Use of tRNA-derived fragments in the diagnosis of laryngeal cancer

Abstract

This invention relates to the field of disease diagnostic technology, specifically to the use of tRNA-derived fragments in the diagnosis of laryngeal cancer. This invention provides a laryngeal cancer biomarker, a kit for diagnosing laryngeal cancer, and a drug for treating laryngeal cancer. The inventors screened a tRF-5c type biomarker, tRF-Val-CAC-008, whose nucleic acid sequence is shown in SEQ ID NO:1. Compared to healthy volunteers, the expression of tRF-Val-CAC-008 was significantly increased in the plasma and saliva of laryngeal cancer patients. Furthermore, the inventors confirmed through experimental data that tRF-Val-CAC-008 can serve as a laryngeal cancer biomarker for in vitro diagnosis of laryngeal cancer. Simultaneously, the inventors found that inhibitors of laryngeal cancer biomarkers can inhibit laryngeal cancer proliferation and promote pyroptosis, indicating that they can be used to prepare drugs for treating laryngeal cancer.

Description

Technical Field

[0001] This invention relates to the field of disease diagnostic technology, specifically to the use of tRNA-derived fragments in the diagnosis of laryngeal cancer. Background Technology

[0002] Laryngeal cancer is one of the most common malignant tumors of the head and neck, with squamous cell carcinoma being the main pathological type. Recently, the incidence of laryngeal cancer has been on the rise. Although a combination of surgery and radiotherapy has reduced the mortality rate, the 5-year survival rate remains low due to recurrence and lymph node metastasis. If laryngeal cancer is diagnosed and treated promptly in its early stages, not only can the larynx be preserved, but the 5-year survival rate can also be increased to over 95%.

[0003] Current routine clinical methods for diagnosing laryngeal cancer, such as traditional laryngoscopy screening, are invasive and depend on the operator's experience; imaging examinations have low sensitivity for early tumors; and tissue biopsy, as the gold standard, has drawbacks such as high invasiveness, risk of infection, and delay, making it impossible to achieve early and efficient screening.

[0004] Therefore, there is an urgent need to develop a minimally invasive or non-invasive method for the early diagnosis of laryngeal cancer. Summary of the Invention

[0005] This invention aims to at least partially address one of the technical problems in related technologies. Therefore, one objective of this invention is to provide a laryngeal cancer biomarker, a diagnostic kit for laryngeal cancer, and a drug for treating laryngeal cancer. The inventors screened a tRF-5c type biomarker, tRF-Val-CAC-008, whose nucleic acid sequence is shown in SEQ ID NO:1. Compared to healthy volunteers, the expression of tRF-Val-CAC-008 was significantly increased in the plasma and saliva of laryngeal cancer patients. Furthermore, the inventors confirmed through experimental data that tRF-Val-CAC-008 can serve as a laryngeal cancer biomarker and can be used for in vitro diagnosis of laryngeal cancer. Simultaneously, the inventors discovered that inhibitors of laryngeal cancer biomarkers can inhibit laryngeal cancer proliferation and promote pyroptosis, indicating that they can be used to prepare drugs for treating laryngeal cancer.

[0006] Therefore, in a first aspect, the present invention provides a biomarker for laryngeal cancer. In some embodiments of the present invention, the biomarker is tRF-Val-CAC-008, the nucleic acid sequence of which is shown in SEQ ID NO:1.

[0007] GCTTCTGTAGTGTAGTGGTTATCACGTTC(SEQ ID NO:1)

[0008] High-throughput sequencing methods have enabled the exploration of many novel biomarkers. Among them, tRNA-derived fragments (tRFs) have become a focus of research. These are short, non-coding RNAs derived from mature or precursor transfer RNA (tRNA). Based on their restriction enzyme sites in the RNA molecule, they are classified into five types: tRF-1, tRF-2, tRF-3, tRF-5, and i-tRF. ​​tRFs play a crucial role in the occurrence and development of various cancers. Due to their numerous modifying groups, tRFs exhibit greater stability compared to other small RNAs, which is a significant advantage in the field of tumor markers. The inventors screened a tRF-5c type biomarker, tRF-Val-CAC-008 (MINTbase_ID: tRF-29-Q99P9P9NH525), whose nucleic acid sequence is shown in SEQ ID NO:1. Compared to healthy volunteers, tRF-Val-CAC-008 levels were significantly upregulated in the plasma and saliva of laryngeal cancer patients. Furthermore, the inventors confirmed through experimental data that tRF-Val-CAC-008 can serve as a biomarker for the in vitro diagnosis of laryngeal cancer. Specifically, the ROC curve results showed an area under the curve (AUC) of 0.8569, indicating that the combined diagnostic results of plasma and saliva tRF-Val-CAC-008 can distinguish laryngeal cancer patients from healthy volunteers.

[0009] A second aspect of the present invention provides a kit for diagnosing laryngeal cancer. In some embodiments of the invention, the kit contains reagents for detecting the levels of the laryngeal cancer markers described in the first aspect.

[0010] The kit provided by this invention, by jointly detecting the level of tRF-Val-CAC-008 in saliva and plasma, assists in the early diagnosis of laryngeal cancer through minimally invasive or even non-invasive methods, thereby improving the efficiency of early laboratory diagnosis of laryngeal cancer.

[0011] A third aspect of the present invention provides the use of the laryngeal cancer markers described in the first aspect in the preparation of a reagent kit for diagnosing laryngeal cancer.

[0012] The fourth aspect of the present invention provides the use of reagents for detecting the laryngeal cancer markers described in the first aspect in the preparation of a kit for diagnosing laryngeal cancer.

[0013] A fifth aspect of the present invention provides a pharmaceutical composition. In some embodiments of the invention, it includes an inhibitor of the laryngeal cancer markers described in the first aspect.

[0014] In some embodiments of the present invention, the nucleic acid sequence of the inhibitor of the laryngeal cancer marker is shown in SEQ ID NO:4.

[0015] GAACGUGAUAACCACUACACUACAGAAGC(SEQ ID NO:4)

[0016] The sixth aspect of the present invention provides the use of the pharmaceutical composition described in the fifth aspect in the preparation of a medicament for treating laryngeal cancer.

[0017] A seventh aspect of the present invention provides a reagent that promotes the proliferation of laryngeal cancer and inhibits pyroptosis in laryngeal cancer patients. In some embodiments of the present invention, the reagent comprises the laryngeal cancer markers described in the first aspect or analogues of the laryngeal cancer markers.

[0018] The inventors discovered that analogues of tRF-Val-CAC-008 can promote laryngeal cancer proliferation, reduce LDH secretion, and decrease the expression of gasdermin E (GSDME) and Caspase-3 proteins, thereby reducing pyroptosis.

[0019] In some embodiments of the present invention, the nucleic acid sequence of the analogue of the laryngeal cancer marker is shown in SEQ ID NO:3.

[0020] GCUUCUGUAGUGUAGUGGUUAUCACGUUC(SEQ ID NO:3)

[0021] An eighth aspect of the present invention provides a reagent for inhibiting laryngeal cancer proliferation and promoting laryngeal cancer pyroptosis. In some embodiments of the present invention, the reagent comprises an inhibitor of the laryngeal cancer markers described in the first aspect.

[0022] In some embodiments of the present invention, the nucleic acid sequence of the inhibitor of the laryngeal cancer marker is shown in SEQ ID NO:4.

[0023] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0024] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:

[0025] Figure 1The screening and validation of tRF-Val-CAC-008 in laryngeal cancer tissues are shown. A and B show the screening of tRF-Val-CAC-008 in laryngeal cancer tissues and adjacent normal tissues using next-generation sequencing (NGS) (n=4). C and D show the validation of tRF-Val-CAC-008 levels in laryngeal cancer tissues and adjacent normal tissues using qRT-PCR (n=60). E shows that 66.67% of laryngeal cancer tissues had higher tRF-Val-CAC-008 expression levels than adjacent normal tissues. Data are expressed as mean ± SD, *P<0.05, **P<0.01. F shows the survival analysis between the high-expression group and the low-expression group (P=0.0278).

[0026] Figure 2 The study demonstrated the effect of tRF-Val-CAC-008 on the proliferation of laryngeal cancer cells. A shows the relative expression levels of tRF-Val-CAC-008 in endothelial HLMEC cell lines and laryngeal cancer cell lines (TU138, TU686, AMC-HN-8, and TU212). B and C show the relative levels of tRF-Val-CAC-008 in AMC-HN-8 and TU686 cells treated with analogues and inhibitors, respectively. D and E show the effects of CCK on the proliferation of laryngeal cancer cells. -8 shows the effect of tRF-Val-CAC-008 on the proliferation of laryngeal cancer cells (AMC-HN-8 and TU686 cells); F shows the representative results of EdU detection of laryngeal cancer cells (AMC-HN-8 and TU686 cells) treated with tRF-Val-CAC-008 analogues and inhibitors; G shows the statistical results of EdU detection of laryngeal cancer cells (AMC-HN-8 and TU686 cells) treated with tRF-Val-CAC-008 analogues and inhibitors. n=3, *P<0.05, **P<0.01, ***P<0.001;

[0027] Figure 3The effects of tRF-Val-CAC-008 analogues on pyroptosis in laryngeal cancer cells were shown. Figures A and B show laryngeal cancer cells treated with tRF-Val-CAC-008 analogues or inhibitors under a microscope; figures C and D show flow cytometry analysis of cells treated with tRF-Val-CAC-008 analogues or inhibitors. The left side of each figure represents representative results, and the right side represents statistical results. Figure E shows the release of lactate dehydrogenase (LDH) in laryngeal cancer cells (AMC-HN-8 and TU686 cells) after treatment with tRF-Val-CAC-008 analogues or inhibitors; and figure F shows the expression of pyroptosis-related proteins (GSDME and Caspase 3) in laryngeal cancer cells (AMC-HN-8 and TU686 cells) after treatment with tRF-Val-CAC-008 analogues or inhibitors, detected by Western blot. n = 3, *P < 0.05, **P < 0.01;

[0028] Figure 4 This study demonstrates that tRF-Val-CAC-008 can be used to diagnose laryngeal cancer. A shows the plasma levels of tRF-Val-CAC-008 in laryngeal cancer patients (n=34) and healthy volunteers (n=52); B shows the saliva levels of tRF-Val-CAC-008 in the saliva of laryngeal cancer patients (n=86) and healthy volunteers (n=86); C shows the ROC curves for plasma, saliva, and both combined in laryngeal cancer; D shows the diagnostic value of tRF-Val-CAC-008 in plasma, saliva, and both combined in laryngeal cancer. Data are expressed as mean ± SD. *P<0.05, **P<0.01, ***P<0.001. Detailed Implementation

[0029] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0030] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this invention, unless otherwise stated, "a plurality of" means two or more.

[0031] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0032] To facilitate understanding of the invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined elsewhere in this document, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains.

[0033] In this document, the terms “comprising” or “including” are open-ended expressions, meaning that they include the contents specified in this invention, but do not exclude other aspects.

[0034] In this document, the terms “optionally,” “optionally,” or “optionally” generally refer to an event or condition that may, but may not, occur, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.

[0035] In this article, the term "tRNA" refers to transferable ribonucleic acid, a type of RNA composed of 76-90 nucleotides. Its 3' end can be attached to specific amino acids under the catalysis of aminoacyl-tRNA synthetase. During translation, tRNA recognizes codons on mRNA using its anticodon, transferring the corresponding amino acid to the polypeptide chain synthesized by the ribosome. Theoretically, each tRNA molecule can only attach to one amino acid; however, the genetic code exhibits degeneracy, allowing more than one tRNA to attach to a single amino acid. The primary structure of tRNA is linear, but through base pairing, it forms a cloverleaf-like secondary structure. This structure mainly consists of four arms: an amino acid arm, an anticodon arm, a D loop (or D arm), and a TψC loop (or T arm).

[0036] In this paper, the term "tRNA-derived fragments (tRFs)" refers to a class of small non-coding RNAs specifically cleaved from mature tRNA or precursor tRNA under specific conditions. As an emerging class of regulatory non-coding RNAs, the roles of tRFs in various physiological and pathological processes are gradually being revealed. tRFs have the potential to serve as disease biomarkers and therapeutic targets, providing new insights for the diagnosis, prognostic assessment, and treatment of diseases such as cancer.

[0037] In this article, the term "laryngeal cancer markers" refers to specific substances (such as proteins, genes, metabolites, etc.) detected in blood, tissues, or other bodily fluids that are associated with the occurrence, development, or treatment outcomes of laryngeal cancer. Abnormal changes in these markers may indicate the presence of laryngeal cancer, disease progression, or the risk of recurrence, and are often used to aid in diagnosis, monitor treatment effectiveness, or assess prognosis.

[0038] In this article, the term "pyroptosis" refers to a form of programmed cell death, belonging to inflammatory cell death. Unlike apoptosis, pyroptosis triggers a significant inflammatory response and plays an important role in immune defense and disease development.

[0039] In this paper, the term "ROC curve (Receiver Operating Characteristic Curve)" refers to a tool used to evaluate the performance of binary classification models, particularly in fields such as medical diagnostics and machine learning. It helps assess the performance of classification models and optimize decision thresholds by visualizing the trade-off between sensitivity and specificity. In the medical field, it is an important tool for validating the reliability of diagnostic biomarkers, imaging examinations, or predictive models.

[0040] In this document, "tRNA analogues" refer to molecules that are structurally or functionally similar to tRNA, obtained through chemical modification, artificial synthesis, or bioengineering techniques. In this invention, they specifically refer to nucleic acid sequences that have similar functions to tRF-Val-CAC-008, such as the sequence shown in SEQ ID NO:3.

[0041] In this paper, "tRNA inhibitors" refer to a class of molecules that can interfere with the normal function of tRNA by blocking tRNA aminoacylation, binding to ribosomes, or other key steps in the translation process, thereby inhibiting protein synthesis. In this invention, it specifically refers to nucleic acid sequences that inhibit the function of tRF-Val-CAC-008, such as the sequence shown in SEQ ID NO:4.

[0042] The present disclosure will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the disclosure. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0043] Sample collection

[0044] The Ethics Committee of Ningbo Medical Center Li Huili Hospital approved this study, and all participants signed written informed consent. The Department of Otolaryngology-Head and Neck Surgery at Ningbo Medical Center Li Huili Hospital provided all samples, including tissue, plasma, and saliva. Tumors and adjacent tissues were collected from 60 patients with surgically removed laryngeal cancer and then preserved in RNA fixation reagent (Bioteke, Beijing, China). Plasma was isolated from fresh blood from 52 healthy volunteers and 34 laryngeal cancer patients, and saliva samples were collected from 86 healthy volunteers and 86 laryngeal cancer patients. All samples were immediately stored at -80°C for further analysis. Two pathologists diagnosed laryngeal cancer according to guidelines from the International Union for Cancer Control and the World Health Organization. All laryngeal cancer patients had not received radiotherapy or chemotherapy prior to surgery.

[0045] Paired t-tests were used to compare the levels of tRF-Val-CAC-008 in laryngeal cancer tissue and adjacent tissues. Log-rank tests were used to assess survival outcomes. ROC curve analysis was used to analyze the diagnostic value of tRF-Val-CAC-008. A p-value <0.05 was considered significant. All data were statistically analyzed using SPSS 20.0 software (IBM, Illinois, USA), and graphs were plotted using GraphPad Prism 6.0 software (California, USA).

[0046] Example 1: tRF-Val-CAC-008 levels were significantly upregulated in laryngeal cancer.

[0047] To screen for differentially expressed tRFs, the inventors performed next-generation sequencing on cancerous and adjacent tissues from four laryngeal cancer patients, identifying several differentially expressed tRFs. Figure 1 (A). This study selected tRF-Val-CAC-008, which was significantly upregulated, for further investigation. Figure 1 (Middle B). To validate the sequencing results, tRF-Val-CAC-008 levels were detected in cancerous and adjacent tissues of 60 laryngeal cancer patients. The results are as follows: Figure 1 As shown in C and D, tRF-Val-CAC-008 levels were significantly upregulated in laryngeal cancer tissue compared to adjacent normal tissue, consistent with sequencing results. In qRT-PCR results, 66.67% (40 / 60) of the patients' cancer tissues contained high levels of tRF-Val-CAC-008. Figure 1 (E). Patients with laryngeal cancer who highly expressed tRF-Val-CAC-008 had significantly lower overall survival than patients with laryngeal cancer who low expressed tRF-Val-CAC-008. Figure 1 (F).

[0048] The RNA extraction and qRT-PCR detection methods involved in the above experiments are as follows:

[0049] 1) RNA isolation and quality control

[0050] Total RNA was extracted from cell and tissue samples using TRIzol reagent (Invitrogen, USA). Total RNA was extracted from plasma and saliva samples using TRIzol LS reagent (Invitrogen, USA) and Viral RNA Extraction Kit R6874 (Omega, USA), respectively. The concentration and purity of total RNA were measured using a UV spectrophotometer. A sample was considered acceptable if its OD260 / OD280 ratio was between 1.8 and 2.1.

[0051] 2) Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR)

[0052] cDNA synthesis and qRT-PCR were performed using a reverse transcription and qRT-PCR kit (Shanghai, China). RNU6-2 (U6) small nuclear RNA was used as an internal control. tRF levels were expressed using the ΔCq method, with higher ΔCq values ​​indicating lower levels. Therefore, using -ΔCq to represent tRF levels provides a more intuitive reflection of expression levels.

[0053] Example 2: tRF-Val-CAC-008 promotes the proliferation of laryngeal cancer cells.

[0054] The inventors examined the expression of tRF-Val-CAC-008 in human endothelial cells (HLMEC) and human laryngeal cancer cell lines (AMC-HN-8, TU686, TU138, and TU212). The results showed that tRF-Val-CAC-008 was relatively highly expressed in AMC-HN-8 and TU686 cells; therefore, these two cell types were used for further experiments. Figure 2 (A)

[0055] To upregulate or downregulate the level of tRF-Val-CAC-008 in laryngeal cancer cells, tRF-Val-CAC-008 analogs and inhibitors were transfected into AMC-HN-8 and TU686 cells, respectively. qRT-PCR results showed that transfection with the analog significantly increased the level of tRF-Val-CAC-008 in cells, while transfection with the inhibitor significantly decreased the level of tRF-Val-CAC-008 in cells. Figure 2 (B, C)

[0056] The effects of tRF-Val-CAC-008 transfection on the proliferation and viability of laryngeal cancer cells were examined using CCK-8 and EdU assays. CCK-8 results showed that tRF-Val-CAC-008 analogs significantly accelerated cell proliferation, while tRF-Val-CAC-008 inhibitors inhibited cell proliferation. Figure 2(D, E). EdU results showed that overexpression of tRF-Val-CAC-008 significantly increased red fluorescence in all cells, indicating a significant increase in the proliferative capacity of laryngeal cancer cells. In contrast, downregulation of tRF-Val-CAC-008 levels yielded the opposite result. Figure 2 (F, G). Table 1 below shows the sequence information used in the experiment.

[0057] Table 1

[0058] tRF-Val-CAC-008 GCTTCTGTAGTGTAGTGGTTATCACGTTC 1 NC UUGUACUACACAAAAGUACUG 2 mimics GCUUCUGUAGUGUAGUGGUUAUCACGUUC 3 inhibitor GAACGUGAUAACCACUACACUACAGAAGC 4

[0059] The experimental methods involved in the above experiment are as follows:

[0060] 1) Cell Culture

[0061] The human laryngeal cancer cell line AMC-HN-8 was derived from metastatic lymph node tissue of a 46-year-old South Korean male patient diagnosed with laryngeal cancer. TU686 was an epithelial-like cell line isolated from cancer tissue of a laryngeal cancer patient. Both cell lines were purchased from the Bena Cell Bank (BeNa, China). Cells were grown in RPMI 1640 medium (Hyclone, USA) containing 10% heat-inactivated fetal bovine serum (Gibco, USA) and 1% penicillin / streptomycin, and incubated in a 37°C incubator containing 5% CO2 (Thermo Fisher, USA).

[0062] 2) Cell transfection

[0063] Cells in the exponential growth phase were seeded into 6-well plates at a density of 2 × 10⁶ cells per well. 5 Cells were cultured for 24 hours until approximately 60% confluence was achieved. Then, they were transfected with an analogue or inhibitor of tRF-Val-CAC-008 using Liposome 2000 reagent (Invitrogen, USA). All oligonucleotide sequences were synthesized by GenePharma (China), as detailed in Table 1.

[0064] 3) CCK-8 detection

[0065] Cell proliferation was assessed using CCK-8 assay. Laryngeal cancer cells were seeded into 96-well plates at a density of 5 × 10⁶ cells per well. 3 Cells were divided into 6 replicate wells, each transfected with either a tRF-Val-CAC-008 analog or an inhibitor. At time points of 0h, 24h, 48h, 72h, and 96h, 10μL of CCK-8 reagent was added to each well, and the cells were incubated at 37°C for 3h. The absorbance at 450nm was then measured using a microplate reader (Labsystem, Finland). The experiment was repeated three times to verify the reliability of the results.

[0066] 4) EdU experiment

[0067] Follow the steps in the instruction manual to use BeyoClick. TM The EdU-555 assay kit (Beyotime, China) was used for detection. Laryngeal cancer cells were transfected with a tRF-Val-CAC-008 analog or inhibitor and cultured for 24 h. Then, preheated EdU working solution (37°C) was added to the wells, resulting in a final EdU concentration of 10 μM. The cells were incubated for 3 h, followed by fixation with 4% paraformaldehyde (Biosharp, China) at room temperature for 15 min. After washing three times with washing buffer (Beyotime, China), 1 ml of permeabilization buffer (Beyotime, China) was added and incubated at room temperature for 10 min. After washing twice more with washing buffer, the cells were incubated sequentially with EDU reaction solution in the dark for 30 min, followed by Hoechst 33342 incubation in the dark for 10 min. Finally, the cells were observed and photographed using a fluorescence microscope, and the percentage of positive cells in each group was calculated using ImageJ.

[0068] Example 3: tRF-Val-CAC-008 inhibits pyroptosis in laryngeal cancer cells

[0069] To further evaluate the function of tRF-Val-CAC-008 in laryngeal cancer cells, live-cell imaging was used to assess morphological changes after treatment. Twelve hours after treatment with the tRF-Val-CAC-008 inhibitor, some AMC-HN-8 and TU686 cells showed swelling and numerous bubbles appeared on the plasma membrane. Figure 3 (A and B) exhibit characteristics consistent with pyroptosis, which were not observed in treatment with the tRF-Val-CAC-008 analogue. Furthermore, flow cytometry revealed a significant decrease in the percentage of apoptotic cells after treatment with the tRF-Val-CAC-008 analogue, while treatment with the tRF-Val-CAC-008 inhibitor increased the percentage of apoptotic cells. Figure 3 (C, D). Consistent with these results, LDH secretion decreased after treatment with tRF-Val-CAC-008 analogs, while LDH secretion increased after treatment with tRF-Val-CAC-008 inhibitors. Figure 3 Furthermore, Western blot results showed that upregulating the level of tRF-Val-CAC-008 in laryngeal cancer cells inhibited the expression of pyroptosis-related proteins GSDME and Caspase-3. Figure 3 These data indicate that tRF-Val-CAC-008 analogues can inhibit pyroptosis in laryngeal cancer cells.

[0070] The experimental methods involved in the above experiment are as follows:

[0071] 1) Flow cytometry

[0072] Apoptosis was detected using the Annexin V-FITC / PI Apoptosis Detection Kit (Beyotime, China). After transfection of laryngeal cancer cells with tRF-Val-CAC-008 analogues or inhibitors, cells were first collected using the trypsin method, then washed twice with frozen PBS, and incubated with FITC-linked Annexin V for 30 min. Cells were immediately stained with PI and analyzed by flow cytometry using FACS Calibur (BD Bioscineces, USA). Data were processed using FlowJo software.

[0073] 2) Lactate dehydrogenase (LDH) release test

[0074] Following the instructions, the intracellular LDH content was detected using a lactate dehydrogenase cytotoxicity assay kit (Beyotime, China). Laryngeal cancer cells were transfected with a tRF-Val-CAC-008 analog or inhibitor, seeded into 96-well plates, and cultured for 24 h. The plates were then centrifuged at 400g for 5 min. After removing the supernatant, the prepared LDH release reagent was added, and the plates were incubated for another 1 h, followed by centrifugation at 400g for 5 min. 120 μl of the supernatant from each well was transferred to the corresponding well in a new 96-well plate, and the results were measured using a microplate reader.

[0075] 3) Western blot

[0076] Forty-eight hours after transfection of laryngeal cancer cells with tRF-Val-CAC-008 analogues or inhibitors, total protein was extracted using a total protein extraction kit (Beyotime, China). Quantification was performed using a BCA kit (Beyotime, China) to assess the concentration of isolated proteins. Buffer was added to the sample, and the mixture was gently mixed, then heated in a 95°C water bath for 10 min to completely denature the proteins. Proteins collected for electrophoresis were diluted to an equal concentration of 1× buffer before gel preparation, electrophoretic separation, membrane transfer, and immunoassay. Immunoassays were performed using primary antibodies against glyceraldehyde-3-phosphate dehydrogenase (GAPDH), GSDME, and caspase 3 (Proteintech, China). Protein expression was detected using electrochemiluminescence immunoassay (Millipore, USA).

[0077] Example 4: Diagnostic value of tRF-Val-CAC-008 for laryngeal cancer

[0078] To evaluate the diagnostic significance of tRF-Val-CAC-008 for laryngeal cancer, the levels of tRF-Val-CAC-008 in plasma and saliva samples from laryngeal cancer patients were measured. Compared with healthy volunteers, tRF-Val-CAC-008 expression was significantly increased in the plasma and saliva of laryngeal cancer patients. Figure 4 (A and B). ROC curve results showed that plasma tRF-Val-CAC-008 could effectively distinguish laryngeal cancer patients from healthy volunteers, with an area under the curve (AUC) of 0.6331, a sensitivity of 58.82%, and a specificity of 66.07%. Similarly, saliva tRF-Val-CAC-008 distinguished laryngeal cancer patients from healthy volunteers, with an AUC of 0.6662, a sensitivity of 44.19%, and a specificity of 81.4%. Combined detection of plasma and saliva tRF-Val-CAC-008 levels had good predictive ability for the diagnosis of laryngeal cancer, with an AUC of 0.8569, a sensitivity of 85.29%, and a specificity of 80.77%. Figure 4 (C, D)

[0079] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," "some implementations," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0080] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. Use of a reagent for detecting a laryngeal cancer marker in the preparation of a kit for diagnosing laryngeal cancer, wherein the laryngeal cancer marker is tRF-Val-CAC-008, and its nucleic acid sequence is shown in SEQ ID NO:

1.

2. Use of the pharmaceutical composition in the preparation of a medicament for treating laryngeal cancer, said pharmaceutical composition comprising an inhibitor of laryngeal cancer markers, wherein, The laryngeal cancer marker is tRF-Val-CAC-008, and its nucleic acid sequence is shown in SEQ ID NO:

1. The nucleic acid sequence of the inhibitor of the laryngeal cancer marker is shown in SEQ ID NO: 4.

Images