Molecular marker closely linked to pepper fruit length regulation gene cafl1 and application thereof
By identifying the pepper fruit length-specific regulatory site FL-10.1 and its candidate gene CaFL1, a tightly linked molecular marker was developed, solving the problems of long cycle and low efficiency in pepper fruit length improvement, and realizing precise and efficient breeding of pepper fruit length.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
- Filing Date
- 2025-04-23
- Publication Date
- 2026-07-21
AI Technical Summary
In existing technologies, genetic improvement of pepper fruit length suffers from long cycles and low efficiency. Furthermore, existing molecular marker pleiotropic sites are difficult to precisely control single traits, resulting in unstable marker-phenotype associations and poor cross-population applicability.
We identified and cloned the pepper fruit length-specific regulatory site FL-10.1 and its candidate gene CaFL1, developed molecular markers closely linked to it, used KASP technology for genotyping, and designed primer sets to detect pepper fruit length.
It has enabled early, large-scale, and precise prediction and targeted improvement of pepper fruit length with an accuracy rate of 100%, breaking through the limitations of traditional markers and achieving precise and efficient breeding of pepper fruit length.
Smart Images

Figure CN120442836B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular markers, specifically relating to a molecular marker closely linked to the chili pepper fruit length regulating gene CaFL1 and its application. Background Technology
[0002] Chili pepper (Capsicum annuum L.) is the most widely planted and highest-value vegetable crop in my country, widely used for fresh consumption, processing, seasoning, and medicinal purposes. Improving the quality and yield of chili peppers to continuously meet the needs of diverse consumers has been a common goal pursued by chili pepper breeders. Fruit length is an important appearance quality trait that directly affects yield, mechanized harvesting efficiency, and end-use. Significant genetic variation in fruit length exists among chili pepper germplasm resources, and current commercial varieties exhibit highly segmented requirements for fruit length. Therefore, genetic improvement of chili pepper fruit length is a core objective for enhancing varietal competitiveness. However, conventional breeding methods suffer from long phenotypic selection cycles and low efficiency, necessitating breakthroughs in molecular breeding technology. Therefore, cloning key regulatory genes for chili pepper fruit length and developing corresponding functional markers is of great significance for the precise and efficient breeding of chili pepper varieties with different fruit lengths.
[0003] Currently, researchers have conducted genetic and mapping studies on pepper fruit length in several different populations and locations over many years. They have found that pepper fruit length is controlled by multiple QTL loci, and have identified several QTL loci controlling pepper fruit length, including FL-2.1, FL-3.1, FL-3.2, FL-3.3, FL-3.4, FL-4.1, FL-6.1, FL-7.1, and FL-8 (Rao, GU et al., 2003. Mapping of yield-related QTLs in pepper in an interspecific cross of Capsicum annuum and C. frutescens. Theoretical and Applied Genetics, 106(8):1457-1466; Barchi, L. et al., 2009. QTL analysis of plant development and fruit traits in pepper and performance of selective phenotyping. Theoretical and Applied Genetics, 118(6):1157-1171; Han, K et al.). al., 2016. An ultra-high-density bin map facilitates high-throughput QTL mapping of horticultural traits in pepper (Capsicum annuum). DNA Research, 23(2):81-91; Chunthawodtiporn, J. et al., 2018. Capsicum annuum quantitative trait loci controlling fruit size and other horticultural traits in bell pepper. The Plant Genome, 11(1); Cao, Y. et al., 2022. Pepper variome reveals the history and key loci associated with fruit domestication and diversification. Molecular Plant, 15(11):1744-1758). Among them, FL-3.2 showed as the major locus controlling pepper fruit length in multiple different hybrid populations.In addition, QTL loci identified in some studies on the regulation of pepper fruit shape can also affect the fruit length of peppers. For example, Cao et al. used 347 pepper germplasm resources to construct a genome variation map of annual cultivated pepper varieties and identified that the genetic regulatory loci Fs3.1 and FL-3.2 of fruit shape highly overlap. This locus may affect the fruit length and transverse diameter of peppers during the flowering period and early fruit development, regulating the fruit development to be slender, which is suitable for the genetic improvement of chili pepper varieties (Cao, Y. et al., 2022. Pepper variome reveals the history and key locias associated with fruit domestication and diversification. Molecular Plant, 15(11):1744-1758). Borovsky et al. found in their study on fruit shape regulation that the fs10.1 site inhibits cell growth during the two weeks from pollination to ovary development, thus affecting the length of pepper fruit (Borovsky, Y. et al., 2011. Characterization of fs10.1, a major QTL controlling fruit elongation in Capsicum. Theoretical and Applied Genetics, 123(4):657-665). In subsequent studies, they cloned the candidate gene CaOFP20 for fs10.1, which encodes a protein homologous to tomato SIOFP20. After silencing CaOFP20, they found that the fruit elongated significantly and became thinner (Borovsky, Y. et al., 2021. Pepper fruit elongation is controlled by Capsicum annuum Ovate Family Protein 20. Frontiers in Plant Science, 12:815589).
[0004] Although multiple regulatory loci have been identified through genome-wide association analysis (GWAS) and QTL mapping, key progress remains hampered: currently, only two pleiotropic loci (FL-3.2 and fs10.1) that simultaneously regulate fruit length and width have been cloned; no loci regulating pepper fruit length alone have been cloned, making it difficult to precisely control a single trait. Furthermore, existing marker development is largely based on linkage disequilibrium (such as SSRs and SNPs) and does not target functional variations, resulting in unstable marker-phenotype associations and poor cross-population applicability. To achieve precise and efficient breeding of pepper fruit length, this invention is proposed. Summary of the Invention
[0005] To address the problems of insufficient functional markers and difficulty in targeted regulation of pepper fruit length by pleiotropic sites in existing technologies, this invention identifies the pepper fruit length-specific regulatory site FL-10.1 and clones its candidate gene CaFL1. Based on sequence variations in its coding region, molecular markers closely linked to the fruit length-specific regulatory gene CaFL1 were developed.
[0006] One of the objectives of this invention is to provide a reagent for detecting the genotype of a molecular marker closely linked to the chili fruit length regulating gene CaFL1, and its application in the breeding or identification of chili fruit length.
[0007] The second objective of this invention is to provide a primer set for detecting molecular marker genotypes closely linked to the chili fruit length regulating gene CaFL1.
[0008] A third objective of this invention is to provide a reagent or kit for detecting the genotype of the aforementioned molecular markers.
[0009] The fourth objective of this invention is to provide a method for determining the length of a chili pepper fruit to be tested.
[0010] To achieve the above objectives, the present invention adopts the following technical solution:
[0011] The first aspect of this invention provides a reagent for detecting the genotype of a molecular marker closely linked to the pepper fruit length regulating gene CaFL1, with applications in (a) or (b) below:
[0012] (a) Application in the selection or breeding of chili pepper varieties with different fruit lengths;
[0013] (b) Application in identifying fruit length of chili pepper varieties;
[0014] The molecular marker is an insertion / deletion of three nucleotides GAC at positions 223149123-223149125 on chromosome 10 of the pepper genome. The position of the molecular marker in the genome was determined based on the Qiemen reference genome (http: / / www.bioinformaticslab.cn / files / genomes / pepper_pan / genome_v1 / Canb / ).
[0015] Specifically, when the genotype of the molecular marker is InGAC:InGAC, the pepper has a long fruit phenotype; when the genotype of the molecular marker is InGAC:DelGAC, the pepper has an intermediate phenotype; and when the genotype of the molecular marker is DelGAC:DelGAC, the pepper has a short fruit phenotype.
[0016] More specifically, a single chili pepper plant with a fruit length of 12cm±4cm is defined as a chili pepper variety with a short fruit phenotype, a single chili pepper plant with a fruit length of 26cm±4cm is defined as a chili pepper variety with a long fruit phenotype, and a single chili pepper plant with a fruit length greater than 16cm and less than 22cm is defined as a chili pepper variety with an intermediate phenotype.
[0017] Existing technologies have identified loci (FL-3.2 and fs10.1) that regulate pepper fruit shape, simultaneously controlling both fruit length and width. While regulating elongation, they also alter fruit width (FL-3.2 regulates a slender fruit, while fs10.1 regulates a short, thick fruit). However, considering general market demand, there is a greater desire to regulate pepper fruit length singularly, making it longer without affecting fruit width. This invention uses genome-wide association analysis combined with BSA sequencing of the F2 segregating population to identify gene loci controlling pepper fruit length, screening for the locus FL-10.1, which can independently regulate pepper fruit length (without regulating fruit width). Through fine mapping of FL-10.1, CaFL1 was identified as an important candidate gene. Based on sequence variations in the CaFL1 coding region, a molecular marker closely linked to it was developed. Verification showed that this molecular marker achieved 100% accuracy in predicting pepper fruit length.
[0018] In the genotype descriptions in this article, "InGAC" indicates that there are three nucleotides with the base GAC at positions 223149123-223149125 on chromosome 10 of the pepper genome (also known as the insertion of nucleotide GAC); "DelGAC" indicates that there are no nucleotides at positions 223149123-223149125 on chromosome 10 of the pepper genome, or in other words, the GAC nucleotides are missing.
[0019] Genotype InGAC: InGAC indicates that both alleles on chromosome 10 of the pepper genome have GAC nucleotides inserted at positions 223149123-223149125; Genotype InGAC: DelGAC indicates that one allele on chromosome 10 of the pepper genome has GAC nucleotides inserted at positions 223149123-223149125, while the other allele lacks GAC nucleotides; Genotype DelGAC: DelGAC indicates that both alleles on chromosome 10 of the pepper genome lack GAC nucleotides at positions 223149123-223149125.
[0020] The molecular marker developed in this invention, which is closely linked to the chili pepper fruit length regulating gene CaFL1, provides a practical molecular marker for the precise and efficient breeding or identification of chili pepper varieties with different fruit lengths.
[0021] The molecular markers developed using this invention enable early, large-scale, and precise prediction and targeted improvement of pepper fruit length. The applications of these molecular markers in pepper fruit length prediction, targeted improvement, screening, identification, and pepper fruit length breeding are all covered within the scope of this invention.
[0022] In the application of the first aspect of the present invention, the reagent for detecting the molecular marker genotype closely linked to the chili fruit length regulating gene CaFL1 can be any reagent in the art capable of determining the molecular marker genotype.
[0023] In a preferred embodiment, the reagent includes a primer set, which can be a primer set designed for high-throughput genotyping based on KASP technology, a primer set designed for genotyping based on conventional PCR and PCR product sequencing, or a primer set designed for genotyping based on conventional PCR, enzyme digestion, and enzyme digestion product electrophoresis.
[0024] Considering the efficiency of genotyping and the simplicity of operation, the primer set described in this invention is preferably a primer set designed based on KASP technology.
[0025] In one optional embodiment of the present invention, the primer set includes:
[0026] The first forward primer contains the nucleotide sequence shown in SEQ ID No. 3 of the sequence listing;
[0027] The second forward primer contains the nucleotide sequence shown in SEQ ID No. 4 of the sequence listing;
[0028] The universal reverse primer has the nucleotide sequence shown in SEQ ID No. 5 of the sequence listing.
[0029] SEQ ID No. 3 in the sequence list is as follows:
[0030] 5'-AGCCCAAATTCTAAGGAAAAGTCTG-3'.
[0031] SEQ ID No. 4 in the sequence list is as follows:
[0032] 5'-GAGCCCAAATTCTAAGGAAAAGTCTA-3'.
[0033] The specific SEQ ID No. 5 in the sequence list is:
[0034] 5'-GCTAGAGAAGTACTAGTATATGATTATTTCAAC-3'.
[0035] Furthermore, the 5' ends of the first and second forward primers are respectively connected to fluorescent adapter sequences of different colors. For example, the fluorescent adapter sequences are selected from one of FAM, HEX, FITC, RED, TET, JOE, and R110.
[0036] Furthermore, the nucleotide sequence of the first forward primer is shown in SEQ ID No. 6, and the nucleotide sequence of the second forward primer is shown in SEQ ID No. 7.
[0037] SEQ ID No. 6 in the sequence list is as follows:
[0038] 5'-GAAGGTGACCAAGTTCATGCTAGCCCAAATTCTAAGGAAAAGTCTG-3'.
[0039] The specific SEQ ID No. 7 in the sequence list is:
[0040] 5'-GAAGGTCGGAGTCAACGGATTGAGCCCAAATTCTAAGGAAAAGTCTA-3'.
[0041] Of course, other primer sets designed based on this molecular marker and KASP technology using existing primer design methods are also within the scope of protection of this invention.
[0042] In one optional embodiment of the application of the first aspect of the present invention, the reagent further includes at least one of PCR auxiliary reagents, reagents for DNA extraction, and reagents for PCR amplification product analysis, such as buffer, DNA polymerase, dNTPs, etc. All or some of the reagents may be available as a kit.
[0043] In summary, primer sets for detecting the above-mentioned molecular markers designed using existing technical methods, reagents containing primer sets, and kits formed from these reagents are all covered within the scope of this invention.
[0044] A second aspect of the present invention provides a primer set for detecting molecular marker genotypes closely linked to the chili pepper fruit length regulating gene CaFL1, wherein the molecular marker is an insertion / deletion of three nucleotides GAC at positions 223149123-223149125 on chromosome 10 of the chili pepper genome, and the position of the molecular marker in the genome is determined according to the Qiemen reference genome.
[0045] In a preferred embodiment, the primer set is designed based on KASP technology and specifically includes:
[0046] The first forward primer contains the nucleotide sequence shown in SEQ ID No. 3 of the sequence listing;
[0047] The second forward primer contains the nucleotide sequence shown in SEQ ID No. 4 of the sequence listing;
[0048] The universal reverse primer has the nucleotide sequence shown in SEQ ID No. 5 of the sequence listing.
[0049] Furthermore, the 5' ends of the first and second forward primers are respectively connected to fluorescent adapter sequences of different colors. For example, the fluorescent adapter sequences are selected from one of FAM, HEX, FITC, RED, TET, JOE, and R110.
[0050] Furthermore, the nucleotide sequence of the first forward primer is shown in SEQ ID No. 6, and the nucleotide sequence of the second forward primer is shown in SEQ ID No. 7.
[0051] A third aspect of the present invention provides a reagent or kit for detecting molecular marker genotypes closely linked to the chili fruit length regulating gene CaFL1, the reagent or kit comprising the primer set described in the second aspect above.
[0052] Furthermore, the reagents or kits may also include other auxiliary reagents, such as reagents for DNA extraction, reagents for PCR amplification, and reagents for PCR amplification product analysis.
[0053] A fourth aspect of the present invention provides a method for identifying the length of a chili pepper fruit to be tested, comprising the following steps:
[0054] (1) Extract genomic DNA from the pepper samples to be tested;
[0055] (2) Using the genomic DNA of the pepper sample to be tested as a template, PCR amplification is performed using the primer set in the second aspect above or the reagents or kits in the third aspect above to obtain PCR amplification products.
[0056] (3) Analyze the PCR amplification products, determine the genotype of the molecular marker closely linked to the pepper fruit length regulation gene CaFL1 based on the analysis results, and predict the fruit length phenotype of the pepper sample to be tested based on the genotype of the molecular marker; the molecular marker is the insertion / deletion of three nucleotides GAC at positions 223149123-223149125 on chromosome 10 of the pepper genome, and the position of the molecular marker in the genome is determined according to the Qiemen reference genome.
[0057] Specifically, the method for predicting the fruit length phenotype of the pepper sample to be tested from the genotype of the molecular marker in step (3) is as follows:
[0058] When the genotype of the molecular marker is InGAC:InGAC, the pepper is predicted to have a long fruit phenotype; when the genotype of the molecular marker is InGAC:DelGAC, the pepper is predicted to have an intermediate phenotype; and when the genotype of the molecular marker is DelGAC:DelGAC, the pepper is predicted to have a short fruit phenotype.
[0059] As an optional implementation, the method for determining the genotype of the molecular marker described in the first aspect in step (3) based on the analysis results includes: detecting the fluorescence signal of the PCR product using an instrument, and determining the genotype of the pepper to be tested based on the fluorescence signal color of the PCR product; preferably, the specific principle of the determination is as follows: if the fluorescence signal of the PCR product of the pepper to be tested shows the fluorescence of the first positive primer, then the genotype of the pepper to be tested is InGAC:InGAC; if the fluorescence signal of the PCR product of the pepper to be tested shows the fluorescence of the second positive primer, then the genotype of the pepper to be tested is DelGAC:DelGAC; if the fluorescence signal of the PCR product of the pepper to be tested shows the fluorescence of both the first and second positive primers, then the genotype of the pepper to be tested is DelGAC:InGAC.
[0060] As an alternative implementation, the chili pepper sample to be tested is obtained during the chili pepper seedling stage.
[0061] As an optional implementation, the chili pepper sample to be tested is the fourth to sixth true leaves that have grown on the chili pepper.
[0062] The growth cycle of chili peppers is generally divided into four stages: germination, seedling, flowering and fruit setting, and fruiting. The seedling stage refers to the time from when the chili pepper sprouts its first true leaf to when it develops its first flower bud. After the chili pepper seedling emerges from the soil, the first two leaves that appear on the embryonic bud are called cotyledons, and all subsequent leaves are true leaves.
[0063] The method for identifying the length of a chili pepper fruit provided in the fourth aspect of this invention can be used to screen or identify chili pepper varieties with the desired fruit length phenotype for further breeding or cultivation. The method for breeding or cultivating chili pepper varieties using the method in the fourth aspect is also within the scope of protection of this invention.
[0064] The beneficial effects of this invention are as follows:
[0065] The molecular marker developed in this invention, which is closely linked to the fruit length-specific regulatory gene CaFL1, solves the problem of directional breeding of pepper varieties with different fruit lengths or the problem of identifying pepper fruit length. It can break through the limitations of traditional markers and has the following advantages: (1) Precision: It regulates pepper fruit length separately (without regulating pepper fruit width), that is, it precisely controls the single trait of pepper fruit length, directly targets causal variation, realizes "design breeding", and avoids the disconnect between phenotype and genotype; and (2) Efficiency: It accelerates the backcross breeding process through KASP marker typing.
[0066] The molecular markers developed in this invention can accurately predict the fruit length phenotype of pepper germplasm or varieties to be tested, with an accuracy rate of 100%. They enable early, large-scale, and precise prediction of pepper fruit length and targeted improvement, providing a new approach for the prediction, targeted improvement, screening, identification, and breeding of pepper fruit length. Attached Figure Description
[0067] To more clearly illustrate the technical solutions of the specific embodiments of the present invention, the drawings used in the description of the specific embodiments will be briefly introduced below. Obviously, the drawings described below do not constitute a limitation on the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0068] Figure 1 For the construction of RIL populations and fruit length association analysis, a is a schematic diagram of the RIL population construction process, in which an F2 segregating population was constructed by crossing two high-generation inbred lines, and then a stable RIL population was constructed by single-seed propagation; b is the bin marker genotype clustering of 216 RIL lines; c is the Manhattan plot of the genome-wide association analysis results based on the genotype data and fruit length data of the 216 RIL lines, in which the major locus FL-3.2 was identified on chromosome 3.
[0069] Figure 2 Phenotypic data for RILs-20 and RILs-126 are presented. Example a shows lines within the RIL population carrying the FL-3.2 long-fruit genotype (AA) but exhibiting significant differences in fruit length phenotype. Example b shows the statistical analysis results of selected RILs-20 and RILs-126 lines that show significant differences in fruit length but no significant differences in fruit width. Example c shows a graph illustrating the changes and differences in fruit length at different developmental stages for RILs-20 and RILs-126.
[0070] Figure 3 This is a fine-map of the new regulatory site for fruit length, FL-10.1, on chromosome 10.
[0071] Figure 4This study analyzed the sequence differences between parental lines RILs-20 and RILs-126 at the fruit length regulating gene CaFL1. In this study, A represents the nucleotide sequence differences between RILs-20 and RILs-126 at this gene, and B represents the protein sequence differences between RILs-20 and RILs-126 encoded by this gene. Here, q94.sequence refers to the Qiemen reference sequence of pepper, and consensus refers to the consensus sequence.
[0072] Figure 5 Genotyping results of KASP70-72 markers on parents (RILs-20 and RILs-126), F1, and 48 F2 individuals are shown. Blue circles represent genotype InGAC:InGAC, predicting long fruit length phenotype for the corresponding line; green circles represent genotype InGAC:DelGAC, predicting intermediate fruit length phenotype for the corresponding line; red circles represent genotype DelGAC:DelGAC, predicting short fruit length phenotype for the corresponding line; black circles represent blank controls; and pink circles represent samples that were not detected. Detailed Implementation
[0073] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0074] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0075] Example 1. Obtaining the primer set for detecting molecular marker genotypes closely linked to the pepper fruit length regulating gene CaFL1.
[0076] Materials numbered "BVRC-" in the test were high-quality inbred lines bred by the Vegetable Research Institute of the Beijing Academy of Agricultural and Forestry Sciences (provided by the Beijing Crop Germplasm Bank), while materials numbered "RILs-" were recombinant inbred line populations constructed using BVRC1 and BVRC25 as parents. For detailed construction procedures, please refer to [link to relevant documentation]. Figure 1 a. Using BVRC1 and BVRC25 as parents, the F1 generation was obtained through hybridization, and then self-pollination was carried out to obtain the F2 generation. From the F2 generation onwards, single-seed propagation was carried out until the F10 generation was obtained. That is, a stable population (216 RIL lines, n=216) was obtained through continuous self-pollination to the F10 generation.
[0077] The new F2 population mentioned in Section 1.5 below was obtained by crossing two independent RIL lines (RILs-20 and RILs-126), totaling about 300 lines.
[0078] 1.1 Material Cultivation
[0079] Seeds were disinfected by soaking in a 4% sodium hypochlorite solution for 3-5 minutes, followed by rinsing with sterile water 3-4 times; then soaked at 55℃ for 5 minutes. The disinfected seeds were wrapped in moist gauze, placed in petri dishes, and cultured in the dark at 25℃ for 7-10 days. When most seeds showed signs of sprouting, they were immediately sown in 72-well trays with a peat moss / vermiculite volume ratio of 2:1 and placed in a culture room at 28℃ with 14 hours of light. When the plants had two fully unfolded leaves, DNA was extracted from one new leaf using the CTAB method. Seedlings were cultured in a seedling substrate for 30-40 days before being transplanted to the field. For the RIL population used for fruit length phenotypic surveys, 6 plants were planted per line, and 4-5 ripening fruits were selected from each plant for fruit length measurement. The average value of the measurements was taken.
[0080] 1.2 Resequencing of parents and RIL strains
[0081] Leaf samples from parents and all RIL lines were collected and sent to MajorBio (https: / / www.majorbio.com / ) to construct DNA libraries, which were then sequenced at 150bp paired ends using the Illumina platform. The raw data were processed using Trimmomatic v0.33 to remove adapter sequences, resulting in high-quality clean reads. These clean reads were then aligned to the Qiemen pepper reference genome (http: / / www.bioinformaticslab.cn / files / genomes / pepper_pan / genome_v1 / Canb / ) using BWA 0.7.17 to obtain SAM files. The SAM files were converted to BAM format and sorted using SAMtools. Repetitive sequences were then removed using the MarkDuplicates function of GATK (v4.1.7). Variation detection was performed using GATK HaplotypeCaller, generating the original VCF file. Finally, ANNOVAR was used for variation functional annotation.
[0082] 1.3 High-density binmap construction
[0083] Genotyping (AA, BB, or heterozygous) was performed on SNPs from 216 RIL lines. A sliding window method with 15 consecutive SNPs was used, and a parental type was defined when at least 9 SNPs within the window showed the same genotype. Recombinant bins were defined as genomic regions within RIL lines with consecutive identical parental genotypes; regions with inconsistent genotypes between adjacent SNPs were excluded, and bins shorter than 250 kb were filtered. Regions with ambiguous genotypes were marked as "not available." Recombinant bin information from all RIL lines and recombination breakpoint analysis were integrated to construct a population recombination bin map (see [link to relevant documentation]). Figure 1 b). Principal component analysis and genotype clustering analysis were performed on 216 RIL lines based on recombinant bin information.
[0084] 1.4 Genome-wide association analysis of fruit length
[0085] GWAS analysis was performed using GEMMA software. First, the kinship matrix was calculated to correct for population structure. Then, fruit length traits were analyzed based on a linear mixture model (LMM) to obtain p-values for all bins. For each associated bin, FDR analysis was performed, using the negative logarithm of the p-value (base 10) as the ordinate and the physical location of the bin as the abscissa. A Manhattan plot was then drawn using R software. Figure 1 c). In the Manhattan plot, a threshold level of significance for the association results was set using -Log10 (0.1 / bin count). A pleiotropic site regulating fruit shape / length was located on chromosome 3, overlapping with the previously reported FS3.1 / FL-3.2, and its candidate gene encodes a TRM25 protein (Han et al., 2016; Colona et al., 2019; Cao et al., 2022).
[0086] 1.5 New F2 Population Construction and BSA Analysis
[0087] Genotyping at the FL-3.2 locus of each RIL line revealed five lines carrying the FL-3.2 long-fruit genotype (AA) but exhibiting a short-fruit phenotype (see [link to RILs]). Figure 2 a) indicates the existence of other sites regulating fruit length in peppers. Meanwhile, our amplification and sequencing of parental materials revealed no difference at the fs10.1 site. Therefore, based on the identification of the known major fruit length site FL-3.2 using the RIL population and excluding the influence of the known fruit length / width pleiotropic site fs10.1, we further explored other minor fruit length sites.
[0088] We screened two lines from the RILs population that carried the long-fruit genotype (AA) at the FL-3.2 locus but showed significant differences in fruit length but no significant differences in fruit width—RILs-20 and RILs-126 (see [link to RILs population]). Figure 2 a and Figure 2 b) For the changes and differences in fruit length of RILs-20 and RILs-126 at different developmental stages, see [reference needed]. Figure 2 c.
[0089] RILs-20 was used as the short-fruit parent, with a fruit length of approximately 14cm; RILs-126 was used as the long-fruit parent, with a fruit length of approximately 26cm. The short-fruit phenotype is characterized by a fruit length of 12cm ± 4cm, the long-fruit phenotype by a fruit length of 26cm ± 4cm, and the intermediate phenotype by a fruit length greater than 16cm and less than 22cm.
[0090] A new F2 population was constructed using RILs-20 and RILs-126 as parents. Extremophile individuals were selected from this population to form mixed pools for BSA sequencing. Illumina paired-end sequencing data were quality controlled using Trimmomatic v0.33 and then aligned to the Qiemen reference genome using BWA v0.7.17 to generate SAM files, which were then converted to BAM format using SAMtools. After deduplication using GATK MarkDuplicates, SNPs were detected using HaplotypeCaller, and VCF files were generated. SNP indexes were calculated using OcBSA software to construct distribution maps, and the genomic distribution characteristics of SNP loci between the two mixed pools were analyzed to locate regions associated with fruit length traits. A candidate region for the novel regulatory site FL-10.1 for pepper fruit length was located on chromosome 10.
[0091] 1.6 Fine localization of the novel fruit length regulatory site FL-10.1
[0092] See Figure 3 First, the initial mapping region was narrowed down to 221-224 Mb on chromosome 10 using BSA and polymorphic markers. Then, through screening exchanged individuals and constructing F2:3 and F3:4 families, the FL-10.1 locus was finely mapped to 222.8-223.2 Mb, narrowing the region to 400 kb. This region contains 10 genes. Combining sequence difference analysis, expression analysis, and functional annotation, CaFL1 was identified as an important candidate gene for FL-10.1, and its sequence was cloned. This gene sequence is located at positions 223149054-223151590 on chromosome 10 of the Qiemen reference genome. (See [link to Qiemen reference genome]). Figure 3 .
[0093] See Figure 4There were seven differences in the CDS sequences of CaFL1, the fruit length regulating gene for RILs-20 and RILs-126, including one InDel and six SNPs. The InDel resulted in a non-frameshift mutation in the amino acid sequence, while the six SNPs resulted in four synonymous mutations and two non-synonymous mutations. The inventors focused on three of these variations, as detailed in [link to documentation]. Figure 3 and 4 This includes: one non-frameshift mutation (a deletion of 3 bases) located at positions 70-72 of the open reading frame (OPF) of the gene, in which the RILs-126 strain has or has inserted the three nucleotides GAC at positions 70-72, while the RILs-20 strain has a deletion of the three nucleotides GAC at positions 70-72; and two non-synonymous mutations, one located at position 443 of the ORF of the gene, in which the nucleotide base at position 443 of the RILs-126 strain is C, while the nucleotide base at position 443 of the RILs-20 strain is A; and the other located at position 1349 of the ORF of the gene, in which the nucleotide base at position 1349 of the RILs-126 strain is C, while the nucleotide base at position 1349 of the RILs-20 strain is T. KASP marker primers were designed for three variations, and they were found to effectively distinguish between long-fruited and short-fruited parents and the F1 generation. Ultimately, the marker KASP70-72, which showed the best genotyping performance, was selected for genotyping of 96 randomly selected individuals from the new F2 population. The KASP70-72 marker indicates a three-base deletion or insertion of GAC (gamma-carbonyl group) at positions 223149123-223149125 on chromosome 10 of pepper.
[0094] The genomic nucleotide sequence of the CaFL1 gene is shown in SEQ ID No. 1 of the sequence listing.
[0095] The nucleotide sequence encoding the CaFL1 gene, also known as the CDS sequence or ORF, is shown in SEQ ID No. 2 of the sequence listing. This gene or the protein it encodes has the function of controlling the elongation of pepper fruits. The nucleotide sequence encoding the CaFL1 gene of the RILs-126 strain is shown in SEQ ID No. 2 of the sequence listing.
[0096] 1.7 Primer design for fruit length linkage marker KASP70-72
[0097] The insertion / deletion site of the three GAC bases at positions 70-72 bp of the CaFL1 gene is the marker site for KASP70-72. Primers were designed and synthesized to determine the genotype of this marker. Two of them are allele-specific forward primers, and one is a universal reverse primer. The allele-specific forward primers will produce different fluorescent signals through competitive PCR.
[0098] The KASP70-72 primer sequence is as follows:
[0099] KASP70-72-X:
[0100] 5'- GAAGGTGACCAAGTTCATGCT AGCCCAAATTCTAAGGAAAAGTCTG-3' (SEQ ID No. 6), where the underlined portion is the fluorescent linker sequence FAM.
[0101] KASP70-72-Y:
[0102] 5'- GAAGGTCGGAGTCAACGGATT GAGCCCAAATTCTAAGGAAAAGTCTA-3' (SEQ ID No. 7), where the underlined portion is the fluorescent linker sequence HEX.
[0103] KASP70-72-C:
[0104] 5'-GCTAGAGAAGTACTAGTATATGATTATTTCAAC-3' (SEQ ID No. 5).
[0105] Example 2: Application of the molecular markers developed in Example 1
[0106] (1) 48 pepper plants that had not undergone genotyping and phenotyping identification, as well as parental RILs-20 and RILs-126 and F1 generation plants, were randomly selected from the new F2 population constructed in Section 1.5 of Example 1. Leaves were taken according to the method described in Example 1.1, and genomic DNA of each plant was extracted using the CTAB method.
[0107] (2) The 51 DNA samples extracted in step (1) were amplified using the KASP70-72 primer sequences (SEQ ID No. 6, SEQ ID No. 7 and SEQ ID No. 5, synthesized by Sangon Biotech (Shanghai) Co., Ltd.) designed in Section 1.7 of Example 1. The typing system is shown in Table 1.
[0108] Table 1 Classification System
[0109] 2X Master Mix (LGC Biosearch Technologies, USA) 5ul KASP70-72-X(10uM) 0.2ul KASP70-72-Y(10uM) 0.2ul KASP70-72-C(10uM) 0.5ul DNA template 10ng <![CDATA[ddH2O]]> Add to 10ul
[0110] The PCR reaction procedure is as follows:
[0111] Step 1: Pre-denaturation 95℃ for 10 min; Step 2: Landing PCR, 95℃ for 15 s, 61℃→55℃, -0.6℃ / cycle 60 s, 10 cycles; Step 3: Amplification, 95℃ for 15 s, 55℃ for 60 s, 28 cycles; Step 4: Plate reading, 30℃ for 30 s.
[0112] The PCR amplification products were subjected to fluorescence signal detection and analysis. The genotype of the molecular marker KASP70-72 of each individual plant was counted. The phenotype of pepper fruit length of each individual plant was predicted based on the genotype. When the fluorescence signal is blue, the genotype of molecular marker KASP70-72 is InGAC:InGAC (i.e., the nucleotide GAC is inserted at positions 223149123-223149125 of one allele on chromosome 10), predicting that the tested pepper will have a long fruit phenotype; when the fluorescence signal is green, the genotype is InGAC:DelGAC (i.e., the nucleotide GAC is inserted at positions 223149123-223149125 of one allele on chromosome 10, and the other allele is missing the nucleotide GAC), and the pepper will have an intermediate phenotype; when the fluorescence signal is red, the genotype is DelGAC:DelGAC (i.e., the nucleotide GAC is missing at positions 223149123-223149125 of one allele on chromosome 10), and the pepper will have a short fruit phenotype.
[0113] The results of genotyping testing are as follows Figure 5 As shown. Figure 5 The genotyping results of the KASP70-72 markers on the parents (RILs-20 and RILs-126), F1, and 48 F2 individual plants are shown. Blue circles represent genotype InGAC:InGAC, predicting long fruit length phenotype for the corresponding line; green circles represent genotype InGAC:DelGAC, predicting intermediate fruit length phenotype for the corresponding line; and red circles represent genotype DelGAC:DelGAC, predicting short fruit length phenotype for the corresponding line.
[0114] (3) Plant the chili pepper plants in step (1) according to the method described in Section 1.1 of Example 1 and investigate the fruit length phenotype of each chili pepper plant. According to Section 1.5 of Example 1, chili pepper plants with a fruit length of 12cm±4cm are identified as having a short fruit phenotype, chili pepper plants with a fruit length of 26cm±4cm are identified as having a long fruit phenotype, and chili pepper plants with a fruit length greater than 16cm and less than 22cm are identified as having an intermediate phenotype.
[0115] (4) The genotypes counted in step (2) and the phenotypes counted in step (3) are listed in Table 2 for comparison and analysis. As can be seen from Table 2, the genotype prediction results are 100% consistent with the phenotype identification results.
[0116] Table 2 Genotypes and phenotypes of parents RILs-20 and RILs-126, F1 and 48 F2 single plants
[0117]
[0118]
[0119] In summary, the molecular marker located on the CaFL1 gene on chromosome 10 of chili pepper provided by this invention is closely linked to the fruit length phenotype of chili pepper. Different genotypes correspond to different fruit length phenotypes. Specifically, when the genotype of the molecular marker in the tested chili pepper germplasm is detected as InGAC:InGAC, it can be determined that the chili pepper germplasm has a long fruit phenotype. When the genotype of the molecular marker is detected as InGAC:DelGAC, it can be determined that the chili pepper germplasm has an intermediate phenotype. When the genotype of the molecular marker is detected as DelGAC:DelGAC, it can be determined that the chili pepper germplasm has a short fruit phenotype.
[0120] This molecular marker can significantly improve the screening efficiency for the single trait of pepper fruit length and accelerate the breeding process of superior varieties. Furthermore, the molecular marker site provided by this invention can serve as a target for genetic engineering breeding. By mutating this site to the InGAC:InGAC genotype through gene mutation or other methods, a rapid and effective approach can be provided for the genetic improvement of pepper fruit length, which has significant application value for pepper germplasm innovation.
[0121] Obviously, those skilled in the art can make various modifications and variations to this technical solution without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this technical solution and their equivalents, this technical solution also intends to include these modifications and variations.
Claims
1. The application of reagents for detecting genotypes of molecular markers closely linked to genes regulating pepper fruit length in either (a) or (b) below: (a) Application in the selection of peppers with different fruit lengths; (b) Application in determining the fruit length of chili peppers; The molecular marker is an insertion / deletion of three nucleotides GAC at positions 223149123-223149125 on chromosome 10 of the pepper genome. The position of the molecular marker in the genome was determined based on the Qiemen reference genome. The chili peppers mentioned are BVRC1, BVRC25, or their hybrid offspring; When the genotype of the molecular marker is InGAC : InGAC, the pepper has a long fruit phenotype; when the genotype of the molecular marker is InGAC : DelGAC, the pepper has an intermediate phenotype; when the genotype of the molecular marker is DelGAC : DelGAC, the pepper has a short fruit phenotype.
2. The application according to claim 1, characterized in that, The reagent includes a primer set, which comprises: The first forward primer contains the nucleotide sequence shown in SEQ ID No. 3 of the sequence listing; The second forward primer contains the nucleotide sequence shown in SEQ ID No. 4 of the sequence listing; The universal reverse primer has the nucleotide sequence shown in SEQ ID No. 5 of the sequence listing.
3. The application according to claim 2, characterized in that, The 5' ends of the first forward primer and the second forward primer are respectively connected to different fluorescent adapter sequences; The fluorescent linker sequence is selected from one of FAM, HEX, FITC, RED, TET, JOE, and R110.
4. The application according to claim 3, characterized in that, The nucleotide sequence of the first forward primer is shown in SEQ ID No. 6, and the nucleotide sequence of the second forward primer is shown in SEQ ID No.
7.
5. A method for determining the length of a chili pepper fruit, comprising the following steps: (1) Extract genomic DNA from the pepper samples to be tested; (2) Using the genomic DNA of the pepper sample to be tested as a template, PCR amplification is performed using the primer set described in any one of claims 2-4 to obtain PCR amplification products; (3) Analyze the PCR amplification products, determine the genotype of the molecular marker closely linked to the gene regulating pepper fruit length based on the analysis results, and predict the fruit length phenotype of the pepper sample to be tested based on the genotype of the molecular marker; the molecular marker is the insertion / deletion of three nucleotides GAC at positions 223149123-223149125 on chromosome 10 of the pepper genome, and the position of the molecular marker in the genome is determined according to the Qiemen reference genome; in, The method for predicting the fruit length phenotype of the pepper sample to be tested from the genotype of the molecular marker is as follows: When the genotype of the molecular marker is InGAC : InGAC, the pepper is predicted to have a long fruit phenotype; when the genotype of the molecular marker is InGAC : DelGAC, the pepper is predicted to have an intermediate phenotype; when the genotype of the molecular marker is DelGAC : DelGAC, the pepper is predicted to have a short fruit phenotype. The chili peppers mentioned are BVRC1, BVRC25, or their hybrid offspring.