetic strand have separated during PCR denaturation, and the original strand now has a complete paired-end adapter structure, which can be amplified and used for library construction using universal primer PCR.

[0409] 7) Add 42 μL of Ampure beads to bind DNA, and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash buffer and air dry at room temperature for 5 minutes;

[0410] 8) Add 9 μl of water, 1 μl of mixed primers (LP5-UDI0021 and LP7-UDI0021 at 10 μM each, with sequences as shown in SEQ ID NO.4 and 5, respectively) and 10 μl of KAPA HiFi HotStart Ready Mix (Roche) to the Ampure beads in sequence;

[0411] SEQ ID NO.4:

[0412] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC

[0413] SEQ ID NO.5:

[0414] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT

[0415] 9) Place it on a PCR instrument, and follow the reaction procedure as follows:

[0416]

[0417]

[0418] 10) Add 24 μL of Ampure beads to purify the PCR product and wash with 50 μL of water to obtain an NGS library with complete paired-end adapter structure;

[0419] 11) Take 5 μl of the NGS library and perform electrophoresis on 1% agarose gel. The electrophoresis conditions are: voltage 100V, electrophoresis time 20 minutes. The results are as follows: Figure 13 As shown in Figure A, the DNA length is concentrated between 100bp and 750bp.

[0420] Library qsep400 atlas as Figure 13 As shown in B.

[0421] Sequencing and sequence analysis using NovaSeq X Plus revealed that the library is a human DNA genome library with a large number of C->T mutations, consistent with ancient DNA characteristics.

[0422] Example 8: NIPT Standard Library Construction

[0423] 1) Take 3.3 μl of NIPT positive DNA (BGI Genomics) and 3.3 μl of NIPT negative DNA (BGI Genomics), add 1 μl of 5X TdT Buffer (TAKARA 2230A), 1 μl of 2 mMdCTP, and 0.5 μl of TdT (TAKARA 2230A) respectively;

[0424] 2) After 10 minutes at 37℃ and 2 minutes at 96℃, transfer to an ice box;

[0425] 3) Add 1.6 μl of SD Polymerase Reaction Buffer incomplete (BIORON), add 2 μl of ldNTP Mix (2.5 mM) and 0.5 μl of SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 2.5 μM) (sequence shown in SEQ ID NO.1) and SNAP5-G12 NH2 (final concentration 2.5 μM) (sequence shown in SEQ ID NO.7), add MgCl2 (final concentration 3 mM), and add water, for a total of 16 μl;

[0426] SEQ ID NO.1:

[0427] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0428] SEQ ID NO.7:

[0429] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)

[0430] 4) Place it on a PCR instrument, and follow the reaction procedure as follows:

[0431]

[0432]

[0433] 5) Add 8 μl of Ligation Buffer and 1.5 μl of DNA ligase V3 (HRK-CC220-24) to 16 μl of reaction solution. Simultaneously add the following adapters: P-STP76 (final concentration 1 μM) as shown in SEQ ID NO.8, P-SCP77 (final concentration 1 μM) as shown in SEQ ID NO.9, and P-STP7B9 (final concentration 1 μM) as shown in SEQ ID NO.10. The total volume is 28 μl. Incubate in a PCR instrument at 20°C for 25 min, then cool to 4°C until proceeding to the next step.

[0434] SEQ ID NO.8:

[0435] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTT

[0436] SEQ ID NO.9:

[0437] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTC

[0438] SEQ ID NO.10:

[0439] pTAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTA

[0440] 6) Add 7 μl of 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl of S1 nuclease (10) to 8 μl of reaction solution.

[0441] Place in a PCR instrument at 23°C for 20 min, then cool to 4°C until proceeding to the next step.

[0442] At this point, the template strand and the synthetic strand have separated during PCR denaturation, and the original strand now has a complete paired-end adapter structure, which can be amplified and used for library construction using universal primer PCR.

[0443] 7) Add 42 μL of Ampure beads to bind DNA, and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash buffer and air dry at room temperature for 5 minutes;

[0444] 8) Add 9 μl of water, 1 μl of mixed primers (LP5-UDI0021 and LP7-UDI0021 at 10 μM each, with sequences as shown in SEQ ID NO.4 and 5, respectively) and 10 μl of KAPA HiFi HotStart Ready Mix (Roche) to the Ampure beads in sequence;

[0445] SEQ ID NO.4:

[0446] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC

[0447] SEQ ID NO.5:

[0448] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT

[0449] 9) Place it on a PCR instrument, and follow the reaction procedure as follows:

[0450]

[0451]

[0452] 10) Add 24 μL of Ampure beads to purify the PCR product and wash with 50 μL of water to obtain an NGS library with complete paired-end adapter structure;

[0453] 11) Take 5 μl of the NGS library and perform electrophoresis on 1% agarose gel. The electrophoresis conditions are: voltage 100V, electrophoresis time 20 minutes. The results are as follows: Figure 14 As shown in Figure A, the DNA length is concentrated between 100bp and 750bp.

[0454] NIPT positive DNA library qsep400 map as shown Figure 14 As shown in B; the NIPT negative DNA library qsep400 map is as follows. Figure 14 As shown in C.

[0455] Sequencing was performed using NovaSeq X Plus. Sequence analysis showed that NIPT positive DNA libraries T21, T18, and T13 were all positive; NIPT negative DNA libraries T21, T18, and T13 were all negative.

[0456] Example 9: Direct Construction of Methylation Sequencing Library from Raw Plasma Samples

[0457] like Figure 15 As shown,

[0458] Step 1: Pre-processing raw samples: 1a. Add lysis buffer to plasma samples; 1b. Remove proteins and retain DNA;

[0459] Step 2: Purify DNA;

[0460] Step 3: Treat DNA with sulfite. During sulfite treatment, unmethylated cytosine (C) in the DNA is converted to uracil (U). In subsequent DNA replication, uracil (U) is replaced by thymine (T). Conversely, methylated cytosine (including 5-methylcytosine, 5mC, and 5-hydroxymethylcytosine, 5hmC) does not undergo this conversion.

[0461] Step 4: After sulfite treatment, the 3' end of the single-stranded DNA (original strand) is affected by TdT (terminal deoxynucleotidyl transferase) and dCTP (or dATP, or dTTP, or dGTP, or dUTP, or a mixture of the above deoxymononucleotide triphosphates), and the corresponding mononucleotide is added to the 3' end of the single-stranded DNA (original strand), thereby forming the 3' extended end of the single-stranded DNA (original strand);

[0462] Step 5: The 3' extension end sequence of the single-stranded DNA (original strand) is complementary to the 3' sequence of the first adapter of the hairpin structure. Under the action of base complementarity, the 3' extension end of the single-stranded DNA (original strand) specifically binds to the 3' sequence of the first adapter of the hairpin structure. Under the action of a nucleic acid polymerase with strand displacement activity, the 3' extension end of the single-stranded DNA (original strand) continues to extend, replicating the first adapter sequence R1 to the end of the original strand. Because the 3' end of the first adapter is blocked by the blocking group, random extension of the first adapter will not occur. The hairpin structure further ensures that random extension between adapter templates will not cause adapter dimers.

[0463] Step 6: Through nucleic acid denaturation, the double-stranded structures of the original strand / linker template generated in the previous step are separated. The hairpin structure sequence on the original strand will undergo a U-turn to form a hairpin structure. The 3' end can be further extended by polymerase to synthesize a complementary synthetic strand;

[0464] Step 7: The synthetic chain formed by the U-turn of the 5' end and 3' end of the original chain forms a double-chain structure. The phosphorylated second connector R2 is added to the original chain by a method of double-chain connection with flat ends, A / T or G / C sticky ends.

[0465] Step 8: Digestion with single-stranded nuclease removes the single-stranded portions of the first and second Y-type adapters, allowing the template strand and the synthetic strand to separate during denaturation.

[0466] Step 9: Both the original strand and the synthesized strand now have complete paired-end adapter structures and can be amplified and library constructed using universal primer PCR.

[0467] Step 10: U and A are converted from unmethylated C in the original PCR strand and paired, and the site exists as T in the PCR product; while methylated C (including 5mC, 5hmC) remains unchanged and is still C in the PCR product.

[0468] The specific experimental steps for the above steps are as follows:

[0469] 1) Add 40 μl of proteinase K and 100 μl of sample lysis buffer (Apostle A17622-250) to 1 ml of human plasma;

[0470] 2) Place at 60℃ for 20 minutes, add 15μl of magnetic beads (Apostle A17622-250), and add 1.25ml of lysis binding buffer (Apostle A17622-250);

[0471] 3) Mix well on a shaker at 2000 rpm for 10 minutes;

[0472] 4) Place on a magnetic rack and let stand for 5 minutes, then discard the supernatant;

[0473] 5) Add 500 μl of washing buffer (Apostle A17622-250) and wash, then use magnetic adsorption and discard the supernatant;

[0474] 6) Wash with 500 μl of 85% ethanol, use magnetic adsorption, and discard the supernatant;

[0475] 7) Wash again with 500 μl of 85% ethanol, use magnetic adsorption, discard the supernatant, and air dry for 5 minutes;

[0476] 8) Add 20 μl of water to elute;

[0477] 9) Add 130 μl of Lightning Conversion Reagent (Zymo Research D5030), place in a PCR instrument at 98℃ for 8 min, then at 54℃ for 60 min, and then cool down to 4℃ until proceeding to the next step;

[0478] 10) Add 600 μl of M-Binding Buffer (Zymo Research D5030) and mix well; pass through a Zymo-Spin column. TMIC Column(Zymo research D5030);

[0479] 11) Add 100 μl of M-Wash Buffer to the column, centrifuge at high speed for 30 seconds, and discard the wash buffer;

[0480] 12) Add 200 μl of L-Desulphonation Buffer (Zymo Research D5030) to Zymo-Spin. TM IC Column; and at room temperature for 15 minutes;

[0481] 13) Add 200 μl of M-Wash Buffer to the column, centrifuge at high speed for 30 seconds, discard the wash buffer; repeat the wash once.

[0482] 14) Add 3.5 μl of M-Elution Buffer for elution;

[0483] 15) Take 3.5 μl of M-Elution Buffer, add 1 μl of 5X TdT Buffer (TAKARA2230A), and add 1 μl of 3...

[0484] Add 0.5 μl TdT (TAKARA 2230A) to mM dCTP;

[0485] 16) 37℃ for 10 min, then 96℃ for 2 min, then transfer to an ice box;

[0486] 17) Add 1.6 μl of SD Polymerase Reaction Buffer incomplete (BIORON), add 2 μl of ldNTP Mix (2.5 mM) and 0.5 μl of SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 2.5 μM) (sequence shown in SEQ ID NO.1) and SNAP5-G12 NH2 (final concentration 2.5 μM) (sequence shown in SEQ ID NO.7), add MgCl2 (final concentration 3 mM), add water, for a total of 16 μl;

[0487] SEQ ID NO.1:

[0488] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0489] SEQ ID NO.7:

[0490] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)

[0491] 18) Place it on a PCR instrument and follow the reaction procedure:

[0492]

[0493] 19) Add 8 μl of Ligation Buffer and 1.5 μl of DNA ligase V3 (HRK-CC220-24) to 16 μl of reaction solution. Simultaneously add P-STP76 adapter (final concentration 1 μM) with the sequence shown in SEQ ID NO.8 and P-SCP77 with the sequence shown in SEQ ID NO.9.

[0494] The adapter (final concentration 1 μM) and the P-STP7B9 adapter (final concentration 1 μM) shown in SEQ ID NO.10 were used. A total volume of 28 μl was placed in a PCR instrument at 20 °C for 25 min, and then cooled to 4 °C until the next step was performed.

[0495] SEQ ID NO.8:

[0496] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTT

[0497] SEQ ID NO.9:

[0498] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTC

[0499] SEQ ID NO.10:

[0500] pTAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTA

[0501] 20) Add 7 μl of 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl of S1 nuclease (10) to 28 μl of reaction solution.

[0502] Place in a PCR instrument at 23°C for 20 min, then cool to 4°C until proceeding to the next step;

[0503] 21) Add 42 μL of Ampure beads to bind DNA, and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash buffer and air dry at room temperature for 5 minutes;

[0504] 22) Add 9 μl of water, 1 μl of mixed primers (LP5-UDI0021 and LP7-UDI0021 at 10 μM each, with sequences as shown in SEQ ID NO.4 and 5, respectively) and 10 μl of KAPA HiFi HotStart Ready Mix (Roche) to the Ampure beads in sequence;

[0505] SEQ ID NO.4:

[0506] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC

[0507] SEQ ID NO.5:

[0508] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT

[0509] 23) Place it on a PCR instrument, and follow the reaction procedure as follows:

[0510]

[0511] 24) Add 24 μL of Ampure beads to purify the PCR product and wash with 50 μL of water to obtain an NGS library with complete paired-end adapter structure;

[0512] 25) Take 5 μl of the NGS library and perform electrophoresis on 1% agarose gel. The electrophoresis conditions are: voltage 100V, electrophoresis time 20 minutes. The results are as follows: Figure 16 As shown in Figure A, the DNA length is concentrated between 100bp and 750bp.

[0513] Library qsep400 atlas as Figure 16 As shown in B; sequencing was performed using NovaSeq X Plus and sequence analysis was conducted. BSMAP sequence analysis showed characteristics consistent with BS-seq data.

[0514] Example 10: FFPE DNA Library Construction Method Two

[0515] like Figure 17As shown: Step 1: Expose the gDNA or FFPE DNA sample to a complex composed of Tn5 Transposase and Adapter R2-ME to randomly fragment the DNA and add an Adapter R2-ME sequence to the 5' end of the fragmented DNA. The 5' end of Adapter R2-ME has an R2-ME hairpin structure, which can bind to the 5' end of the DNA fragment, regardless of whether the DNA fragment is single-stranded or double-stranded;

[0516] Step 2: Denature the double-stranded DNA by methods such as heating or alkali treatment to convert it into single-stranded DNA. An R2-ME hairpin structure is added to the 5' end of the DNA molecule treated with Tn5 Transposase.

[0517] Step 3: The 3' end of the 5' end R2-ME hairpin structure single-stranded DNA (original strand) is extended by adding corresponding mononucleotides to the 3' end of the single-stranded DNA under the action of TdT and dCTP (or dATP, or dTTP, or dGTP, or dUTP, or a mixture of the above deoxymononucleotide triphosphates), forming the 3' extension end of the single-stranded DNA (original strand).

[0518] Step 4: The 3' extension end sequence of the 5' R2-ME hairpin single-stranded DNA (original strand) is complementary to the 3' sequence of the first hairpin adapter. Under the action of base complementarity, the 3' extension end of the single-stranded DNA (original strand) specifically binds to the 3' sequence of the first hairpin adapter. Under the action of a nucleic acid polymerase with strand displacement activity, the 3' extension end of the 5' R2-ME hairpin single-stranded DNA (original strand) continues to extend, replicating the first adapter sequence R1 to the end of the original strand. Because the 3' end of the first adapter is blocked by a blocking group, random extension of the first adapter will not occur. The hairpin structure further ensures that random extension between adapter templates will not cause adapter dimers.

[0519] Step 5: Through nucleic acid denaturation, the double-stranded structures of the original strand / linker template generated in the previous step are separated. The hairpin structure sequence on the original strand will undergo a U-turn to form a hairpin structure. The 3' end can be further extended by polymerase to synthesize a complementary synthetic strand;

[0520] Step 6: Obtain a double-stranded molecule with R1 and R2-ME hairpin structures at both ends by extension;

[0521] Step 7: Digestion with single-stranded nuclease removes the single-stranded portion of the hairpin structure, allowing the DNA to separate during denaturation;

[0522] Step 8: The DNA has a complete paired-end adapter structure and can be amplified and used for library construction using universal primer PCR.

[0523] The specific experimental steps are as follows:

[0524] 1) Take 20 μl of QuarPro Tn5 Transposase (1 U / μL) (Dynegene NE1001A) and add it to ME-UTP7 (final concentration 10 μM) as shown in SEQ ID NO.11;

[0525] SEQ ID NO.11:

[0526] 5'-[phos]CTGTCTCTTATACACATCTAGATCGGAAGAGCACACGTCTTTTTTAGACGTGTGCTCTTCCGATCTAGATGTGTATAAGAGACAG

[0527] 2) Place at 30℃ for 60 minutes, then mark as ME-UTP7 transpose body;

[0528] 3) Add 2 μl of 5×Tagment Buffer (Dynegene), add 1 μl of ME-UTP7 transposon, add 100 ng of FFPE DNA, and make up to 10 μl with water;

[0529] 4) Place at 55℃ for 20 minutes;

[0530] 5) Add 1 μL of Termination Buffer (Dynegene) and gently pipette 10 times to thoroughly mix the reaction system;

[0531] 6) Add 12 μL of Ampure beads to bind DNA, and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash buffer and air dry at room temperature for 5 minutes;

[0532] 7) Add 5 μl of water to the Ampure beads to elute;

[0533] 8) Take 5 μl of elution buffer, add 1.5 μl of 5X TdT Buffer (TAKARA 2230A), 1 μl of 2.5 mM dCTP, and 0.6 μl of TdT (TAKARA 2230A);

[0534] 9) 37℃ for 10 min, then 96℃ for 2 min, then transfer to an ice box;

[0535] 10) Add 2 μl of SD Polymerase Reaction Buffer incomplete (BIORON), add 2.5 μl of ldNTP Mix (2.5 mM) and 0.5 μl of SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 2 μM) (sequence shown in SEQ ID NO.1) and SNAP5-G12 NH2 (final concentration 2 μM) (sequence shown in SEQ ID NO.7), add MgCl2 (final concentration 2.5 mM), add water, for a total of 21 μl;

[0536] SEQ ID NO.1:

[0537] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0538] SEQ ID NO.7:

[0539] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)

[0540] 11) Place it on a PCR instrument and follow the reaction procedure:

[0541]

[0542] 12) Add 5.5 μl of 5X Reaction Buffer (Thermo Scientific EN0321) and 1 μl of S1 nuclease (10) to 21 μl of reaction solution.

[0543] Place in a PCR instrument at 23°C for 25 min, then cool to 4°C until proceeding to the next step;

[0544] 13) Add 27.5 μL of Ampure beads to bind DNA, and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash buffer and air dry at room temperature for 5 minutes;

[0545] Add 9 μl of water, 1 μl of mixed primers (LP5-UDI0021 and LP7-UDI0021 at 10 μM each, with sequences as shown in SEQ ID NO.4 and 5, respectively) and 10 μl of KAPA HiFi HotStart Ready Mix (Roche) to the Ampure beads in sequence.

[0546] SEQ ID NO.4:

[0547] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC

[0548] SEQ ID NO.5:

[0549] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT

[0550] 14) Place it on a PCR instrument and follow the reaction procedure:

[0551]

[0552] 15) Add 24 μL of Ampure beads to purify the PCR product and wash with 50 μL of water to obtain an NGS library with complete paired-end adapter structures.

[0553] 16) Take 5 μl of the NGS library and perform electrophoresis on 1% agarose gel. The electrophoresis conditions are: voltage 100V, electrophoresis time 20 minutes. The results are as follows: Figure 18 As shown in Figure A, the DNA length is concentrated between 100bp and 750bp.

[0554] Sequencing was performed using NovaSeq X Plus, and the sequences were analyzed. Sequence analysis revealed that all Read2 sequences began with MEsequenceAGATGTGTATAAGAGACAG, perfectly matching our experimental design.

[0555] Example 11: Direct Library Construction of Blood Collection Card Samples

[0556] 1) Use a 1.0mm diameter punch to punch a blood collection card containing a blood sample;

[0557] 2) Soak the blood collection card with 14.5 μl of Atlantis Digestion Buffer (ZYMO Cat: D5220);

[0558] 3) Place at 37℃ for 60 minutes;

[0559] 4) Add 0.05U of Atlantis dsDNase (ZYMO Cat: D5220);

[0560] 5) Place at 42℃ for 30 minutes;

[0561] 6) Add 10 μl of magnetic beads (Apostle A17622-250) and 32 μl of lysis binding buffer (Apostle A17622-250);

[0562] 7) Let stand at room temperature for 30 minutes, shaking to mix every 5 minutes;

[0563] 8) Place the magnetic rack and let it stand for 5 minutes, then discard the supernatant;

[0564] 9) Add 100 μl of washing buffer (Apostle A17622-250) and wash, then use magnetic adsorption and discard the supernatant;

[0565] 10) Wash with 100 μl of 85% ethanol, use magnetic adsorption, and discard the supernatant;

[0566] 11) Wash again with 100 μl of 85% ethanol, use magnetic adsorption, discard the supernatant, and air dry for 5 minutes;

[0567] 12) Elute with 5 μl of water;

[0568] 13) Take 5 μl of water eluent, add 1.5 μl of 5X TdT Buffer (TAKARA 2230A), add 1 μl of 3mMdCTP, and add 0.3 μl of TdT (TAKARA 2230A);

[0569] 14) Heat at 37℃ for 10 minutes, then at 96℃ for 2 minutes, then transfer to an ice box;

[0570] 15) Add 2 μl of SD Polymerase Reaction Buffer incomplete (BIORON), add 2.5 μl of ldNTP Mix (2.5 mM) and 0.5 μl of SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 3 μM) (sequence shown in SEQ ID NO.1) and SNAP5-G12 NH2 (final concentration 3.5 μM) (sequence shown in SEQ ID NO.7), add MgCl2 (final concentration 4 mM), add water, for a total of 16 μl;

[0571] SEQ ID NO.1:

[0572] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0573] SEQ ID NO.7:

[0574] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)

[0575] 16) Place it on a PCR instrument, and follow the reaction procedure as follows:

[0576]

[0577] 17) Add 8 μl of Ligation Buffer and 1.5 μl of DNA ligase V3 (HRK-CC220-24) to 16 μl of reaction solution. Simultaneously add the following adapters with sequences as shown in SEQ ID NO.8 (final concentration 0.5 μM), SEQ ID NO.9 (final concentration 0.5 μM), and SEQ ID NO.10 (final concentration 0.5 μM): P-STP76 adapter (final concentration 0.5 μM).

[0578] A total volume of 28 μl was placed in a PCR instrument at 20°C for 25 min, and then cooled to 4°C until the next step was performed.

[0579] SEQ ID NO.8:

[0580] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTT

[0581] SEQ ID NO.9:

[0582] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTC

[0583] SEQ ID NO.10:

[0584] pTAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTA

[0585] 18) Add 7 μl of 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl of S1 nuclease (10) to 28 μl of reaction solution.

[0586] Place in a PCR instrument at 23°C for 20 min, then cool to 4°C until proceeding to the next step;

[0587] 19) Add 42 μL of Ampure beads to bind DNA and wash twice with 85% ethanol; carefully remove the 85% ethanol washing solution and air dry at room temperature for 5 minutes.

[0588] 20) Add 9 μl of water, 1 μl of mixed primers (LP5-UDI0021 and LP7-UDI0021 at 10 μM each, with sequences as shown in SEQ ID NO.4 and 5, respectively) and 10 μl of KAPA HiFi HotStart Ready Mix (Roche) to the Ampure beads in sequence;

[0589] SEQ ID NO.4:

[0590] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC

[0591] SEQ ID NO.5:

[0592] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT

[0593] 21) Place it on a PCR instrument, and follow the reaction procedure as follows:

[0594]

[0595] 22) Add 24 μL of Ampure beads to purify the PCR product and wash with 50 μL of water to obtain an NGS library with complete paired-end adapter structure;

[0596] 23) Take 5 μl of the NGS library and perform electrophoresis on 1% agarose gel. The electrophoresis conditions are: voltage 100V, electrophoresis time 20 minutes. The results are as follows: Figure 18 As shown in Figure B, the DNA length is concentrated between 100 bp and 750 bp. The qsep400 library map is shown below. Figure 19 As shown in Figure A. Sequencing was performed using NovaSeq XPlus, and sequence analysis was conducted. The library length distribution is as follows. Figure 19 As shown in B.

[0597] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations of the methods listed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

Claims

1. A method for U-shaped self-rotation amplification of nucleic acids, characterized in that, The method involves adding a specific adapter to the 3' end of a single-stranded nucleic acid. The specific adapter includes a hairpin structure and an adapter sequence. The adapter sequence is used to bind complementary to the 3' end of the single-stranded nucleic acid. The 3' end of the adapter sequence has a blocking group, which is a 3' terminal hydroxyl active blocking group. After a single-stranded nucleic acid binds to a specific adapter, it extends from the 3' end of the single-stranded nucleic acid using the adapter as a template. The extended single-stranded nucleic acid has a hairpin structure to form a self-rotation. The original single-stranded nucleic acid is then used as a template for further extension and amplification to form an amplification product. The hairpin structure includes a stem region and a loop region. The two strands in the stem region are complementary. The two strands in the stem region are the adapter template and the adapter sequence, respectively. The adapter template and the adapter sequence are complementary. The adapter sequence is connected to the end of the adapter template.

2. The method according to claim 1, characterized in that, The single-stranded nucleic acid is selected from DNA or RNA; And / or, the 3' end of the single-stranded nucleic acid includes the natural 3' end of the single-stranded nucleic acid or the 3' end that has been extended and modified; And / or, the linker sequence consists of 6 to 25 degenerate N bases.

3. The method according to claim 2, characterized in that, The blocking group is selected from NH2 modification, MGB modification, Spacer modification, ddNTP, phosphate group, cy3, cy5, VIC, FAM, BHQ1 or BHQ2.

4. The method according to claim 1, wherein the adapter template is selected from sequencing primer binding sites, protein binding sequences, or promoter sequences; And / or, the sequence length of the stem region in the hairpin structure is 5~40 bp; And / or, the sequence of the ring area in the hairpin structure is TTTTT, AAAAAA, ACTCTTTCCCTA, or AATAA.

5. The method according to claim 4, characterized in that, The sequence of the sequencing primer binding site is selected from a portion or full-length sequence of the sequencing primer binding sites R1, R2 or their respective complementary sequences R1', R2'.

6. The method according to claim 1, characterized in that, The specific adapter includes a sequencing primer binding site R1, a circular structure, a sequence R1' complementary to the sequencing primer binding site R1, an adapter sequence, and a blocking group; or, the specific adapter sequence includes a sequencing primer binding site R2, a circular structure, a sequence R2' complementary to the sequencing primer binding site R2, an adapter sequence, and a blocking group.

7. Use of the method as described in any one of claims 1 to 6 in DNA amplification, library construction, qPCR detection, ddPCR detection, DNA methylation detection, second-generation sequencing, third-generation sequencing and / or fourth-generation sequencing.

8. A nucleic acid molecular adapter, characterized in that, The nucleic acid molecule adapter includes a first adapter, which comprises a hairpin structure and a random sequence. The hairpin structure includes a stem region and a loop region. The two strands of the stem region are complementary, and the two strands of the stem region are an adapter template and an adapter sequence, respectively. The adapter template and the adapter sequence are complementary. The random sequence is connected to the end of the adapter template. The random sequence includes a sequence complementary to the 3' end portion of the nucleic acid molecule to be tested. The 3' end of the random sequence is provided with a blocking group, which is a hydroxyl active blocking group at the 3' end of the nucleic acid molecule adapter.

9. The nucleic acid molecular adapter according to claim 8, characterized in that, The 3' end of the nucleic acid molecule to be tested includes the natural 3' end of the nucleic acid molecule to be tested or the 3' end that has been extended and modified. And / or, the nucleic acid molecule to be tested is selected from DNA or RNA; And / or, the adapter template is selected from sequencing primer binding sites, protein binding sequences, or promoter sequences; And / or, the random sequence consists of 6 to 25 degenerate bases N.

10. The nucleic acid molecular adapter according to claim 9, characterized in that, The extended modified sequence consists of 2 to 30 degenerate N bases.

11. The nucleic acid molecular adapter according to claim 9, characterized in that, The sequence of the sequencing primer binding site is selected from a portion or full-length sequence of the sequencing primer binding sites R1, R2 or their respective complementary sequences R1', R2'.

12. The nucleic acid molecular adapter according to claim 9, characterized in that, The blocking group is selected from NH2 modification, MGB modification, Spacer modification, ddNTP, phosphate group, cy3, cy5, VIC, FAM, BHQ1 or BHQ2.

13. The nucleic acid molecular adapter according to claim 8, characterized in that, The first adapter includes a sequencing primer binding site R1, a circular structure, a sequence R1' complementary to the sequencing primer binding site R1, a random sequence, and a blocking group; or, the first adapter includes a sequencing primer binding site R2, a circular structure, a sequence R1' complementary to the sequencing primer binding site R2, a random sequence, and a blocking group. And / or, the sequence length of the first connector stem region is 5~40 bp; And / or, the sequence of the first connector ring region is TTTTT, AAAAAA, ACTCTTTCCCTA, or AATAA.

14. The nucleic acid molecular adapter according to claim 8, characterized in that, The nucleic acid molecular adapter also includes a second adapter, which is either a phosphorylated adapter or a non-phosphorylated adapter.

15. The nucleic acid molecular adapter according to claim 14, wherein the second adapter has blunt ends or sticky ends.

16. The nucleic acid molecular adapter according to claim 15, characterized in that, The ends of the second connector with adhesive ends are T and / or C.

17. The nucleic acid molecular adapter according to claim 14, characterized in that, The second connector is a hairpin structure, comprising a stem region and a loop region. The two strands of the stem region are complementary and serve as sequencing primer binding sites. The sequencing primer binding sites are selected from sequencing primer binding sites R1, R2, or their respective complementary sequences R1' or R2'. The sequencing primer binding sites are different from the sequencing primer binding sites in the first connector.

18. The nucleic acid molecular adapter according to claim 14, characterized in that, The second adapter is a Y-type adapter, which includes a head and a tail. The head and tail each include two strands. The head consists of two non-complementary strands, while the tail consists of two complementary strands. The two strands of the tail are sequencing primer binding sites. The sequencing primer binding sites are selected from sequencing primer binding sites R1, R2, or their respective complementary sequences R1' or R2'. The sequencing primer binding sites are different from the sequencing primer binding sites in the first adapter.

19. The nucleic acid molecular adapter according to claim 17, characterized in that, The length of the stem region of the second connector is typically 5-40 bp; And / or, the ring region sequence of the second connector is TTTTT, AACTCCAGTCA, ACTCCAGTC, CTCCAGT, or AAAAAA.

20. Use of the nucleic acid molecular adapter according to any one of claims 8 to 19 in the addition of adapters to nucleic acid molecules to be tested or in the preparation of DNA library construction products.

21. A kit for constructing a DNA library, characterized in that, The kit includes any of the nucleic acid molecular adapters described in claims 8 to 19, and further includes one or more of the following: nucleic acid polymerase, library construction reagent, nucleic acid purification reagent, and single-stranded nuclease.

22. A method for constructing an NGS library using U-shaped self-rotation amplification of nucleic acids, characterized in that, An NGS library was constructed using the kit described in claim 21.

23. The method according to claim 22, characterized in that, The method includes the following steps: 1) The nucleic acid molecule to be tested, a nucleic acid polymerase with strand displacement activity, and the first adapter are mixed and reacted to copy the adapter sequence to the 3' end of the original strand of the nucleic acid molecule to be tested; 2) Synthesize the complementary strand of the original strand of the nucleic acid molecule to be tested so that the nucleic acid molecule to be tested forms a double strand; 3) The product of step 2), the second adapter, and the DNA ligase are mixed and reacted to add the second adapter to the original strand and / or synthetic strand of the nucleic acid molecule to be tested. 4) The product from step 3) is purified with magnetic beads, then mixed with PCR amplification reagents and subjected to PCR reaction to obtain an NGS library containing the target nucleic acid molecule with a dual-end adapter structure and / or its complementary strand.

24. The method according to claim 23, characterized in that, It also includes one or more of the following features: A) In step 1), the nucleic acid molecule to be tested, terminal deoxynucleotidyl transferase, and dNTPs are mixed to extend and modify the 3' end of the nucleic acid molecule to be tested; B) In step 2), denaturation is first used to open the binding site between the first adapter and the original strand of the nucleic acid molecule to be tested, and then the complementary strand is extended and synthesized by nucleic acid polymerase to form a double strand. C) In step 3), the second connector is a flat-end second connector or a sticky-end second connector; D) In ​​step 3), the nucleic acid molecule to be tested with the second adapter is mixed with a single-stranded nuclease to remove the single-stranded portion of the first adapter and / or the second adapter. In step 4) of E), after the PCR reaction is completed, the PCR product is also mixed with magnetic beads for purification.

25. The method according to claim 22, characterized in that, The method includes the following steps: 1) The double-stranded nucleic acid molecule to be tested, transposase, and second adapter are mixed and reacted to add the second adapter sequence to the 5' end of the nucleic acid molecule to be tested; the second adapter is a hairpin structure and carries the ME sequence; 2) Denaturation to convert the product from step 1) into a single strand, resulting in a single-stranded nucleic acid molecule with a second adapter; 3) The single-stranded nucleic acid molecule to be tested, the nucleic acid polymerase with strand displacement activity, and the first adapter are mixed and reacted to copy the first adapter sequence to the 3' end of the nucleic acid molecule to be tested; 4) Synthesize the complementary strand of the original strand of the nucleic acid molecule to be tested so that the nucleic acid molecule to be tested forms a double strand; 5) The product from step 4) is purified with magnetic beads, then mixed with PCR amplification reagents and subjected to PCR reaction to obtain an NGS library containing the target nucleic acid molecule with a dual-end adapter structure and / or its complementary strand.

26. The method according to claim 25, characterized in that, It also includes one or more of the following features: A) In step 3), before the mixing reaction, the single-stranded nucleic acid molecule to be tested, the terminal deoxynucleotidyl transferase, and dNTPs are mixed to extend and modify the 3' end of the nucleic acid molecule to be tested. In step 4), the nucleic acid molecule to be tested with the first adapter is mixed with a single-stranded nuclease to remove the single-stranded portion of the first adapter and / or the second adapter.

27. The use of the method as described in any one of claims 22 to 26 in any one or more of the following: 1) Used for constructing NGS libraries from FFPE DNA; 2) Used for constructing NGS libraries from ancient DNA; 3) Used for directly constructing whole-genome NGS libraries; 4) Used for directly constructing whole-genome NGS libraries; 5) Used for direct construction of cfDNA NGS libraries; 6) Construct an NGS library of plasma cfDNA treated with bisulfite for methylation sequencing; 7) Used to construct cffDNA NGS libraries; 8) Used to enable FFPE slides to directly build NGS libraries.

Images